Starting /dee2/code/volunteer_pipeline.sh SRR7170176 current disk space = 3051954274304 free memory = 1468592992 SRR7170176 SRAfilesize e819f4a0f497e2f698c8e942a5b06cf3 SRR7170176.sra SRR7170176.sra file validated SRR7170176 is paired end SRR7170176 is conventional basespace SRR7170176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97925 34.0 33.0 34.0 33.0 34.0 2 33.3155 34.0 33.0 34.0 33.0 34.0 3 33.373 34.0 33.0 34.0 33.0 34.0 4 33.38025 34.0 33.0 34.0 33.0 34.0 5 33.39825 34.0 34.0 34.0 33.0 34.0 6 35.45025 38.0 37.0 38.0 29.0 38.0 7 36.933 38.0 37.0 38.0 35.0 38.0 8 37.291 38.0 38.0 38.0 37.0 38.0 9 37.3505 38.0 38.0 38.0 37.0 38.0 10-14 37.4302 38.0 38.0 38.0 37.2 38.0 15-19 37.4536 38.0 38.0 38.0 37.4 38.0 20-24 37.47455 38.0 38.0 38.0 37.8 38.0 25-29 37.21695 38.0 38.0 38.0 37.0 38.0 30-34 37.434200000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.39345 38.0 38.0 38.0 37.4 38.0 40-44 37.2411 38.0 38.0 38.0 36.8 38.0 45-49 37.18975 38.0 38.0 38.0 36.8 38.0 50-54 37.09675 38.0 38.0 38.0 36.0 38.0 55-59 37.128750000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.62725 38.0 37.8 38.0 34.2 38.0 65-69 37.124649999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.96125 38.0 38.0 38.0 36.0 38.0 75-79 36.8679 38.0 38.0 38.0 35.8 38.0 80-84 36.559450000000005 38.0 37.8 38.0 34.2 38.0 85-89 36.50405 38.0 37.8 38.0 33.8 38.0 90-94 36.624 38.0 38.0 38.0 34.8 38.0 95-99 36.7117 38.0 38.0 38.0 35.2 38.0 100-104 36.4876 38.0 38.0 38.0 34.2 38.0 105-109 36.20605 38.0 38.0 38.0 33.8 38.0 110-114 36.24309999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.2059 38.0 38.0 38.0 34.0 38.0 120-124 36.0148 38.0 37.8 38.0 33.2 38.0 125-129 35.833800000000004 38.0 37.0 38.0 32.6 38.0 130-134 35.557900000000004 38.0 36.6 38.0 31.4 38.0 135-139 35.325450000000004 38.0 36.0 38.0 30.4 38.0 140-144 35.08964999999999 38.0 36.0 38.0 29.6 38.0 145-149 34.61725 38.0 35.6 38.0 27.8 38.0 150-151 31.234875000000002 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 4.0 18 4.0 19 10.0 20 5.0 21 3.0 22 5.0 23 12.0 24 6.0 25 18.0 26 14.0 27 21.0 28 21.0 29 40.0 30 50.0 31 52.0 32 64.0 33 83.0 34 133.0 35 217.0 36 504.0 37 2729.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.10526315789473 16.219635627530366 11.411943319838057 30.263157894736842 2 20.349999999999998 20.875 34.849999999999994 23.925 3 18.825 28.075 26.1 27.0 4 21.575 34.65 23.075000000000003 20.7 5 20.150000000000002 36.725 23.1 20.025000000000002 6 18.434217108554275 36.16808404202101 25.337668834417208 20.060030015007506 7 14.274999999999999 23.05 41.925000000000004 20.75 8 18.05 23.925 29.975 28.050000000000004 9 18.125 25.650000000000002 30.349999999999998 25.874999999999996 10-14 20.25 29.470000000000002 26.69 23.59 15-19 20.235 28.73 27.775 23.26 20-24 19.935 28.694999999999997 27.134999999999998 24.235 25-29 20.435 29.18 26.765 23.62 30-34 19.73 28.444999999999997 27.839999999999996 23.985 35-39 20.205000000000002 29.215000000000003 26.85 23.73 40-44 20.244999999999997 29.299999999999997 26.924999999999997 23.53 45-49 20.09 28.715000000000003 27.57 23.625 50-54 20.06 28.46 27.27 24.21 55-59 19.955000000000002 28.27 27.16 24.615000000000002 60-64 20.369999999999997 