Starting /dee2/code/volunteer_pipeline.sh SRR7170173 current disk space = 3051980808192 free memory = 1464941548 SRR7170173 SRAfilesize da8282bc43feafbd1d3637b0d046590c SRR7170173.sra SRR7170173.sra file validated SRR7170173 is paired end SRR7170173 is conventional basespace SRR7170173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8285 34.0 33.0 34.0 33.0 34.0 2 33.34675 34.0 33.0 34.0 33.0 34.0 3 33.3835 34.0 33.0 34.0 33.0 34.0 4 33.42925 34.0 33.0 34.0 33.0 34.0 5 33.32125 34.0 33.0 34.0 33.0 34.0 6 36.87175 38.0 37.0 38.0 35.0 38.0 7 37.17525 38.0 38.0 38.0 36.0 38.0 8 37.3055 38.0 38.0 38.0 37.0 38.0 9 37.32375 38.0 38.0 38.0 37.0 38.0 10-14 37.309200000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.24015 38.0 38.0 38.0 36.2 38.0 20-24 37.205349999999996 38.0 38.0 38.0 36.2 38.0 25-29 37.086949999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.09715 38.0 38.0 38.0 36.0 38.0 35-39 36.965450000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.58315 38.0 38.0 38.0 34.2 38.0 45-49 36.36995 38.0 37.0 38.0 33.6 38.0 50-54 36.19625 38.0 37.0 38.0 33.0 38.0 55-59 36.081450000000004 38.0 37.0 38.0 33.0 38.0 60-64 35.9875 38.0 37.0 38.0 32.2 38.0 65-69 35.94745 38.0 37.0 38.0 31.6 38.0 70-74 35.7685 38.0 36.6 38.0 31.4 38.0 75-79 35.62765 38.0 36.0 38.0 29.8 38.0 80-84 35.4734 38.0 36.0 38.0 29.0 38.0 85-89 35.3086 38.0 36.0 38.0 28.8 38.0 90-94 35.118199999999995 38.0 36.0 38.0 28.8 38.0 95-99 34.873900000000006 38.0 35.4 38.0 27.8 38.0 100-104 34.71645 38.0 35.0 38.0 26.8 38.0 105-109 34.3158 38.0 34.2 38.0 24.8 38.0 110-114 34.034299999999995 38.0 34.0 38.0 23.6 38.0 115-119 33.58285 38.0 33.8 38.0 17.8 38.0 120-124 33.43985 37.8 33.8 38.0 20.2 38.0 125-129 32.65845 37.0 32.6 38.0 15.0 38.0 130-134 32.18975 36.6 31.4 38.0 15.0 38.0 135-139 31.57765 36.0 30.4 38.0 14.2 38.0 140-144 30.624000000000002 35.6 28.0 38.0 13.4 38.0 145-149 29.2224 35.0 25.6 38.0 4.2 38.0 150-151 24.056375000000003 30.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 3.0 13 3.0 14 2.0 15 5.0 16 6.0 17 5.0 18 11.0 19 10.0 20 6.0 21 21.0 22 10.0 23 26.0 24 16.0 25 28.0 26 31.0 27 49.0 28 58.0 29 67.0 30 92.0 31 119.0 32 163.0 33 215.0 34 324.0 35 546.0 36 1147.0 37 1031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.79527559055118 13.893827787655574 12.750825501651002 35.56007112014224 2 22.680670167541887 19.829957489372344 33.88347086771693 23.605901475368842 3 19.55 26.900000000000002 25.424999999999997 28.125 4 23.0 33.45 21.65 21.9 5 21.21896162528217 35.71607725106596 23.225482819162277 19.839478304489592 6 17.625 36.0 25.324999999999996 21.05 7 13.875000000000002 23.125 43.5 19.5 8 17.724999999999998 22.025 30.099999999999998 30.15 9 19.05 23.325000000000003 31.125000000000004 26.5 10-14 20.349999999999998 29.654999999999998 26.69 23.305 15-19 20.44 29.015 27.439999999999998 23.105 20-24 20.555 28.62 26.87 23.955000000000002 25-29 20.21 29.175 27.115000000000002 23.5 30-34 19.580000000000002 29.65 27.265 23.505000000000003 35-39 20.335 28.88 27.375 23.41 40-44 20.369999999999997 28.470000000000002 27.465 23.695 45-49 20.41 29.14 27.395000000000003 23.055 50-54 20.345 28.389999999999997 27.584999999999997 23.68 55-59 20.655 29.14 26.66 23.544999999999998 60-64 19.905 28.744999999999997 27.525 23.825 65-69 20.1 28.410000000000004 27.700000000000003 23.79 70-74 20.305 27.93 27.250000000000004 24.515 75-79 20.39 28.904999999999998 27.175 23.53 80-84 20.419999999999998 28.425 