Starting /dee2/code/volunteer_pipeline.sh SRR7170175 current disk space = 3051769749504 free memory = 1582060284 SRR7170175 SRAfilesize 62692b3290e411de82be6e11430f4004 SRR7170175.sra SRR7170175.sra file validated SRR7170175 is paired end SRR7170175 is conventional basespace SRR7170175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.30825 34.0 33.0 34.0 33.0 34.0 2 33.42025 34.0 33.0 34.0 33.0 34.0 3 33.4475 34.0 34.0 34.0 33.0 34.0 4 33.42425 34.0 34.0 34.0 33.0 34.0 5 33.39575 34.0 34.0 34.0 33.0 34.0 6 36.956 38.0 37.0 38.0 36.0 38.0 7 37.31075 38.0 38.0 38.0 36.0 38.0 8 37.42275 38.0 38.0 38.0 37.0 38.0 9 37.44125 38.0 38.0 38.0 37.0 38.0 10-14 37.35979999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.349149999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.3187 38.0 38.0 38.0 37.0 38.0 25-29 37.2654 38.0 38.0 38.0 37.0 38.0 30-34 37.18300000000001 38.0 38.0 38.0 36.4 38.0 35-39 37.11475 38.0 38.0 38.0 36.2 38.0 40-44 36.74804999999999 38.0 38.0 38.0 34.6 38.0 45-49 36.56745 38.0 38.0 38.0 34.2 38.0 50-54 36.46425000000001 38.0 37.8 38.0 34.0 38.0 55-59 36.3942 38.0 37.4 38.0 34.0 38.0 60-64 36.287549999999996 38.0 37.0 38.0 33.2 38.0 65-69 36.2631 38.0 37.0 38.0 33.6 38.0 70-74 36.14375 38.0 37.0 38.0 32.8 38.0 75-79 35.96575 38.0 37.0 38.0 31.4 38.0 80-84 35.81295 38.0 37.0 38.0 31.0 38.0 85-89 35.652699999999996 38.0 36.4 38.0 30.2 38.0 90-94 35.479099999999995 38.0 36.0 38.0 29.0 38.0 95-99 35.24425 38.0 36.0 38.0 29.0 38.0 100-104 35.13965 38.0 36.0 38.0 28.8 38.0 105-109 34.7781 38.0 35.2 38.0 26.8 38.0 110-114 34.608700000000006 38.0 34.8 38.0 26.4 38.0 115-119 34.00785 38.0 34.0 38.0 23.0 38.0 120-124 33.6105 38.0 34.0 38.0 19.4 38.0 125-129 33.160700000000006 37.8 33.2 38.0 15.0 38.0 130-134 32.67985 37.2 32.6 38.0 15.0 38.0 135-139 32.1598 36.6 31.6 38.0 14.6 38.0 140-144 31.52295 36.0 31.0 38.0 14.0 38.0 145-149 30.30555 36.0 29.0 38.0 6.4 38.0 150-151 25.60625 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 1.0 15 2.0 16 6.0 17 3.0 18 5.0 19 10.0 20 12.0 21 11.0 22 14.0 23 21.0 24 26.0 25 25.0 26 42.0 27 27.0 28 50.0 29 62.0 30 80.0 31 96.0 32 120.0 33 178.0 34 297.0 35 494.0 36 1102.0 37 1310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45783132530121 13.20281124497992 11.721887550200803 35.61746987951807 2 21.85 19.2 36.1 22.85 3 19.025 26.85 26.3 27.825 4 23.45 33.575 21.5 21.475 5 21.675 35.525 23.45 19.35 6 16.925 37.625 25.074999999999996 20.375 7 13.025 24.4 42.925000000000004 19.650000000000002 8 18.275 23.400000000000002 29.349999999999998 28.975 9 18.125 24.15 31.3 26.424999999999997 10-14 19.365 30.695 26.655 23.285 15-19 19.915 29.45 27.51 23.125 20-24 20.07 29.075 26.985 23.87 25-29 20.135 29.425 26.924999999999997 23.515 30-34 20.14 28.705000000000002 27.62 23.535 35-39 19.98 29.020000000000003 27.18 23.82 40-44 19.865 28.810000000000002 27.794999999999998 23.53 45-49 20.31 28.95 26.534999999999997 24.205 50-54 19.97 28.93 27.245 23.855 55-59 20.549999999999997 29.24 26.85 23.36 60-64 20.27 28.89 26.69 24.15 65-69 20.169999999999998 28.18 27.79 23.86 70-74 19.794999999999998 29.304999999999996 26.939999999999998 23.96 75-79 20.055 29.115000000000002 26.525 24.305 