28.17 27.79 23.669999999999998 65-69 20.325 28.595 27.215 23.865 70-74 20.669999999999998 29.020000000000003 26.640000000000004 23.669999999999998 75-79 20.23 28.375 26.845000000000002 24.55 80-84 20.61 28.62 26.915 23.855 85-89 20.685000000000002 27.889999999999997 27.565 23.86 90-94 20.78 28.694999999999997 26.855 23.669999999999998 95-99 20.64 27.755000000000003 27.900000000000002 23.705000000000002 100-104 21.6 28.32 26.784999999999997 23.294999999999998 105-109 20.880000000000003 28.095 26.555 24.47 110-114 20.605 28.485 26.590000000000003 24.32 115-119 20.669999999999998 28.505000000000003 26.700000000000003 24.125 120-124 20.64 28.57 26.115 24.675 125-129 20.986049302465123 27.976398819940997 26.626331316565828 24.411220561028053 130-134 21.275 28.115000000000002 26.755000000000003 23.855 135-139 20.691034551727586 27.66638331916596 26.691334566728337 24.951247562378118 140-144 21.415 28.549999999999997 26.085 23.95 145-149 21.315 27.715 26.665 24.305 150-151 21.45 28.487499999999997 25.7125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 0.5 24 1.5 25 4.0 26 8.5 27 11.0 28 11.5 29 11.5 30 14.5 31 20.0 32 28.5 33 41.5 34 48.5 35 60.5 36 90.5 37 109.0 38 125.5 39 164.0 40 189.0 41 209.5 42 242.0 43 254.0 44 262.0 45 268.5 46 252.5 47 243.5 48 232.5 49 184.0 50 165.0 51 166.0 52 137.0 53 108.0 54 85.5 55 68.5 56 42.5 57 26.5 58 28.5 59 19.5 60 10.0 61 8.5 62 6.5 63 7.5 64 5.0 65 4.0 66 4.5 67 2.0 68 0.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.25113008538422904 0.5 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.475 0.0 0.0 0.0 0.0 108-109 2.9125 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.65 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 7.0375 0.0 0.0 0.0 0.0 126-127 7.6125 0.0 0.0 0.0 0.0 128-129 8.3875 0.0 0.0 0.0 0.0 130-131 8.875 0.0 0.0 0.0 0.0 132-133 9.55 0.0 0.0 0.0 0.0 134-135 10.3125 0.0 0.0 0.0 0.0 136-137 10.9125 0.0 0.0 0.0 0.0 138-139 11.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACCT 10 0.0068343505 144.975 7 AAAATGG 10 0.0068343505 144.975 3 AAATGGC 10 0.0068343505 144.975 4 >>END_MODULE SRR7170176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77375 33.0 33.0 34.0 32.0 34.0 2 32.836 34.0 33.0 34.0 32.0 34.0 3 32.87475 34.0 33.0 34.0 32.0 34.0 4 32.79875 34.0 33.0 34.0 32.0 34.0 5 32.79725 34.0 33.0 34.0 32.0 34.0 6 36.84925 38.0 38.0 38.0 37.0 38.0 7 36.96675 38.0 38.0 38.0 37.0 38.0 8 37.0245 38.0 38.0 38.0 37.0 38.0 9 36.92625 38.0 38.0 38.0 37.0 38.0 10-14 36.8613 38.0 38.0 38.0 36.4 38.0 15-19 36.9046 38.0 38.0 38.0 36.8 38.0 20-24 36.867850000000004 38.0 38.0 38.0 37.0 38.0 25-29 36.84755 38.0 38.0 38.0 37.0 38.0 30-34 36.6845 38.0 38.0 38.0 35.8 38.0 35-39 36.450649999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.44705 38.0 38.0 38.0 35.0 38.0 45-49 36.68445 38.0 38.0 38.0 36.0 38.0 50-54 36.69715000000001 38.0 38.0 38.0 36.2 38.0 55-59 36.65155 38.0 38.0 38.0 35.6 38.0 60-64 36.59519999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.6193 38.0 38.0 38.0 35.8 38.0 70-74 36.3571 38.0 38.0 38.0 34.8 38.0 75-79 36.244099999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.343 38.0 38.0 38.0 34.8 38.0 85-89 36.2934 38.0 38.0 