26.924999999999997 24.23 85-89 20.925 29.005 26.86 23.21 90-94 20.044999999999998 28.854999999999997 27.200000000000003 23.9 95-99 20.575 28.360000000000003 27.169999999999998 23.895 100-104 20.919999999999998 28.560000000000002 27.325 23.195 105-109 20.755000000000003 28.525 27.04 23.68 110-114 20.84 28.435 26.82 23.905 115-119 20.915 28.7 26.765 23.62 120-124 20.8 28.315 26.705000000000002 24.18 125-129 21.154999999999998 27.994999999999997 27.055 23.794999999999998 130-134 20.630000000000003 28.575 26.99 23.805 135-139 20.880000000000003 28.57 26.75 23.799999999999997 140-144 21.09 28.415000000000003 26.840000000000003 23.655 145-149 21.27 28.1 26.229999999999997 24.4 150-151 20.1179718875502 29.103915662650603 26.556224899598398 24.2218875502008 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 2.0 21 2.0 22 2.0 23 2.5 24 4.0 25 5.5 26 4.5 27 5.5 28 8.0 29 16.0 30 20.5 31 23.0 32 29.0 33 34.5 34 42.0 35 64.0 36 101.0 37 114.5 38 136.0 39 169.5 40 183.5 41 207.0 42 238.0 43 246.0 44 260.0 45 272.5 46 263.0 47 249.0 48 237.5 49 208.5 50 169.0 51 147.5 52 123.5 53 103.5 54 77.0 55 48.5 56 36.0 57 33.0 58 28.5 59 26.0 60 17.0 61 6.0 62 6.0 63 5.5 64 4.0 65 2.0 66 1.5 67 1.5 68 1.5 69 3.5 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.025 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.1624999999999996 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.1375 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 5.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTA 15 1.1411342E-4 145.0 7 CGTATTC 10 0.006830828 145.0 3 >>END_MODULE SRR7170173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.795 33.0 33.0 34.0 32.0 34.0 2 32.93975 34.0 33.0 34.0 32.0 34.0 3 32.73125 34.0 33.0 34.0 32.0 34.0 4 32.48625 34.0 33.0 34.0 32.0 34.0 5 32.581 34.0 33.0 34.0 32.0 34.0 6 36.7505 38.0 38.0 38.0 36.0 38.0 7 36.84675 38.0 38.0 38.0 36.0 38.0 8 36.73725 38.0 38.0 38.0 36.0 38.0 9 36.8285 38.0 38.0 38.0 36.0 38.0 10-14 36.583800000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.509350000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.607749999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.730149999999995 38.0 38.0 38.0 36.2 38.0 30-34 36.714999999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.5098 38.0 38.0 38.0 35.8 38.0 40-44 36.36535 38.0 38.0 38.0 35.6 38.0 45-49 36.3909 38.0 38.0 38.0 35.0 38.0 50-54 36.45215 38.0 38.0 38.0 35.2 38.0 55-59 36.429449999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.3916 38.0 38.0 38.0 35.0 38.0 65-69 36.3674 38.0 38.0 38.0 34.2 38.0 70-74 36.3174 38.0 38.0 38.0 34.0 38.0 75-79 36.22115 38.0 38.0 38.0 34.0 38.0 80-84 36.0592 38.0 38.0 38.0 33.8 38.0 85-89 35.647800000000004 38.0 38.0 38.0 32.4 38.0 90-94 35.3996 38.0 38.0 38.0 30.6 38.0 95-99 35.6563 38.0 37.8 38.0 31.0 38.0 100-104 35.68345000000001 38.0 37.6 38.0 31.8 38.0 105-109 35.5469 38.0 37.4 38.0 31.4 38.0 110-114 35.271550000000005 38.0 37.0 38.0 29.4 38.0 115-119 35.0847 38.0 36.8 38.0 29.0 38.0 120-124 34.91085 38.0 36.2 38.0 28.0 38.0 125-129 34.1567 38.0 35.4 38.0 24.0 38.0 130-134 32.98115 38.0 34.6 38.0 14.6 38.0 135-139 32.01005 38.0 33.8 38.0 8.6 38.0 140-144 31.2118 38.0 33.2 38.0 2.0 38.0 145-149 30.598899999999997 38.0 31.2 38.0 2.0 38.0 150-151 26.839375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 6.0 4 0.0 5 1.0 6 1.0 7 1.0 8 2.0 9 3.0 10 2.0 11 0.0 12 5.0 13 7.0 14 6.0 15 5.0 16 6.0 17 11.0 18 8.0 19 9.0 20 7.0 21 23.0 22 15.0 