Starting /dee2/code/volunteer_pipeline.sh SRR7170174 current disk space = 3051754250240 free memory = 1582050076 SRR7170174 SRAfilesize 165b2fa69068b825976d713ed0c21820 SRR7170174.sra SRR7170174.sra file validated SRR7170174 is paired end SRR7170174 is conventional basespace SRR7170174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33075 34.0 33.0 34.0 33.0 34.0 2 33.43775 34.0 33.0 34.0 33.0 34.0 3 33.459 34.0 34.0 34.0 33.0 34.0 4 33.38975 34.0 34.0 34.0 33.0 34.0 5 33.37025 34.0 34.0 34.0 33.0 34.0 6 36.8445 38.0 37.0 38.0 35.0 38.0 7 37.25075 38.0 38.0 38.0 36.0 38.0 8 37.4545 38.0 38.0 38.0 37.0 38.0 9 37.45175 38.0 38.0 38.0 37.0 38.0 10-14 37.42765 38.0 38.0 38.0 37.0 38.0 15-19 37.45655000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.3515 38.0 38.0 38.0 37.0 38.0 25-29 37.31455 38.0 38.0 38.0 37.0 38.0 30-34 37.26075000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.17095 38.0 38.0 38.0 36.6 38.0 40-44 36.79485 38.0 38.0 38.0 35.0 38.0 45-49 36.67274999999999 38.0 38.0 38.0 34.2 38.0 50-54 36.5832 38.0 38.0 38.0 34.2 38.0 55-59 36.480650000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.4111 38.0 38.0 38.0 34.0 38.0 65-69 36.36005 38.0 37.4 38.0 34.0 38.0 70-74 36.2552 38.0 37.0 38.0 33.4 38.0 75-79 36.029399999999995 38.0 37.0 38.0 32.6 38.0 80-84 35.8781 38.0 37.0 38.0 31.8 38.0 85-89 35.7829 38.0 37.0 38.0 31.0 38.0 90-94 35.5574 38.0 36.4 38.0 29.8 38.0 95-99 35.4207 38.0 36.4 38.0 29.8 38.0 100-104 35.235 38.0 36.0 38.0 29.0 38.0 105-109 34.8964 38.0 35.6 38.0 27.6 38.0 110-114 34.701350000000005 38.0 35.0 38.0 27.0 38.0 115-119 34.25715 38.0 34.6 38.0 24.4 38.0 120-124 33.9756 38.0 34.4 38.0 22.6 38.0 125-129 33.53805 38.0 34.0 38.0 19.4 38.0 130-134 32.8977 38.0 33.4 38.0 15.0 38.0 135-139 32.1416 36.8 32.0 38.0 14.2 38.0 140-144 31.732549999999996 36.2 31.0 38.0 14.0 38.0 145-149 30.7657 36.0 30.6 38.0 8.8 38.0 150-151 25.906125000000003 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 3.0 16 1.0 17 8.0 18 12.0 19 13.0 20 12.0 21 14.0 22 12.0 23 18.0 24 17.0 25 27.0 26 27.0 27 29.0 28 41.0 29 53.0 30 69.0 31 85.0 32 122.0 33 169.0 34 269.0 35 464.0 36 1017.0 37 1508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.69639278557114 13.902805611222444 13.151302605210422 37.24949899799599 2 21.675 19.775000000000002 36.5 22.05 3 20.925 25.275 23.125 30.675 4 23.674999999999997 35.025 19.625 21.675 5 22.25 35.875 23.75 18.125 6 17.05 37.05 25.224999999999998 20.674999999999997 7 13.775 22.400000000000002 44.474999999999994 19.35 8 18.7 21.75 30.525000000000002 29.025000000000002 9 17.724999999999998 23.724999999999998 31.900000000000002 26.650000000000002 10-14 19.73 29.909999999999997 26.740000000000002 23.62 15-19 20.24 28.360000000000003 27.12 24.279999999999998 20-24 19.705000000000002 29.79 27.529999999999998 22.975 25-29 20.14 28.71 27.32 23.830000000000002 30-34 20.325 29.09 27.095000000000002 23.49 35-39 19.71 29.385 27.55 23.355 40-44 20.465 28.82 27.04 23.674999999999997 45-49 20.875 28.384999999999998 27.12 23.62 50-54 20.294999999999998 28.415000000000003 27.474999999999998 23.815 55-59 20.265 28.235 27.465 24.035 60-64 20.09 28.325 27.52 24.065 65-69 20.455000000000002 27.97 27.61 23.965 70-74 20.165 28.24 27.61 23.985 75-79 20.8 28.595 26.93 23.674999999999997 80-84 20.96 28.355000000000004 27.195000000000004 23.49 85-89 20.705000000000002 28.63 27.200000000000003 