Starting /dee2/code/volunteer_pipeline.sh SRR7170178 current disk space = 3051942739968 free memory = 1506172500 SRR7170178 SRAfilesize 13feff34c63933d7b10f4c1cc49b04ec SRR7170178.sra SRR7170178.sra file validated SRR7170178 is paired end SRR7170178 is conventional basespace SRR7170178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29 34.0 33.0 34.0 33.0 34.0 2 33.40775 34.0 33.0 34.0 33.0 34.0 3 33.43675 34.0 33.0 34.0 33.0 34.0 4 33.374 34.0 33.0 34.0 33.0 34.0 5 33.4765 34.0 34.0 34.0 33.0 34.0 6 36.91725 38.0 37.0 38.0 35.0 38.0 7 37.20625 38.0 38.0 38.0 36.0 38.0 8 37.35625 38.0 38.0 38.0 37.0 38.0 9 37.35475 38.0 38.0 38.0 37.0 38.0 10-14 37.25725 38.0 38.0 38.0 36.4 38.0 15-19 37.21865 38.0 38.0 38.0 36.2 38.0 20-24 37.1885 38.0 38.0 38.0 36.2 38.0 25-29 37.11874999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.01275 38.0 38.0 38.0 36.0 38.0 35-39 36.84365 38.0 38.0 38.0 35.4 38.0 40-44 36.475649999999995 38.0 37.6 38.0 34.0 38.0 45-49 36.33095 38.0 37.0 38.0 33.6 38.0 50-54 36.275150000000004 38.0 37.0 38.0 33.2 38.0 55-59 36.1937 38.0 37.0 38.0 33.0 38.0 60-64 36.02855 38.0 37.0 38.0 31.8 38.0 65-69 35.919599999999996 38.0 37.0 38.0 31.4 38.0 70-74 35.80275 38.0 36.6 38.0 30.8 38.0 75-79 35.717000000000006 38.0 36.2 38.0 30.6 38.0 80-84 35.4454 38.0 36.0 38.0 29.0 38.0 85-89 35.231100000000005 38.0 36.0 38.0 29.0 38.0 90-94 35.07935 38.0 36.0 38.0 28.4 38.0 95-99 34.8023 38.0 35.0 38.0 27.6 38.0 100-104 34.61185 38.0 34.8 38.0 26.0 38.0 105-109 34.35135 38.0 34.0 38.0 25.0 38.0 110-114 33.9882 38.0 34.0 38.0 23.0 38.0 115-119 33.3986 37.8 33.6 38.0 16.2 38.0 120-124 33.13515 37.4 33.4 38.0 15.0 38.0 125-129 32.632349999999995 37.0 31.6 38.0 15.0 38.0 130-134 32.08925000000001 36.8 31.0 38.0 15.0 38.0 135-139 31.202099999999994 36.0 30.0 38.0 14.0 38.0 140-144 30.586399999999998 35.8 28.0 38.0 13.2 38.0 145-149 29.114150000000002 35.2 25.8 38.0 2.0 38.0 150-151 24.469749999999998 33.0 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 2.0 16 5.0 17 6.0 18 7.0 19 8.0 20 12.0 21 13.0 22 28.0 23 23.0 24 30.0 25 25.0 26 41.0 27 45.0 28 65.0 29 81.0 30 83.0 31 129.0 32 157.0 33 205.0 34 343.0 35 529.0 36 1116.0 37 1039.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.8012048192771 14.307228915662652 13.453815261044177 34.437751004016064 2 22.7 21.15 34.050000000000004 22.1 3 19.900000000000002 29.599999999999998 24.125 26.375 4 22.125 33.775 23.425 20.674999999999997 5 21.099999999999998 36.125 23.150000000000002 19.625 6 18.025 36.3 25.474999999999998 20.200000000000003 7 13.525 24.2 41.9 20.375 8 18.675 22.425 30.625000000000004 28.275 9 18.95 24.25 31.125000000000004 25.674999999999997 10-14 19.759999999999998 29.59 27.365000000000002 23.285 15-19 20.085 28.73 27.445000000000004 23.74 20-24 19.79 28.599999999999998 27.400000000000002 24.21 25-29 19.814999999999998 28.78 27.71 23.695 30-34 19.650000000000002 28.92 27.595 23.835 35-39 20.244999999999997 28.689999999999998 27.48 23.585 40-44 20.515 29.125 26.895000000000003 23.465 45-49 20.015 29.14 27.445000000000004 23.400000000000002 50-54 19.74 29.315 27.3 23.645 55-59 20.195 28.68 27.615000000000002 23.51 60-64 20.485 28.87 26.595000000000002 24.05 65-69 20.345 28.249999999999996 27.065 24.34 70-74 20.424999999999997 28.749999999999996 27.384999999999998 23.44 75-79 20.0 28.599999999999998 27.33 24.07 80-84 20.474999999999998 28.294999999999998 27.544999999999998 23.685000000000002 85-89 20.4 28.98 27.334999999999997 23.285 90-94 20.595 29.34 26.674999999999997 23.39 95-99 20.79 28.24 27.465 23.505000000000003 100-104 20.805 28.235 27.839999999999996 23.119999999999997 105-109 20.69 28.205000000000002 