38.0 34.8 38.0 90-94 36.3009 38.0 38.0 38.0 34.8 38.0 95-99 36.22255 38.0 38.0 38.0 34.4 38.0 100-104 36.135450000000006 38.0 38.0 38.0 34.2 38.0 105-109 35.906099999999995 38.0 38.0 38.0 33.4 38.0 110-114 35.83415 38.0 38.0 38.0 33.8 38.0 115-119 35.69655 38.0 38.0 38.0 33.0 38.0 120-124 35.4106 38.0 37.6 38.0 31.4 38.0 125-129 35.1385 38.0 36.8 38.0 29.8 38.0 130-134 34.91545 38.0 36.0 38.0 28.2 38.0 135-139 34.637 38.0 36.0 38.0 27.0 38.0 140-144 34.3386 38.0 36.0 38.0 25.0 38.0 145-149 33.402049999999996 38.0 35.0 38.0 17.0 38.0 150-151 29.620250000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 3.0 4 10.0 5 3.0 6 0.0 7 1.0 8 2.0 9 1.0 10 3.0 11 4.0 12 6.0 13 3.0 14 9.0 15 5.0 16 3.0 17 10.0 18 3.0 19 9.0 20 7.0 21 12.0 22 13.0 23 8.0 24 15.0 25 18.0 26 19.0 27 21.0 28 31.0 29 41.0 30 42.0 31 47.0 32 64.0 33 78.0 34 95.0 35 192.0 36 460.0 37 2745.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.325 17.75 15.8 24.125 2 23.65 26.625 31.35 18.375 3 22.425 28.9 29.875 18.8 4 23.875 35.325 21.099999999999998 19.7 5 23.45 36.7 21.925 17.925 6 20.775 33.975 25.924999999999997 19.325 7 19.925 20.375 37.85 21.85 8 21.95 24.275 26.025 27.750000000000004 9 23.025000000000002 25.525 27.800000000000004 23.65 10-14 23.849999999999998 28.515 25.6 22.035 15-19 23.56 27.755000000000003 27.075 21.61 20-24 23.535 28.16 27.139999999999997 21.165 25-29 23.535 28.185 27.41 20.87 30-34 23.72 27.755000000000003 27.245 21.279999999999998 35-39 23.59 28.134999999999998 27.075 21.2 40-44 24.235 28.215 26.974999999999998 20.575 45-49 24.085 27.375 27.51 21.029999999999998 50-54 23.35 27.73 27.894999999999996 21.025 55-59 23.794999999999998 27.485 27.785 20.935000000000002 60-64 23.645 28.02 27.735 20.599999999999998 65-69 23.665 27.845 27.500000000000004 20.990000000000002 70-74 24.15 27.705000000000002 27.305 20.84 75-79 23.945 27.925 27.365000000000002 20.765 80-84 23.945 27.88 27.67 20.505000000000003 85-89 23.751187559377968 27.801390069503473 27.541377068853446 20.906045302265113 90-94 24.32 27.855 27.62 20.205000000000002 95-99 24.33 27.455000000000002 27.33 20.885 100-104 24.43 27.865000000000002 27.779999999999998 19.925 105-109 24.141035258814703 27.811952988247064 27.301825456364092 20.745186296574143 110-114 24.821241062053105 27.881394069703486 27.33136656832842 19.965998299914997 115-119 24.815 27.555000000000003 27.215 20.415 120-124 25.416270813540677 27.341367068353417 26.796339816990848 20.446022301115054 125-129 25.474999999999998 27.495000000000005 27.1 19.93 130-134 25.70885632844927 27.99419912986948 26.608991348702304 19.687953192978945 135-139 25.80387058058709 27.424113617042558 26.739010851627743 20.033004950742612 140-144 25.790000000000003 27.29 27.200000000000003 19.72 145-149 26.630326065213044 27.680536107221442 26.46529305861172 19.22384476895379 150-151 27.01113474290004 27.12373326660828 26.96109095458526 18.90404103590642 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.5 23 1.5 24 0.5 25 2.0 26 3.0 27 2.0 28 2.5 29 4.0 30 6.5 31 9.5 32 13.0 33 24.0 34 32.5 35 43.0 36 71.5 37 86.0 38 106.5 39 154.0 40 186.5 41 201.0 42 243.5 43 285.0 44 287.0 45 299.5 46 298.0 47 270.5 48 245.0 49 221.0 50 187.0 51 142.5 52 125.5 53 113.0 54 82.5 55 63.0 56 44.5 57 29.0 58 26.0 59 21.5 60 15.0 61 10.0 62 6.5 63 6.5 64 6.0 65 4.0 66 3.0 67 2.