23.465 90-94 20.36 28.76 26.995 23.885 95-99 20.96 28.485 27.12 23.435 100-104 20.585 28.89 27.02 23.505000000000003 105-109 20.25 28.705000000000002 27.485 23.56 110-114 21.385 28.485 26.465 23.665 115-119 20.965 28.634999999999998 26.924999999999997 23.474999999999998 120-124 21.145 28.46 26.939999999999998 23.455000000000002 125-129 21.05 28.505000000000003 26.735 23.71 130-134 20.815 28.884999999999998 26.295 24.005000000000003 135-139 20.565 28.57 26.595000000000002 24.27 140-144 21.285 28.26 26.85 23.605 145-149 20.979999999999997 29.15 26.22 23.65 150-151 21.240155019377422 28.328541067633456 26.103262907863485 24.32804100512564 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 3.5 26 7.0 27 6.5 28 12.5 29 19.0 30 13.0 31 13.0 32 25.0 33 42.5 34 56.5 35 69.0 36 90.5 37 106.5 38 124.5 39 153.5 40 186.5 41 216.5 42 231.5 43 251.5 44 278.0 45 281.5 46 278.0 47 277.0 48 250.0 49 203.0 50 160.0 51 140.0 52 114.5 53 90.5 54 76.0 55 50.0 56 38.5 57 33.0 58 22.5 59 17.0 60 14.5 61 8.0 62 8.5 63 9.0 64 3.5 65 3.5 66 2.5 67 1.5 68 1.5 69 1.0 70 2.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.4275653923541248 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025150905432595575 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGCT 10 0.006830828 145.0 2 GGCCTTT 10 0.006830828 145.0 5 >>END_MODULE SRR7170174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77675 33.0 33.0 34.0 32.0 34.0 2 32.921 33.0 33.0 34.0 32.0 34.0 3 32.716 34.0 33.0 34.0 32.0 34.0 4 32.432 34.0 33.0 34.0 32.0 34.0 5 32.501 34.0 33.0 34.0 32.0 34.0 6 36.8225 38.0 38.0 38.0 36.0 38.0 7 36.857 38.0 38.0 38.0 36.0 38.0 8 36.8765 38.0 38.0 38.0 36.0 38.0 9 36.921 38.0 38.0 38.0 36.0 38.0 10-14 36.71045 38.0 38.0 38.0 36.0 38.0 15-19 36.52695 38.0 38.0 38.0 35.8 38.0 20-24 36.6303 38.0 38.0 38.0 36.0 38.0 25-29 36.650450000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.66545 38.0 38.0 38.0 36.0 38.0 35-39 36.4379 38.0 38.0 38.0 35.6 38.0 40-44 36.34585 38.0 38.0 38.0 35.4 38.0 45-49 36.265750000000004 38.0 38.0 38.0 34.6 38.0 50-54 36.50750000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.4046 38.0 38.0 38.0 35.0 38.0 60-64 36.33925000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.266000000000005 38.0 38.0 38.0 34.2 38.0 70-74 36.27285 38.0 38.0 38.0 34.0 38.0 75-79 36.0994 38.0 38.0 38.0 34.0 38.0 80-84 36.0621 38.0 38.0 38.0 33.6 38.0 85-89 35.53395 38.0 38.0 38.0 31.4 38.0 90-94 35.11615 38.0 37.4 38.0 29.0 38.0 95-99 35.49614999999999 38.0 37.0 38.0 30.0 38.0 100-104 35.6019 38.0 37.2 38.0 31.6 38.0 105-109 35.28315 38.0 37.0 38.0 29.8 38.0 110-114 35.08165 38.0 37.0 38.0 28.4 38.0 115-119 34.990899999999996 38.0 36.2 38.0 28.4 38.0 120-124 34.68429999999999 38.0 36.0 38.0 26.4 38.0 125-129 34.137649999999994 38.0 35.2 38.0 23.4 38.0 130-134 32.882999999999996 38.0 34.8 38.0 14.0 38.0 135-139 31.57285 38.0 33.4 38.0 4.2 38.0 140-144 30.807100000000002 38.0 32.0 38.0 2.0 38.0 145-149 30.17795 38.0 31.0 38.0 2.0 38.0 150-151 26.266875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 8.0 4 3.0 5 3.0 6 1.0 7 0.0 8 1.0 9 3.0 10 0.0 11 2.0 12 4.0 13 1.0 14 5.0 15 10.0 16 10.0 17 14.0 18 12.0 19 15.0 20 9.0 21 12.0 22 11.0 23 21.0 24 25.0 25 25.0 26 33.0 27 38.0 28 49.0 29 57.0 30 61.0 31 84.0 32 140.0 33 165.0 34 140.0 35 231.0 36 576.0 37 2207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.99499374217772 