23 14.0 24 22.0 25 23.0 26 27.0 27 31.0 28 50.0 29 55.0 30 60.0 31 70.0 32 125.0 33 141.0 34 153.0 35 260.0 36 558.0 37 2263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.418546365914786 17.218045112781954 17.543859649122805 27.819548872180448 2 26.476476476476474 24.84984984984985 30.705705705705704 17.96796796796797 3 21.089808274470233 26.992936427850655 31.00403632694248 20.91321897073663 4 23.587534836584748 34.25386369394477 22.472764124651633 19.68583734481885 5 23.296314992428066 35.84048460373549 22.614840989399294 18.248359414437154 6 19.702320887991927 36.30171543895055 23.990918264379417 20.0050454086781 7 18.935208437970868 17.37820190858865 41.76293319939729 21.923656454043194 8 21.779682379631964 22.68716914544996 26.77085959163096 28.76228888328712 9 21.566658297765503 24.930956565402962 28.14461461210143 25.357770524730107 10-14 22.971058490184173 27.81825541388383 27.008702691762803 22.201983404169194 15-19 23.058215534275725 27.58271267163196 27.906976744186046 21.452095049906266 20-24 23.000353696124503 27.800515385781416 27.704512151988276 21.494618766105805 25-29 23.684608025779166 27.7629525200141 27.536377825889936 21.016061628316802 30-34 22.77970883078938 27.605662183265327 27.907913958994506 21.706715026950786 35-39 23.01655612374057 28.003645385043797 27.330261758898285 21.64953673231735 40-44 22.844958879074017 27.875926489998985 27.82008325718347 21.459031373743528 45-49 23.272192946899068 27.81718686663964 27.497973246858532 21.412646939602755 50-54 23.769168684422922 27.527239709443098 27.597861178369655 21.10573042776433 55-59 23.540090771558244 26.94906707009582 28.38124054462935 21.12960161371659 60-64 22.929389794579315 27.75955180941806 27.865542825417656 21.44551557058497 65-69 23.417085427135678 27.25125628140703 28.542713567839193 20.78894472361809 70-74 23.556801682271068 27.5171481500025 27.942722675612075 20.983327492114352 75-79 23.176953085925778 27.513253976192857 28.19845953786136 21.111333400020005 80-84 23.621217443669394 27.711145681738348 27.620815978320874 21.04682089627139 85-89 23.552457515009667 27.59743563651165 27.775516434313623 21.074590414165055 90-94 23.065157540532272 28.132966248597942 27.699602324869993 21.102273885999796 95-99 23.8358089120835 27.388598956242472 28.0760738659173 20.699518265756726 100-104 23.841723015276735 27.317806160781366 27.878787878787882 20.96168294515402 105-109 23.771727117452023 26.946649251481965 27.896111725108007 21.385511905958 110-114 23.80043209566397 27.97065768979551 27.76465859418178 20.464251620358738 115-119 23.605687393611696 27.680985280865123 28.011414839291078 20.701912486232104 120-124 23.879327596557935 27.096257754652793 28.427056233740245 20.59735841504903 125-129 23.807838179519596 27.56510745891277 27.802781289506957 20.824273072060684 130-134 24.55523376086057 27.58067852709971 27.741001241208107 20.12308647083161 135-139 24.480845442536328 27.963011889035666 27.254953764861295 20.30118890356671 140-144 24.695056708752407 27.878236678793066 27.23625080248235 20.19045580997218 145-149 24.621952474025306 28.129822034770086 26.926242156156775 20.321983335047836 150-151 25.050916496945007 26.578411405295316 27.64765784114053 20.723014256619145 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 2.5 7 3.0 8 0.5 9 2.5 10 4.0 11 3.0 12 3.0 13 3.0 14 1.5 15 0.5 16 1.5 17 1.0 18 1.0 19 1.5 20 1.5 21 1.0 22 1.5 23 3.5 24 4.5 25 4.0 26 2.0 27 2.5 28 5.5 29 7.0 30 10.0 31 15.0 32 18.5 33 29.5 34 46.0 35 56.0 36 70.0 37 101.0 38 129.5 39 153.5 40 177.0 41 203.0 42 242.5 43 294.0 44 292.0 45 256.5 46 269.5 47 273.5 48 252.0 49 215.5 50 173.0 51 149.0 52 121.0 53 96.0 54 74.0 55 52.5 56 41.5 57 27.0 58 14.5 59 18.0 60 18.5 61 9.5 62 8.0 63 7.0 64 5.0 65 3.0 66 2.0 67 3.0 68 2.0 69 1.0 70 2.