80-84 20.52 28.605000000000004 27.3 23.575 85-89 20.54 28.02 27.48 23.96 90-94 20.549999999999997 28.46 27.265 23.724999999999998 95-99 20.915 28.565 27.134999999999998 23.385 100-104 20.585 28.994999999999997 26.924999999999997 23.494999999999997 105-109 20.445 28.455000000000002 27.705000000000002 23.395 110-114 21.16 28.439999999999998 26.924999999999997 23.474999999999998 115-119 20.849999999999998 28.144999999999996 27.485 23.52 120-124 20.865000000000002 28.299999999999997 27.325 23.51 125-129 21.235 27.87 26.995 23.9 130-134 20.965 28.4 26.55 24.085 135-139 20.935000000000002 27.839999999999996 26.855 24.37 140-144 21.085 28.205000000000002 27.11 23.599999999999998 145-149 20.905 28.449999999999996 27.015 23.630000000000003 150-151 20.70776541202951 28.173064899337252 26.84756783793923 24.27160185069401 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.0 24 3.0 25 3.0 26 6.0 27 9.0 28 9.5 29 14.5 30 20.5 31 25.5 32 34.0 33 43.5 34 56.5 35 76.5 36 91.0 37 106.0 38 122.5 39 146.5 40 183.5 41 206.0 42 238.5 43 265.0 44 271.0 45 287.0 46 263.0 47 236.5 48 240.0 49 212.5 50 176.5 51 141.0 52 108.0 53 95.0 54 82.5 55 61.5 56 40.0 57 30.5 58 25.0 59 19.5 60 15.0 61 7.0 62 3.0 63 4.0 64 3.0 65 1.5 66 2.0 67 3.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 3.025 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.800000000000001 0.0 0.0 0.0 0.0 134-135 5.3 0.0 0.0 0.0 0.0 136-137 5.762499999999999 0.0 0.0 0.0 0.0 138-139 6.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8 33.0 33.0 34.0 32.0 34.0 2 32.85825 34.0 33.0 34.0 32.0 34.0 3 32.7435 34.0 33.0 34.0 32.0 34.0 4 32.3415 34.0 33.0 34.0 32.0 34.0 5 32.43025 34.0 33.0 34.0 32.0 34.0 6 36.9165 38.0 38.0 38.0 36.0 38.0 7 36.93125 38.0 38.0 38.0 36.0 38.0 8 36.95725 38.0 38.0 38.0 36.0 38.0 9 37.00925 38.0 38.0 38.0 37.0 38.0 10-14 36.90595 38.0 38.0 38.0 36.4 38.0 15-19 36.63915 38.0 38.0 38.0 36.0 38.0 20-24 36.803399999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.92135 38.0 38.0 38.0 36.0 38.0 30-34 36.8945 38.0 38.0 38.0 36.0 38.0 35-39 36.75035 38.0 38.0 38.0 36.0 38.0 40-44 36.56400000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.54695 38.0 38.0 38.0 35.0 38.0 50-54 36.653200000000005 38.0 38.0 38.0 35.4 38.0 55-59 36.6577 38.0 38.0 38.0 35.0 38.0 60-64 36.612199999999994 38.0 38.0 38.0 35.2 38.0 65-69 36.53825 38.0 38.0 38.0 35.0 38.0 70-74 36.47005 38.0 38.0 38.0 34.2 38.0 75-79 36.32790000000001 38.0 38.0 38.0 34.0 38.0 80-84 36.330650000000006 38.0 38.0 38.0 34.0 38.0 85-89 35.894850000000005 38.0 38.0 38.0 33.0 38.0 90-94 35.6052 38.0 38.0 38.0 31.0 38.0 95-99 35.91850000000001 38.0 37.8 38.0 33.0 38.0 100-104 35.84855 38.0 37.8 38.0 32.6 38.0 105-109 35.5961 38.0 37.0 38.0 30.6 38.0 110-114 35.50455 38.0 37.0 38.0 30.8 38.0 115-119 35.181250000000006 38.0 36.6 38.0 28.6 38.0 120-124 34.94445 38.0 36.0 38.0 27.8 38.0 125-129 34.43145 38.0 36.0 38.0 25.0 38.0 130-134 33.18605 38.0 35.0 38.0 15.8 38.0 135-139 31.8667 38.0 33.6 38.0 6.4 38.0 140-144 31.142000000000003 38.0 32.6 38.0 2.0 38.0 145-149 30.28745 38.0 31.0 38.0 2.0 38.0 150-151 26.4755 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 1.0 13 1.0 14 8.0 15 8.0 16 7.0 