16.0450563204005 18.072590738423028 29.887359198998748 2 24.55569461827284 26.33291614518148 32.24030037546934 16.871088861076345 3 20.03027245206862 28.43087790110999 29.18768920282543 22.351160443995962 4 23.45773038842346 34.88194973343488 20.91901497842092 20.741304899720742 5 24.290060851926977 37.27180527383367 21.146044624746448 17.2920892494929 6 18.960321446509294 36.13761928679055 24.05826217980914 20.84379708689101 7 18.06564770734152 18.090704084189426 42.37033324981208 21.473314958656978 8 20.67151089952393 23.076923076923077 27.712352793786017 28.539213229766975 9 21.74459527400704 24.283559577677224 28.858722976370032 25.1131221719457 10-14 22.498863693752842 28.301600929245996 26.534013433664967 22.665521943336195 15-19 22.41711446821454 27.59809388624151 28.546081314001825 21.438710331542126 20-24 22.670368500757192 28.263503281171126 27.56183745583039 21.504290762241293 25-29 23.163188332914256 27.75961780236359 27.935629871762636 21.141563992959515 30-34 22.4523737526459 28.071766958975907 27.92561233746598 21.550246950912204 35-39 22.286321542432063 27.73645058448459 27.812357674206773 22.164870198876574 40-44 22.67973192526401 27.57412672623883 28.513403736799347 21.232737611697807 45-49 23.111675126903553 26.908629441624367 28.578680203045685 21.401015228426395 50-54 22.293794977605554 27.55271501182628 28.46359015650949 21.689899854058677 55-59 23.3533538585777 26.992378741230503 28.723565335890576 20.930702064301215 60-64 22.771728171002216 27.384553337366402 28.02984472675943 21.81387376487195 65-69 23.269965801649565 27.31341782337558 28.309193321263326 21.10742305371153 70-74 23.221348820908226 27.417012967506132 28.478445901967657 20.883192309617986 75-79 23.81285964473355 27.31548661496122 28.07605704278209 20.79559669752314 80-84 23.378711006178733 27.56316873461596 28.34681267895715 20.711307580248153 85-89 23.858593072488905 27.261133499974495 28.056930061725243 20.823343365811358 90-94 23.230974632843793 27.493067679983568 28.00143781452193 21.274519872650714 95-99 24.085794655414908 27.908378541289935 27.561784207353828 20.44404259594133 100-104 23.9735298541134 27.447736501729587 27.80869303654685 20.770040607610166 105-109 23.752264037029583 27.887905011068625 27.59609579392232 20.763735157979475 110-114 24.157868275515334 28.009049773755656 26.978381096028155 20.854700854700855 115-119 24.325679334202345 27.564423944650557 27.739897723854405 20.36999899729269 120-124 24.430766151228546 28.19896912375519 26.82279937947255 20.54746534554371 125-129 24.279939363314806 28.236483072258718 26.93279434057605 20.55078322385043 130-134 24.818433564972047 28.115366529076752 26.95020638486859 20.115993521082608 135-139 24.012223234868387 28.022302042566878 27.534444861416397 20.431029861148343 140-144 24.53330447486608 27.93138899410205 27.163032303446784 20.372274227585088 145-149 25.001292724546254 28.25378768292052 26.976575831221883 19.768343761311343 150-151 25.51304788446922 26.80516848239169 27.235875348365845 20.445908284773246 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 1.5 6 1.5 7 1.5 8 3.0 9 2.5 10 1.0 11 1.5 12 2.0 13 3.5 14 2.5 15 0.5 16 1.0 17 3.0 18 3.0 19 3.0 20 3.0 21 0.5 22 2.5 23 3.5 24 5.0 25 5.0 26 4.0 27 5.0 28 6.5 29 9.5 30 11.0 31 15.0 32 21.5 33 32.5 34 44.5 35 61.0 36 82.5 37 97.5 38 113.0 39 146.5 40 190.5 41 226.5 42 250.0 43 270.0 44 277.0 45 284.5 46 285.0 47 260.0 48 238.0 49 214.5 50 171.0 51 148.5 52 121.0 53 94.5 54 77.0 55 49.0 56 36.5 57 22.5 58 18.0 59 13.5 60 8.5 61 8.5 62 7.5 63 4.0 64 4.5 65 5.0 66 2.0 67 1.5 68 3.0 69 2.