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.1 3 0.8999999999999999 4 1.325 5 0.95 6 0.8999999999999999 7 0.44999999999999996 8 0.8250000000000001 9 0.42500000000000004 10-14 1.18 15-19 1.315 20-24 1.045 25-29 0.695 30-34 0.745 35-39 1.2449999999999999 40-44 1.51 45-49 1.32 50-54 0.88 55-59 0.8500000000000001 60-64 0.935 65-69 0.5 70-74 0.135 75-79 0.03 80-84 0.365 85-89 1.73 90-94 1.9300000000000002 95-99 0.36 100-104 0.17500000000000002 105-109 0.47000000000000003 110-114 0.485 115-119 0.13 120-124 0.06 125-129 1.125 130-134 3.32 135-139 5.375 140-144 6.54 145-149 2.79 150-151 1.7999999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.0875000000000004 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.7874999999999996 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCAG 10 0.0069845165 143.925 9 >>END_MODULE Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788807 spots for SRR7170173.sra Written 788807 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra Read 788804 spots for SRR7170173.sra Written 788804 spots for SRR7170173.sra SRR ids: ['SRR7170173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lt23gio4 SRR7170173.sra spots: 15776083 blocks: [[1, 788804], [788805, 1577608], [1577609, 2366412], [2366413, 3155216], [3155217, 3944020], [3944021, 4732824], [4732825, 5521628], [5521629, 6310432], [6310433, 7099236], [7099237, 7888040], [7888041, 8676844], [8676845, 9465648], [9465649, 10254452], [10254453, 11043256], [11043257, 11832060], [11832061, 12620864], [12620865, 13409668], [13409669, 14198472], [14198473, 14987276], [14987277, 15776083]] SRR7170173 file size 5324296 SRR7170173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170173 SRR7170173_1.fastq SRR7170173_2.fastq Input file: SRR7170173_1.fastq Paired file: SRR7170173_2.fastq trimmed: SRR7170173-trimmed-pair1.fastq, SRR7170173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:54:00 2025 >> started Wed Feb 12 16:54:18 2025 >> done (17.685s) 15776083 read pairs processed; of these: 33430 ( 0.21%) short read pairs filtered out after trimming by size control 36358 ( 0.23%) empty read pairs filtered out after trimming by size control 15706295 (99.56%) read pairs available; of these: 9172783 (58.40%) trimmed read pairs available after processing 6533512 (41.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 8 0.00% 27 5 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 9 0.00% 32 11 0.00% 33 5 0.00% 34 6 0.00% 35 10 0.00% 36 16 0.00% 37 16 0.00% 38 19 0.00% 39 23 0.00% 40 21 0.00% 41 23 0.00% 42 38 0.00% 43 25 0.00% 44 38 0.00% 45 50 0.00% 46 45 0.00% 47 48 0.00% 48 60 0.00% 49 61 0.00% 50 73 0.00% 51 83 0.00% 52 91 0.00% 53 103 0.00% 54 116 0.00% 55 128 0.00% 56 134 0.00% 57 143 0.00% 58 192 0.00% 59 220 0.00% 60 199 0.00% 61 251 0.00% 62 272 0.00% 63 306 0.00% 64 367 0.00% 65 460 0.00% 66 540 0.00% 67 671 0.00% 68 730 0.00% 69 862 0.01% 70 1009 0.01% 71 1016 0.01% 72 1096 0.01% 73 1182 0.01% 74 1218 0.01% 75 1371 0.01% 76 1515 0.01% 77 1659 0.01% 78 1861 0.01% 79 2093 0.01% 80 2459 0.02% 81 2758 0.02% 82 3194 0.02% 83 3675 0.02% 84 4915 0.03% 85 5708 0.04% 86 5992 