17 14.0 18 10.0 19 16.0 20 9.0 21 16.0 22 18.0 23 14.0 24 29.0 25 28.0 26 31.0 27 35.0 28 37.0 29 53.0 30 64.0 31 81.0 32 132.0 33 163.0 34 145.0 35 263.0 36 537.0 37 2259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.16516516516517 17.96796796796797 15.165165165165165 26.7017017017017 2 26.282853566958696 25.832290362953692 31.33917396745932 16.545682102628284 3 21.235813366960908 28.524590163934427 29.583858764186633 20.655737704918035 4 24.147582697201017 34.961832061068705 21.424936386768447 19.46564885496183 5 24.644670050761423 36.26903553299493 19.619289340101524 19.467005076142133 6 18.65 36.7 24.55 20.1 7 20.25 18.275 40.550000000000004 20.925 8 21.975 22.45 27.725 27.85 9 21.525 25.324999999999996 28.7 24.45 10-14 23.00065100906405 28.839701537382943 26.29575842555962 21.863889027993388 15-19 23.523196135654626 27.48817550568582 27.664284995471473 21.324343363188085 20-24 22.941618641944377 28.223502881483338 27.070909546479577 21.76396893009271 25-29 22.814999999999998 27.85 27.900000000000002 21.435000000000002 30-34 22.71 27.605 28.410000000000004 21.275 35-39 23.061869637212105 27.959255356515634 27.899041597671737 21.079833408600532 40-44 23.14814814814815 27.641908212560384 28.14512882447665 21.064814814814813 45-49 23.342374924653406 27.531645569620256 28.159533855736385 20.966445649989954 50-54 23.53176588294147 28.129064532266135 27.05352676338169 21.285642821410704 55-59 23.492317701816727 27.77138281367299 28.121715629848353 20.614583854661927 60-64 23.120432475723295 27.890679747722498 28.47632395635199 20.512563820202224 65-69 23.05575017515764 27.359623661295167 28.640776699029125 20.943849464518067 70-74 23.415 28.025 27.74 20.82 75-79 23.799999999999997 27.16 28.315 20.724999999999998 80-84 23.405 27.794999999999998 28.139999999999997 20.66 85-89 24.253580794835585 27.884809360500302 27.319951583619122 20.541658261044986 90-94 23.71411179872172 27.564167596631833 27.86344729633763 20.858273308308817 95-99 23.810000000000002 27.61 27.865000000000002 20.715 100-104 23.625 27.47 28.084999999999997 20.82 105-109 23.82 28.065 27.650000000000002 20.465 110-114 24.169999999999998 27.24 27.775 20.815 115-119 24.490000000000002 27.665 27.74 20.105 120-124 24.02 27.595 27.855 20.53 125-129 24.438977860334354 28.018474823033284 27.3106079622471 20.23193935438526 130-134 24.698950850173134 28.177166778644892 27.133185177528556 19.99069719365342 135-139 24.83847050100625 27.417646435758925 27.396462239169576 20.347420824065246 140-144 24.898330479452056 27.39190924657534 27.49892979452055 20.210830479452056 145-149 24.956530633118543 27.999386314820494 26.787358085302237 20.256724966758718 150-151 25.216844751728473 27.73098680075424 26.763042111879322 20.289126335637963 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 3.0 27 4.0 28 7.0 29 11.5 30 9.0 31 13.0 32 23.5 33 36.0 34 47.5 35 61.0 36 78.0 37 92.0 38 124.5 39 164.5 40 202.0 41 226.5 42 249.5 43 263.5 44 258.0 45 280.0 46 293.5 47 266.0 48 241.5 49 210.0 50 181.5 51 171.0 52 129.5 53 82.0 54 64.5 55 55.5 56 44.0 57 26.0 58 14.5 59 16.5 60 12.5 61 8.0 62 7.5 63 5.5 64 4.0 65 2.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.125 3 0.8750000000000001 4 1.7500000000000002 5 1.