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.125 3 0.8999999999999999 4 1.525 5 1.4000000000000001 6 0.44999999999999996 7 0.22499999999999998 8 0.22499999999999998 9 0.5499999999999999 10-14 0.9950000000000001 15-19 1.37 20-24 0.95 25-29 0.575 30-34 0.79 35-39 1.195 40-44 1.52 45-49 1.5 50-54 0.645 55-59 0.935 60-64 0.8200000000000001 65-69 0.58 70-74 0.135 75-79 0.075 80-84 0.46499999999999997 85-89 1.9849999999999999 90-94 2.63 95-99 0.45999999999999996 100-104 0.265 105-109 0.62 110-114 0.5499999999999999 115-119 0.27 120-124 0.08499999999999999 125-129 1.05 130-134 4.305 135-139 6.734999999999999 140-144 7.595000000000001 145-149 3.305 150-151 1.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24299772899319 98.32499999999999 2 0.6813020439061317 1.35 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025233409033560434 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.4 0.0 0.0 0.0 0.0 126-127 3.6500000000000004 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.949999999999999 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra Read 872783 spots for SRR7170174.sra Written 872783 spots for SRR7170174.sra Read 872767 spots for SRR7170174.sra Written 872767 spots for SRR7170174.sra SRR ids: ['SRR7170174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_coxec5ag SRR7170174.sra spots: 17455356 blocks: [[1, 872767], [872768, 1745534], [1745535, 2618301], [2618302, 3491068], [3491069, 4363835], [4363836, 5236602], [5236603, 6109369], [6109370, 6982136], [6982137, 7854903], [7854904, 8727670], [8727671, 9600437], [9600438, 10473204], [10473205, 11345971], [11345972, 12218738], [12218739, 13091505], [13091506, 13964272], [13964273, 14837039], [14837040, 15709806], [15709807, 16582573], [16582574, 17455356]] SRR7170174 file size 5893347 SRR7170174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170174 SRR7170174_1.fastq SRR7170174_2.fastq Input file: SRR7170174_1.fastq Paired file: SRR7170174_2.fastq trimmed: SRR7170174-trimmed-pair1.fastq, SRR7170174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:32:34 2025 >> started Wed Feb 12 17:32:55 2025 >> done (21.472s) 17455356 read pairs processed; of these: 24694 ( 0.14%) short read pairs filtered out after trimming by size control 59275 ( 0.34%) empty read pairs filtered out after trimming by size control 17371387 (99.52%) read pairs available; of these: 9678614 (55.72%) trimmed read pairs available after processing 7692773 (44.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 6 0.00% 32 11 0.00% 33 13 0.00% 34 16 0.00% 35 14 0.00% 36 12 0.00% 37 11 0.00% 38 21 0.00% 39 25 0.00% 40 34 0.00% 41 30 0.00% 42 26 0.00% 43 37 0.00% 44 43 0.00% 45 53 0.00% 46 76 0.00% 47 71 0.00% 48 85 0.00% 49 92 0.00% 50 111 0.00% 51 123 0.00% 52 137 0.00% 53 134 0.00% 54 160 0.00% 55 196 0.00% 56 214 0.00% 57 237 0.00% 58 256 0.00% 59 293 0.00% 60 299 0.00% 61 333 0.00% 62 389 0.00% 63 447 0.00% 64 479 0.00% 65 567 0.00% 66 629 0.00% 67 730 0.00% 68 905 0.01% 69 1199 0.01% 70 1580 0.01% 71 1471 0.01% 72 1542 0.01% 73 1653 0.01% 74 1697 0.01% 75 1925 0.01% 76 2116 0.01% 77 2443 0.01% 78 2758 0.02% 79 3026 0.02% 80 3443 0.02% 81 3831 0.02% 82 4321 0.02% 83 5089 0.03% 84 6156 0.04% 