Starting /dee2/code/volunteer_pipeline.sh SRR7170177 current disk space = 3051972325376 free memory = 1000774856 SRR7170177 SRAfilesize 95ebe32e24336f8a1637d39f83c79ba1 SRR7170177.sra SRR7170177.sra file validated SRR7170177 is paired end SRR7170177 is conventional basespace SRR7170177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85075 34.0 33.0 34.0 33.0 34.0 2 33.30275 34.0 33.0 34.0 32.0 34.0 3 33.35425 34.0 33.0 34.0 33.0 34.0 4 33.42425 34.0 33.0 34.0 33.0 34.0 5 33.35325 34.0 33.0 34.0 33.0 34.0 6 37.07275 38.0 37.0 38.0 36.0 38.0 7 34.66525 38.0 36.0 38.0 26.0 38.0 8 36.78 38.0 37.0 38.0 34.0 38.0 9 37.2815 38.0 38.0 38.0 37.0 38.0 10-14 36.95095 38.0 37.8 38.0 35.2 38.0 15-19 37.39945 38.0 38.0 38.0 37.4 38.0 20-24 37.53025 38.0 38.0 38.0 38.0 38.0 25-29 37.54365 38.0 38.0 38.0 38.0 38.0 30-34 37.5083 38.0 38.0 38.0 38.0 38.0 35-39 37.436400000000006 38.0 38.0 38.0 37.6 38.0 40-44 37.3403 38.0 38.0 38.0 37.0 38.0 45-49 36.0629 38.0 36.8 38.0 31.4 38.0 50-54 36.87475 38.0 37.8 38.0 35.2 38.0 55-59 37.0564 38.0 38.0 38.0 36.4 38.0 60-64 37.1288 38.0 38.0 38.0 36.4 38.0 65-69 37.1479 38.0 38.0 38.0 36.4 38.0 70-74 35.8141 38.0 36.8 38.0 29.8 38.0 75-79 36.887150000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.91369999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.6238 38.0 38.0 38.0 34.4 38.0 90-94 36.6857 38.0 38.0 38.0 34.8 38.0 95-99 36.6383 38.0 38.0 38.0 34.8 38.0 100-104 36.5401 38.0 38.0 38.0 34.6 38.0 105-109 36.3202 38.0 38.0 38.0 33.8 38.0 110-114 36.3287 38.0 38.0 38.0 34.0 38.0 115-119 35.966 38.0 37.4 38.0 32.6 38.0 120-124 36.16105 38.0 37.8 38.0 33.8 38.0 125-129 35.928250000000006 38.0 37.2 38.0 33.2 38.0 130-134 35.663850000000004 38.0 36.2 38.0 31.4 38.0 135-139 35.413500000000006 38.0 36.0 38.0 31.0 38.0 140-144 35.023799999999994 38.0 35.8 38.0 29.0 38.0 145-149 34.77095 38.0 35.8 38.0 29.0 38.0 150-151 31.238 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 3.0 19 7.0 20 0.0 21 0.0 22 5.0 23 7.0 24 13.0 25 8.0 26 16.0 27 17.0 28 29.0 29 19.0 30 46.0 31 56.0 32 85.0 33 92.0 34 136.0 35 267.0 36 631.0 37 2552.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.69918699186992 14.48170731707317 10.060975609756099 31.758130081300813 2 20.599999999999998 19.0 35.8 24.6 3 18.975 27.150000000000002 26.125 27.750000000000004 4 22.1 33.4 23.625 20.875 5 22.28614307153577 36.06803401700851 23.08654327163582 18.55927963981991 6 18.099999999999998 35.725 25.6 20.575 7 13.950000000000001 23.825 43.075 19.15 8 18.224999999999998 22.675 30.875000000000004 28.225 9 18.975 24.175 31.324999999999996 25.525 10-14 19.75 30.635 26.384999999999998 23.23 15-19 19.830000000000002 29.17 27.139999999999997 23.86 20-24 20.055 29.095 26.834999999999997 24.015 25-29 20.375 29.13 27.165 23.330000000000002 30-34 20.25 29.185 27.02 23.544999999999998 35-39 19.785 29.435 26.865 23.915 40-44 20.255000000000003 28.74 27.495000000000005 23.51 45-49 20.44 28.93 27.015 23.615 50-54 20.51 28.945 27.185 23.36 55-59 20.544999999999998 28.68 26.945000000000004 23.830000000000002 60-64 19.98 28.865000000000002 26.889999999999997 24.265 65-69 20.43 28.525 27.0 24.044999999999998 70-74 20.385 28.025 