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.155 15-19 0.63 20-24 0.22499999999999998 25-29 0.0 30-34 0.0 35-39 0.35500000000000004 40-44 0.64 45-49 0.45999999999999996 50-54 0.05 55-59 0.095 60-64 0.11 65-69 0.09 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.86 90-94 1.43 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.40499999999999997 130-134 3.2550000000000003 135-139 5.59 140-144 6.5600000000000005 145-149 2.23 150-151 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.6375 0.0 0.0 0.0 0.0 134-135 5.1375 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 5.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTCT 10 0.0070117936 143.7375 6 >>END_MODULE Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904982 spots for SRR7170175.sra Written 904982 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra Read 904963 spots for SRR7170175.sra Written 904963 spots for SRR7170175.sra SRR ids: ['SRR7170175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_06xq5z1x SRR7170175.sra spots: 18099279 blocks: [[1, 904963], [904964, 1809926], [1809927, 2714889], [2714890, 3619852], [3619853, 4524815], [4524816, 5429778], [5429779, 6334741], [6334742, 7239704], [7239705, 8144667], [8144668, 9049630], [9049631, 9954593], [9954594, 10859556], [10859557, 11764519], [11764520, 12669482], [12669483, 13574445], [13574446, 14479408], [14479409, 15384371], [15384372, 16289334], [16289335, 17194297], [17194298, 18099279]] SRR7170175 file size 6111551 SRR7170175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170175 SRR7170175_1.fastq SRR7170175_2.fastq Input file: SRR7170175_1.fastq Paired file: SRR7170175_2.fastq trimmed: SRR7170175-trimmed-pair1.fastq, SRR7170175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:30:17 2025 >> started Wed Feb 12 17:30:39 2025 >> done (22.490s) 18099279 read pairs processed; of these: 27168 ( 0.15%) short read pairs filtered out after trimming by size control 26880 ( 0.15%) empty read pairs filtered out after trimming by size control 18045231 (99.70%) read pairs available; of these: 10085875 (55.89%) trimmed read pairs available after processing 7959356 (44.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 6 0.00% 24 11 0.00% 25 7 0.00% 26 8 0.00% 27 12 0.00% 28 5 0.00% 29 5 0.00% 30 15 0.00% 31 11 0.00% 32 10 0.00% 33 15 0.00% 34 11 0.00% 35 15 0.00% 36 12 0.00% 37 11 0.00% 38 18 0.00% 39 29 0.00% 40 26 0.00% 41 26 0.00% 42 26 0.00% 43 30 0.00% 44 36 0.00% 45 42 0.00% 46 57 0.00% 47 48 0.00% 48 67 0.00% 49 81 0.00% 50 89 0.00% 51 101 0.00% 52 116 0.00% 53 115 0.00% 54 145 0.00% 55 146 0.00% 56 158 0.00% 57 171 0.00% 58 221 0.00% 59 259 0.00% 60 304 0.00% 61 332 0.00% 62 401 0.00% 63 439 0.00% 64 492 0.00% 65 523 0.00% 66 626 0.00% 67 633 0.00% 68 850 0.00% 69 1077 0.01% 70 1258 0.01% 71 1210 0.01% 72 1325 0.01% 73 1413 0.01% 74 1586 0.01% 75 1755 0.01% 76 1960 0.01% 77 2201 0.01% 78 2442 0.01% 79 2772 0.02% 80 3091 0.02% 81 3498 0.02% 82 4149 0.02% 83 4804 0.03% 84 5788 0.03% 85 6620 0.04% 86 7065 0.04% 87 7500 0.04% 88 7908 0.04% 89 8270 0.05% 90 8991 0.05% 91 9669 0.05% 92 10438 0.06% 93 11631 0.06% 94 11944 0.07% 95 12802 0.07% 