85 7031 0.04% 86 7186 0.04% 87 7528 0.04% 88 8296 0.05% 89 8615 0.05% 90 9245 0.05% 91 10184 0.06% 92 10856 0.06% 93 11370 0.07% 94 11929 0.07% 95 12765 0.07% 96 13585 0.08% 97 14402 0.08% 98 14766 0.09% 99 15871 0.09% 100 16322 0.09% 101 17452 0.10% 102 18471 0.11% 103 19510 0.11% 104 20238 0.12% 105 21775 0.13% 106 22365 0.13% 107 23114 0.13% 108 24490 0.14% 109 24904 0.14% 110 25975 0.15% 111 27105 0.16% 112 28478 0.16% 113 29538 0.17% 114 31024 0.18% 115 32765 0.19% 116 33605 0.19% 117 34444 0.20% 118 35947 0.21% 119 37017 0.21% 120 38597 0.22% 121 41008 0.24% 122 42930 0.25% 123 45128 0.26% 124 46874 0.27% 125 49096 0.28% 126 51783 0.30% 127 54154 0.31% 128 56563 0.33% 129 58891 0.34% 130 61475 0.35% 131 64937 0.37% 132 69196 0.40% 133 74147 0.43% 134 78333 0.45% 135 83901 0.48% 136 90091 0.52% 137 96702 0.56% 138 105610 0.61% 139 116444 0.67% 140 126477 0.73% 141 137015 0.79% 142 153958 0.89% 143 172104 0.99% 144 198873 1.14% 145 240889 1.39% 146 298987 1.72% 147 393028 2.26% 148 589580 3.39% 149 1104766 6.36% 150 4197291 24.16% 151 7692773 44.28% 17371387 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.1 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=81.42 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=18.6 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=62.34 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.8 sequence=AGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7170174 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:33:57 Started mapping on | Feb 12 17:33:57 Finished on | Feb 12 17:35:29 Mapping speed, Million of reads per hour | 679.75 Number of input reads | 17371387 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16532635 Uniquely mapped reads % | 95.17% Average mapped length | 292.38 Number of splices: Total | 15455008 Number of splices: Annotated (sjdb) | 15200495 Number of splices: GT/AG | 15235587 Number of splices: GC/AG | 172851 Number of splices: AT/AC | 12696 Number of splices: Non-canonical | 33874 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312993 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 78585 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543203 543203 543203 N_multimapping 312993 312993 312993 N_noFeature 396306 16357585 470421 N_ambiguous 168953 1113 67144 UnstrandedReadsAssigned:15967376 PositiveStrandReadsAssigned:173937 NegativeStrandReadsAssigned:15995070 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170174-trimmed-pair1.fastq SRR7170174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,371,387 reads, 15,934,289 reads pseudoaligned [quant] estimated average fragment length: 248.43 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7170174.ke.tsv 34699 SRR7170174.se.tsv 87100 total ==> SRR7170174.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.57 227 8.09357 Potri.005G024800.1.v4.1 1035 787.57 34 2.72532 Potri.004G059700.1.v4.1 961 713.601 3 0.265395 Potri.007G009000.2.v4.1 1416 1168.57 0 0 Potri.003G141000.2.v4.1 2943 2695.57 296.06 6.93357 Potri.016G087400.1.v4.1 270 81.2431 1581 1228.49 Potri.015G069301.1.v4.1 564 323.284 0 0 Potri.010G195200.1.v4.1 1773 1525.57 24 0.993131 Potri.012G127500.1.v4.1 977 729.589 5459 472.348 ==> SRR7170174.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1495 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170174 completed mapping pipeline successfully