27.655 23.935000000000002 75-79 20.405 29.134999999999998 26.545 23.915 80-84 20.24 28.74 26.584999999999997 24.435000000000002 85-89 20.75 28.26 27.084999999999997 23.905 90-94 20.575 29.110000000000003 26.584999999999997 23.73 95-99 20.815 28.33 27.04 23.815 100-104 20.605 28.744999999999997 26.505000000000003 24.145 105-109 20.645 28.494999999999997 26.875 23.985 110-114 20.695 28.82 26.595000000000002 23.89 115-119 21.02 28.22 26.63 24.13 120-124 21.04 27.875 26.555 24.529999999999998 125-129 21.07 28.43 26.8 23.7 130-134 21.15 27.939999999999998 26.465 24.445 135-139 21.05 28.365000000000002 26.740000000000002 23.845 140-144 21.46 28.349999999999998 26.05 24.14 145-149 21.45 28.110000000000003 26.565 23.875 150-151 21.305326331582897 28.00700175043761 26.669167291822955 24.01850462615654 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 3.5 25 5.5 26 7.5 27 5.5 28 7.5 29 15.0 30 19.5 31 22.5 32 23.5 33 37.0 34 50.0 35 66.0 36 91.0 37 100.0 38 125.5 39 156.5 40 178.0 41 206.0 42 244.0 43 265.5 44 268.0 45 274.0 46 281.0 47 270.5 48 230.5 49 202.0 50 184.0 51 157.5 52 119.0 53 89.0 54 73.5 55 54.5 56 43.5 57 36.5 58 20.5 59 14.0 60 13.0 61 7.5 62 6.5 63 7.0 64 4.5 65 2.0 66 2.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 4.050000000000001 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.0875 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.512499999999999 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTTGA 10 0.0068343505 144.975 4 GTCCCCA 10 0.0068343505 144.975 7 >>END_MODULE SRR7170177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94925 33.0 33.0 34.0 32.0 34.0 2 33.00325 34.0 33.0 34.0 32.0 34.0 3 33.001 34.0 33.0 34.0 32.0 34.0 4 32.919 34.0 33.0 34.0 32.0 34.0 5 32.9795 34.0 33.0 34.0 32.0 34.0 6 37.1285 38.0 38.0 38.0 37.0 38.0 7 37.1695 38.0 38.0 38.0 37.0 38.0 8 36.98225 38.0 38.0 38.0 37.0 38.0 9 37.03375 38.0 38.0 38.0 37.0 38.0 10-14 36.9713 38.0 38.0 38.0 36.4 38.0 15-19 37.05195 38.0 38.0 38.0 37.0 38.0 20-24 36.87675 38.0 38.0 38.0 36.2 38.0 25-29 36.8726 38.0 38.0 38.0 36.2 38.0 30-34 36.867599999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.77015 38.0 38.0 38.0 35.6 38.0 40-44 36.81205 38.0 38.0 38.0 36.2 38.0 45-49 36.839 38.0 38.0 38.0 36.0 38.0 50-54 36.8022 38.0 38.0 38.0 36.4 38.0 55-59 36.7668 38.0 38.0 38.0 35.8 38.0 60-64 36.769 38.0 38.0 38.0 36.0 38.0 65-69 36.7023 38.0 38.0 38.0 35.4 38.0 70-74 36.4866 38.0 38.0 38.0 34.6 38.0 75-79 36.156 38.0 38.0 38.0 33.2 38.0 80-84 36.3527 38.0 38.0 38.0 34.2 38.0 85-89 36.527 38.0 38.0 38.0 35.0 38.0 90-94 36.4066 38.0 38.0 38.0 34.6 38.0 95-99 36.3966 38.0 38.0 38.0 34.8 38.0 100-104 36.21565 38.0 38.0 38.0 34.2 38.0 105-109 36.12815 38.0 38.0 38.0 33.8 38.0 110-114 35.902950000000004 38.0 38.0 38.0 33.0 38.0 115-119 35.766549999999995 38.0 38.0 38.0 32.2 38.0 120-124 35.67145 38.0 37.8 38.0 32.2 38.0 125-129 35.470949999999995 38.0 37.2 38.0 31.4 38.0 130-134 34.96295 38.0 36.2 38.0 28.0 38.0 135-139 34.644600000000004 38.0 35.6 38.0 26.4 38.0 140-144 34.561099999999996 38.0 36.0 38.0 27.0 38.0 145-149 33.848200000000006 38.0 34.8 38.0 23.0 38.0 150-151 29.886374999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 