0.04% 87 6182 0.04% 88 6666 0.04% 89 6950 0.04% 90 7297 0.05% 91 7912 0.05% 92 8408 0.05% 93 8960 0.06% 94 9637 0.06% 95 10228 0.07% 96 10780 0.07% 97 11408 0.07% 98 11842 0.08% 99 12619 0.08% 100 13492 0.09% 101 14154 0.09% 102 15229 0.10% 103 15862 0.10% 104 17006 0.11% 105 18155 0.12% 106 18786 0.12% 107 19872 0.13% 108 20514 0.13% 109 21028 0.13% 110 21812 0.14% 111 23162 0.15% 112 24478 0.16% 113 25943 0.17% 114 27010 0.17% 115 28475 0.18% 116 29305 0.19% 117 30565 0.19% 118 31710 0.20% 119 32543 0.21% 120 34624 0.22% 121 36224 0.23% 122 38507 0.25% 123 40636 0.26% 124 42758 0.27% 125 44895 0.29% 126 47146 0.30% 127 49641 0.32% 128 51684 0.33% 129 54507 0.35% 130 58161 0.37% 131 60694 0.39% 132 64888 0.41% 133 69332 0.44% 134 74443 0.47% 135 80445 0.51% 136 86646 0.55% 137 94039 0.60% 138 103794 0.66% 139 113945 0.73% 140 124344 0.79% 141 136063 0.87% 142 153451 0.98% 143 175137 1.12% 144 203996 1.30% 145 242529 1.54% 146 301605 1.92% 147 404594 2.58% 148 594342 3.78% 149 1112143 7.08% 150 3860322 24.58% 151 6533512 41.60% 15706295 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=40 prefix-density=0.28 prefix-fanout=2.3 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=236.21 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.8 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=35 prefix-density=0.30 prefix-fanout=2.1 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=25.65 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=8.5 sequence=TTGATGTTGTGA SRR7170173 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:55:03 Started mapping on | Feb 12 16:55:03 Finished on | Feb 12 16:56:46 Mapping speed, Million of reads per hour | 548.96 Number of input reads | 15706295 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14680462 Uniquely mapped reads % | 93.47% Average mapped length | 292.41 Number of splices: Total | 13242778 Number of splices: Annotated (sjdb) | 12995165 Number of splices: GT/AG | 13054435 Number of splices: GC/AG | 147655 Number of splices: AT/AC | 11499 Number of splices: Non-canonical | 29189 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285568 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 48931 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 763363 763363 763363 N_multimapping 285568 285568 285568 N_noFeature 402810 14506517 468866 N_ambiguous 171924 796 63582 UnstrandedReadsAssigned:14105728 PositiveStrandReadsAssigned:173149 NegativeStrandReadsAssigned:14148014 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170173-trimmed-pair1.fastq SRR7170173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,706,295 reads, 14,130,819 reads pseudoaligned [quant] estimated average fragment length: 253.463 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7170173.ke.tsv 34699 SRR7170173.se.tsv 87100 total ==> SRR7170173.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.54 288 11.7613 Potri.005G024800.1.v4.1 1035 782.537 16 1.4742 Potri.004G059700.1.v4.1 961 708.625 2 0.203495 Potri.007G009000.2.v4.1 1416 1163.54 0 0 Potri.003G141000.2.v4.1 2943 2690.54 252.034 6.75398 Potri.016G087400.1.v4.1 270 79.2237 1235 1123.96 Potri.015G069301.1.v4.1 564 319.05 0 0 Potri.010G195200.1.v4.1 1773 1520.54 33 1.56479 Potri.012G127500.1.v4.1 977 724.569 4177 415.647 ==> SRR7170173.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1978 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170173 completed mapping pipeline successfully