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.005 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.02 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.35175879396984927 0.7000000000000001 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 4.95 0.0 0.0 0.0 0.0 120-121 5.6375 0.0 0.0 0.0 0.0 122-123 6.125 0.0 0.0 0.0 0.0 124-125 6.825 0.0 0.0 0.0 0.0 126-127 7.3875 0.0 0.0 0.0 0.0 128-129 8.175 0.0 0.0 0.0 0.0 130-131 8.662500000000001 0.0 0.0 0.0 0.0 132-133 9.35 0.0 0.0 0.0 0.0 134-135 10.0625 0.0 0.0 0.0 0.0 136-137 10.6125 0.0 0.0 0.0 0.0 138-139 11.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCGC 10 0.006830828 145.0 145 >>END_MODULE Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782236 spots for SRR7170176.sra Written 782236 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra Read 782231 spots for SRR7170176.sra Written 782231 spots for SRR7170176.sra SRR ids: ['SRR7170176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dc3ijbos SRR7170176.sra spots: 15644625 blocks: [[1, 782231], [782232, 1564462], [1564463, 2346693], [2346694, 3128924], [3128925, 3911155], [3911156, 4693386], [4693387, 5475617], [5475618, 6257848], [6257849, 7040079], [7040080, 7822310], [7822311, 8604541], [8604542, 9386772], [9386773, 10169003], [10169004, 10951234], [10951235, 11733465], [11733466, 12515696], [12515697, 13297927], [13297928, 14080158], [14080159, 14862389], [14862390, 15644625]] SRR7170176 file size 5279749 SRR7170176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170176 SRR7170176_1.fastq SRR7170176_2.fastq Input file: SRR7170176_1.fastq Paired file: SRR7170176_2.fastq trimmed: SRR7170176-trimmed-pair1.fastq, SRR7170176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:59:53 2025 >> started Wed Feb 12 17:00:11 2025 >> done (17.576s) 15644625 read pairs processed; of these: 35925 ( 0.23%) short read pairs filtered out after trimming by size control 39760 ( 0.25%) empty read pairs filtered out after trimming by size control 15568940 (99.52%) read pairs available; of these: 7866575 (50.53%) trimmed read pairs available after processing 7702365 (49.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 6 0.00% 22 8 0.00% 23 13 0.00% 24 10 0.00% 25 11 0.00% 26 12 0.00% 27 8 0.00% 28 10 0.00% 29 10 0.00% 30 20 0.00% 31 14 0.00% 32 17 0.00% 33 20 0.00% 34 18 0.00% 35 27 0.00% 36 20 0.00% 37 19 0.00% 38 36 0.00% 39 25 0.00% 40 33 0.00% 41 41 0.00% 42 48 0.00% 43 57 0.00% 44 66 0.00% 45 61 0.00% 46 64 0.00% 47 95 0.00% 48 101 0.00% 49 93 0.00% 50 122 0.00% 51 163 0.00% 52 187 0.00% 53 216 0.00% 54 223 0.00% 55 232 0.00% 56 248 0.00% 57 286 0.00% 58 341 0.00% 59 382 0.00% 60 380 0.00% 61 490 0.00% 62 623 0.00% 63 602 0.00% 64 732 0.00% 65 728 0.00% 66 988 0.01% 67 1175 0.01% 68 1565 0.01% 69 4175 0.03% 70 5656 0.04% 71 2917 0.02% 72 2479 0.02% 73 2449 0.02% 74 2643 0.02% 75 2975 0.02% 76 3115 0.02% 77 3354 0.02% 78 3696 0.02% 79 4167 0.03% 80 4747 0.03% 81 5407 0.03% 82 6232 0.04% 83 7153 0.05% 84 9378 0.06% 85 10613 0.07% 86 10906 0.07% 87 11557 0.07% 88 12413 0.08% 89 12833 0.08% 