4.0 11 3.0 12 3.0 13 1.0 14 5.0 15 8.0 16 3.0 17 10.0 18 4.0 19 6.0 20 6.0 21 12.0 22 11.0 23 14.0 24 12.0 25 23.0 26 25.0 27 26.0 28 24.0 29 38.0 30 35.0 31 51.0 32 55.0 33 93.0 34 137.0 35 202.0 36 495.0 37 2678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.125 18.75 14.124999999999998 24.0 2 24.8 24.575 32.6 18.025 3 20.875 28.449999999999996 31.55 19.125 4 26.224999999999998 34.625 20.925 18.224999999999998 5 24.0 36.1 22.175 17.724999999999998 6 20.925 35.075 23.775 20.225 7 20.3 18.0 41.275 20.424999999999997 8 22.525000000000002 22.5 25.825 29.15 9 21.85 25.0 29.349999999999998 23.799999999999997 10-14 23.695 27.83 26.705000000000002 21.77 15-19 23.535 27.889999999999997 27.22 21.355 20-24 23.255 28.425 27.045 21.275 25-29 23.46 27.58 27.694999999999997 21.265 30-34 23.29 27.98 27.76 20.97 35-39 23.355 27.82 27.834999999999997 20.990000000000002 40-44 23.952395239523952 27.607760776077605 27.522752275227525 20.91709170917092 45-49 24.12 27.400000000000002 27.884999999999998 20.595 50-54 23.630000000000003 27.655 27.425 21.29 55-59 23.915 27.55 27.689999999999998 20.845 60-64 23.605 27.685 28.105000000000004 20.605 65-69 24.05 27.02 27.860000000000003 21.07 70-74 23.635 27.185 27.865000000000002 21.315 75-79 23.955000000000002 27.51 27.415 21.12 80-84 23.715 26.625 28.305000000000003 21.355 85-89 23.544999999999998 26.924999999999997 28.655 20.875 90-94 24.26 27.200000000000003 27.57 20.97 95-99 23.925 27.595 27.97 20.51 100-104 24.195 27.500000000000004 27.650000000000002 20.655 105-109 24.015 27.52 27.834999999999997 20.630000000000003 110-114 24.395 27.425 27.889999999999997 20.29 115-119 24.345 26.945000000000004 27.794999999999998 20.915 120-124 24.33 27.279999999999998 27.755000000000003 20.635 125-129 24.535 27.605 27.395000000000003 20.465 130-134 24.709999999999997 28.015 26.935 20.34 135-139 25.55 27.675 27.22 19.555 140-144 24.915000000000003 27.310000000000002 27.544999999999998 20.23 145-149 24.93 27.155 27.77 20.145 150-151 25.288365095285858 27.833500501504517 27.80842527582748 19.069709127382144 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 3.5 28 5.5 29 6.5 30 9.5 31 8.0 32 14.5 33 28.5 34 29.0 35 34.5 36 58.5 37 94.5 38 124.5 39 158.5 40 187.5 41 208.5 42 246.5 43 252.5 44 263.0 45 290.0 46 299.5 47 304.5 48 266.5 49 220.0 50 199.5 51 167.0 52 128.5 53 98.0 54 72.5 55 58.0 56 41.5 57 29.5 58 22.0 59 11.5 60 9.5 61 10.5 62 8.5 63 5.0 64 5.0 65 5.0 66 3.0 67 1.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3769791404875597 0.75 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0125 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1125 0.0 0.0 0.025 0.0 82-83 0.175 0.0 0.0 0.025 0.0 84-85 0.2375 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.32499999999999996 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.48750000000000004 0.0 0.0 0.025 0.0 94-95 0.6625 0.0 0.0 0.025 0.0 96-97 0.8 0.0 0.0 0.025 0.0 98-99 0.975 0.0 0.0 0.025 0.0 100-101 1.1875 0.0 0.0 0.025 0.0 102-103 1.3125 0.0 0.0 0.025 0.0 104-105 1.6124999999999998 0.0 0.0 0.025 0.0 106-107 1.9375 0.0 0.0 0.025 0.0 108-109 2.1875 0.0 0.0 0.025 0.0 110-111 2.45 0.0 0.0 0.025 0.0 