96 13484 0.07% 97 14307 0.08% 98 14819 0.08% 99 15775 0.09% 100 16549 0.09% 101 17712 0.10% 102 18658 0.10% 103 19876 0.11% 104 20901 0.12% 105 21895 0.12% 106 23037 0.13% 107 24027 0.13% 108 25288 0.14% 109 25393 0.14% 110 26808 0.15% 111 27834 0.15% 112 29541 0.16% 113 30858 0.17% 114 32814 0.18% 115 34032 0.19% 116 35515 0.20% 117 36486 0.20% 118 37961 0.21% 119 38781 0.21% 120 40773 0.23% 121 43027 0.24% 122 45447 0.25% 123 47855 0.27% 124 49812 0.28% 125 52433 0.29% 126 55002 0.30% 127 57589 0.32% 128 59492 0.33% 129 62613 0.35% 130 65431 0.36% 131 68982 0.38% 132 73187 0.41% 133 78785 0.44% 134 83372 0.46% 135 89175 0.49% 136 95252 0.53% 137 103059 0.57% 138 111215 0.62% 139 121644 0.67% 140 132853 0.74% 141 145252 0.80% 142 162553 0.90% 143 180532 1.00% 144 207682 1.15% 145 248181 1.38% 146 304017 1.68% 147 407758 2.26% 148 610010 3.38% 149 1150886 6.38% 150 4379711 24.27% 151 7959356 44.11% 18045231 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=39 fanout-score=152.48 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.9 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.15 fanout-score-rank=19 prefix-density=0.37 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=58.40 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.6 sequence=TGTTGGTGGTGG SRR7170175 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:31:22 Started mapping on | Feb 12 17:31:22 Finished on | Feb 12 17:32:49 Mapping speed, Million of reads per hour | 746.70 Number of input reads | 18045231 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17083236 Uniquely mapped reads % | 94.67% Average mapped length | 292.37 Number of splices: Total | 16071976 Number of splices: Annotated (sjdb) | 15801290 Number of splices: GT/AG | 15838101 Number of splices: GC/AG | 185375 Number of splices: AT/AC | 13045 Number of splices: Non-canonical | 35455 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328047 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 82022 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656126 656126 656126 N_multimapping 328047 328047 328047 N_noFeature 396178 16893284 477573 N_ambiguous 179128 1384 69481 UnstrandedReadsAssigned:16507930 PositiveStrandReadsAssigned:188568 NegativeStrandReadsAssigned:16536182 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170175-trimmed-pair1.fastq SRR7170175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,045,231 reads, 16,465,990 reads pseudoaligned [quant] estimated average fragment length: 247.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7170175.ke.tsv 34699 SRR7170175.se.tsv 87100 total ==> SRR7170175.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.03 336 11.3065 Potri.005G024800.1.v4.1 1035 788.033 44 3.32756 Potri.004G059700.1.v4.1 961 714.107 6 0.500731 Potri.007G009000.2.v4.1 1416 1169.03 0 0 Potri.003G141000.2.v4.1 2943 2696.03 384.109 8.49076 Potri.016G087400.1.v4.1 270 81.505 1587 1160.4 Potri.015G069301.1.v4.1 564 324.495 0 0 Potri.010G195200.1.v4.1 1773 1526.03 29.822 1.16463 Potri.012G127500.1.v4.1 977 730.078 6601 538.837 ==> SRR7170175.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170175 completed mapping pipeline successfully