90 13723 0.09% 91 14818 0.10% 92 16242 0.10% 93 17710 0.11% 94 18489 0.12% 95 19556 0.13% 96 20161 0.13% 97 20651 0.13% 98 21312 0.14% 99 22351 0.14% 100 23721 0.15% 101 25044 0.16% 102 27246 0.18% 103 28682 0.18% 104 30176 0.19% 105 31554 0.20% 106 32046 0.21% 107 32453 0.21% 108 33370 0.21% 109 34399 0.22% 110 35834 0.23% 111 37236 0.24% 112 39518 0.25% 113 41857 0.27% 114 43385 0.28% 115 44503 0.29% 116 45461 0.29% 117 45439 0.29% 118 46437 0.30% 119 46969 0.30% 120 48253 0.31% 121 50114 0.32% 122 51871 0.33% 123 54621 0.35% 124 57400 0.37% 125 58749 0.38% 126 60458 0.39% 127 61478 0.39% 128 61311 0.39% 129 62950 0.40% 130 64083 0.41% 131 66237 0.43% 132 69277 0.44% 133 72681 0.47% 134 75764 0.49% 135 79714 0.51% 136 82342 0.53% 137 84806 0.54% 138 88619 0.57% 139 90778 0.58% 140 94964 0.61% 141 101965 0.65% 142 109328 0.70% 143 120413 0.77% 144 136391 0.88% 145 157397 1.01% 146 188962 1.21% 147 240938 1.55% 148 341452 2.19% 149 633652 4.07% 150 3349738 21.52% 151 7702365 49.47% 15568940 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=285.93 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=111.16 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170176 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:01:16 Started mapping on | Feb 12 17:01:16 Finished on | Feb 12 17:02:53 Mapping speed, Million of reads per hour | 577.82 Number of input reads | 15568940 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 12616661 Uniquely mapped reads % | 81.04% Average mapped length | 284.22 Number of splices: Total | 11618250 Number of splices: Annotated (sjdb) | 11408782 Number of splices: GT/AG | 11437541 Number of splices: GC/AG | 139547 Number of splices: AT/AC | 10401 Number of splices: Non-canonical | 30761 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238516 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 36239 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.15% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2747535 2747535 2747535 N_multimapping 238516 238516 238516 N_noFeature 262698 12477698 316390 N_ambiguous 186488 1252 100536 UnstrandedReadsAssigned:12167475 PositiveStrandReadsAssigned:137711 NegativeStrandReadsAssigned:12199735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170176-trimmed-pair1.fastq SRR7170176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,568,940 reads, 13,970,733 reads pseudoaligned [quant] estimated average fragment length: 211.88 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7170176.ke.tsv 34699 SRR7170176.se.tsv 87100 total ==> SRR7170176.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.12 256 9.6123 Potri.005G024800.1.v4.1 1035 824.12 34 2.79939 Potri.004G059700.1.v4.1 961 750.143 3 0.271364 Potri.007G009000.2.v4.1 1416 1205.12 0 0 Potri.003G141000.2.v4.1 2943 2732.12 241.175 5.98972 Potri.016G087400.1.v4.1 270 99.0466 1493.53 1023.17 Potri.015G069301.1.v4.1 564 357.365 0 0 Potri.010G195200.1.v4.1 1773 1562.12 7 0.304059 Potri.012G127500.1.v4.1 977 766.143 7065 625.716 ==> SRR7170176.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 774 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170176 completed mapping pipeline successfully