112-113 2.6875 0.0 0.0 0.025 0.0 114-115 2.975 0.0 0.0 0.025 0.0 116-117 3.2625 0.0 0.0 0.025 0.0 118-119 3.6125 0.0 0.0 0.025 0.0 120-121 4.050000000000001 0.0 0.0 0.025 0.0 122-123 4.4125 0.0 0.0 0.025 0.0 124-125 4.65 0.0 0.0 0.025 0.0 126-127 5.112500000000001 0.0 0.0 0.025 0.0 128-129 5.5625 0.0 0.0 0.025 0.0 130-131 6.074999999999999 0.0 0.0 0.025 0.0 132-133 6.550000000000001 0.0 0.0 0.025 0.0 134-135 7.25 0.0 0.0 0.025 0.0 136-137 7.85 0.0 0.0 0.025 0.0 138-139 8.45 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTA 10 0.006830828 145.0 3 AGAACAA 10 0.006830828 145.0 145 CAAGTAC 10 0.006830828 145.0 4 >>END_MODULE Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125954 spots for SRR7170177.sra Written 1125954 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra Read 1125952 spots for SRR7170177.sra Written 1125952 spots for SRR7170177.sra SRR ids: ['SRR7170177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f611deuu SRR7170177.sra spots: 22519042 blocks: [[1, 1125952], [1125953, 2251904], [2251905, 3377856], [3377857, 4503808], [4503809, 5629760], [5629761, 6755712], [6755713, 7881664], [7881665, 9007616], [9007617, 10133568], [10133569, 11259520], [11259521, 12385472], [12385473, 13511424], [13511425, 14637376], [14637377, 15763328], [15763329, 16889280], [16889281, 18015232], [18015233, 19141184], [19141185, 20267136], [20267137, 21393088], [21393089, 22519042]] SRR7170177 file size 7609264 SRR7170177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170177 SRR7170177_1.fastq SRR7170177_2.fastq Input file: SRR7170177_1.fastq Paired file: SRR7170177_2.fastq trimmed: SRR7170177-trimmed-pair1.fastq, SRR7170177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:05:47 2025 >> started Wed Feb 12 17:06:15 2025 >> done (27.934s) 22519042 read pairs processed; of these: 32289 ( 0.14%) short read pairs filtered out after trimming by size control 35143 ( 0.16%) empty read pairs filtered out after trimming by size control 22451610 (99.70%) read pairs available; of these: 10152772 (45.22%) trimmed read pairs available after processing 12298838 (54.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 8 0.00% 21 10 0.00% 22 13 0.00% 23 8 0.00% 24 8 0.00% 25 9 0.00% 26 10 0.00% 27 13 0.00% 28 15 0.00% 29 17 0.00% 30 17 0.00% 31 25 0.00% 32 22 0.00% 33 26 0.00% 34 17 0.00% 35 30 0.00% 36 26 0.00% 37 25 0.00% 38 23 0.00% 39 24 0.00% 40 42 0.00% 41 49 0.00% 42 44 0.00% 43 44 0.00% 44 42 0.00% 45 63 0.00% 46 84 0.00% 47 93 0.00% 48 93 0.00% 49 94 0.00% 50 124 0.00% 51 115 0.00% 52 157 0.00% 53 165 0.00% 54 160 0.00% 55 181 0.00% 56 217 0.00% 57 231 0.00% 58 264 0.00% 59 345 0.00% 60 390 0.00% 61 404 0.00% 62 474 0.00% 63 548 0.00% 64 628 0.00% 65 692 0.00% 66 814 0.00% 67 848 0.00% 68 1069 0.00% 69 2108 0.01% 70 3106 0.01% 71 2075 0.01% 72 1997 0.01% 73 2022 0.01% 74 2236 0.01% 75 2508 0.01% 76 2617 0.01% 77 2953 0.01% 78 3305 0.01% 79 3747 0.02% 80 4196 0.02% 81 4815 0.02% 82 5609 0.02% 83 6288 0.03% 84 8147 0.04% 85 9472 0.04% 86 9805 0.04% 87 10708 0.05% 88 11130 0.05% 89 11968 0.05% 90 12832 0.06% 91 13891 0.06% 92 14984 0.07% 93 16285 0.07% 94 17262 0.08% 95 17795 0.08% 96 19098 0.09% 97 19427 0.09% 98 20668 0.09% 99 21684 0.10% 100 23121 0.10% 101 24547 0.11% 102 26440 0.12% 103 27956 0.12% 104 29901 0.13% 105 31546 0.14% 106 31924 0.14% 107 32655 0.15% 108 34448 0.15% 109 35479 0.16% 110 37543 0.17% 111 39500 0.18% 112 41731 0.19% 113 44065 0.20% 114 46818 0.21% 115 48169 0.21% 116 49725 0.22% 117 50682 0.23% 118 51449 0.23% 119 53382 0.24% 120 55070 0.25% 121 57660 0.26% 122 60325 0.27% 123 64196 0.29% 124 67125 0.30% 125 69567 0.31% 126 71376 0.32% 127 73467 0.33% 128 74912 0.33% 129 77051 0.34% 130 79882 0.36% 131 82789 0.37% 132 87867 0.39% 133 91680 0.41% 134 97605 0.43% 135 102580 0.46% 136 107359 0.48% 137 112374 0.50% 138 115986 0.52% 139 121812 0.54% 140 127034 0.57% 141 136259 0.61% 142 146577 0.65% 143 161357 0.72% 144 184167 0.82% 145 212619 0.95% 146 252646 1.13% 147 322186 1.44% 148 461133 2.05% 149 828708 3.69% 150 4594749 20.47% 151 12298838 54.78% 22451610 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=124.80 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=10.7 sequence=CATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGAC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=45.93 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.3 sequence=TGTTGGTGGTGG SRR7170177 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:07:06 Started mapping on | Feb 12 17:07:06 Finished on | Feb 12 17:09:51 Mapping speed, Million of reads per hour | 489.85 Number of input reads | 22451610 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 20972178 Uniquely mapped reads % | 93.41% Average mapped length | 292.55 Number of splices: Total | 19206549 Number of splices: Annotated (sjdb) | 18889073 Number of splices: GT/AG | 18932698 Number of splices: GC/AG | 216694 Number of splices: AT/AC | 16524 Number of splices: Non-canonical | 40633 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381697 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 39193 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1130144 1130144 1130144 N_multimapping 381697 381697 381697 N_noFeature 402682 20750554 477135 N_ambiguous 230173 1429 82012 UnstrandedReadsAssigned:20339323 PositiveStrandReadsAssigned:220195 NegativeStrandReadsAssigned:20413031 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170177-trimmed-pair1.fastq SRR7170177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,451,610 reads, 20,317,666 reads pseudoaligned [quant] estimated average fragment length: 228.027 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7170177.ke.tsv 34699 SRR7170177.se.tsv 87100 total ==> SRR7170177.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.97 369 9.31781 Potri.005G024800.1.v4.1 1035 807.973 50 2.79866 Potri.004G059700.1.v4.1 961 734.021 6 0.369674 Potri.007G009000.2.v4.1 1416 1188.97 0 0 Potri.003G141000.2.v4.1 2943 2715.97 348.065 5.79577 Potri.016G087400.1.v4.1 270 87.8219 2333 1201.4 Potri.015G069301.1.v4.1 564 342.282 0 0 Potri.010G195200.1.v4.1 1773 1545.97 25 0.731332 Potri.012G127500.1.v4.1 977 750 7481 451.102 ==> SRR7170177.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1581 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170177 completed mapping pipeline successfully