27.169999999999998 23.935000000000002 110-114 21.175 28.655 26.245 23.925 115-119 20.54 28.93 27.185 23.345 120-124 20.555 27.99 27.36 24.095 125-129 20.09 28.63 27.55 23.73 130-134 20.895 27.775 27.52 23.810000000000002 135-139 21.125 28.485 26.674999999999997 23.715 140-144 20.965 27.96 27.38 23.695 145-149 20.599999999999998 28.32 27.05 24.03 150-151 20.640480360270203 27.658243682762073 27.307980985739306 24.39329497122842 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 2.0 23 3.0 24 3.5 25 5.0 26 4.5 27 6.5 28 10.5 29 16.0 30 20.0 31 27.5 32 36.5 33 43.5 34 57.5 35 80.0 36 89.5 37 103.5 38 145.0 39 166.0 40 186.5 41 211.0 42 230.0 43 255.5 44 250.5 45 257.5 46 286.0 47 268.5 48 220.0 49 188.5 50 173.5 51 144.5 52 113.5 53 87.5 54 66.5 55 57.5 56 48.5 57 34.0 58 24.5 59 21.5 60 14.0 61 11.0 62 6.5 63 2.5 64 3.0 65 1.5 66 2.5 67 4.5 68 2.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.0625 0.025 0.0 0.0 0.0 76-77 0.075 0.025 0.0 0.0 0.0 78-79 0.1 0.025 0.0 0.0 0.0 80-81 0.1 0.025 0.0 0.0 0.0 82-83 0.125 0.025 0.0 0.0 0.0 84-85 0.225 0.025 0.0 0.0 0.0 86-87 0.2875 0.025 0.0 0.0 0.0 88-89 0.3125 0.025 0.0 0.0 0.0 90-91 0.35 0.025 0.0 0.0 0.0 92-93 0.3625 0.025 0.0 0.0 0.0 94-95 0.4125 0.025 0.0 0.0 0.0 96-97 0.4625 0.025 0.0 0.0 0.0 98-99 0.6 0.025 0.0 0.0 0.0 100-101 0.7125 0.025 0.0 0.0 0.0 102-103 0.8125 0.025 0.0 0.0 0.0 104-105 0.9375 0.025 0.0 0.0 0.0 106-107 1.0750000000000002 0.025 0.0 0.0 0.0 108-109 1.1875 0.025 0.0 0.0 0.0 110-111 1.2625000000000002 0.025 0.0 0.0 0.0 112-113 1.375 0.025 0.0 0.0 0.0 114-115 1.55 0.025 0.0 0.0 0.0 116-117 1.7000000000000002 0.025 0.0 0.0 0.0 118-119 1.9125 0.025 0.0 0.0 0.0 120-121 2.05 0.025 0.0 0.0 0.0 122-123 2.175 0.025 0.0 0.0 0.0 124-125 2.5 0.025 0.0 0.0 0.0 126-127 2.6125 0.025 0.0 0.0 0.0 128-129 2.7875 0.025 0.0 0.0 0.0 130-131 3.1500000000000004 0.025 0.0 0.0 0.0 132-133 3.375 0.025 0.0 0.0 0.0 134-135 3.8 0.025 0.0 0.0 0.0 136-137 4.05 0.025 0.0 0.0 0.0 138-139 4.4625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATATT 10 0.006832588 144.9875 4 >>END_MODULE SRR7170178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72325 33.0 33.0 34.0 32.0 34.0 2 32.739 33.0 33.0 34.0 32.0 34.0 3 32.455 33.0 33.0 34.0 32.0 34.0 4 32.03925 34.0 33.0 34.0 31.0 34.0 5 32.106 33.0 33.0 34.0 31.0 34.0 6 36.6995 38.0 38.0 38.0 34.0 38.0 7 36.72725 38.0 38.0 38.0 35.0 38.0 8 36.87525 38.0 38.0 38.0 36.0 38.0 9 36.9555 38.0 38.0 38.0 36.0 38.0 10-14 36.794200000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.5037 38.0 38.0 38.0 35.4 38.0 20-24 36.6491 38.0 38.0 38.0 35.4 38.0 25-29 36.7628 38.0 38.0 38.0 35.8 38.0 30-34 36.77165 38.0 38.0 38.0 36.0 38.0 35-39 36.570899999999995 38.0 38.0 38.0 35.6 38.0 40-44 36.45065 38.0 38.0 38.0 35.0 38.0 45-49 36.3471 38.0 38.0 38.0 34.0 38.0 50-54 36.50455 38.0 38.0 38.0 35.0 38.0 55-59 36.49015 38.0 38.0 38.0 34.4 38.0 60-64 36.3787 38.0 38.0 38.0 34.0 38.0 65-69 36.32375 38.0 38.0 38.0 34.0 38.0 70-74 36.26120000000001 38.0 38.0 38.0 33.8 38.0 75-79 36.19304999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.106649999999995 38.0 38.0 38.0 33.2 38.0 85-89 35.61300000000001 38.0 37.4 38.0 31.4 38.0 90-94 35.1632 38.0 37.0 38.0 28.8 38.0 95-99 35.57725000000001 38.0 37.0 38.0 30.4 38.0 100-104 35.442449999999994 38.0 37.0 38.0 30.2 38.0 105-109 35.29225 38.0 37.0 38.0 29.0 38.0 110-114 35.05135 38.0 36.6 38.0 28.0 38.0 115-119 34.7246 38.0 36.0 38.0 26.6 38.0 120-124 34.46325 38.0 35.6 38.0 25.6 38.0 125-129 33.841449999999995 38.0 35.0 38.0 20.6 38.0 130-134 32.478750000000005 38.0 34.0 38.0 13.8 38.0 135-139 31.05485 38.0 31.8 38.0 2.0 38.0 140-144 30.256099999999996 38.0 30.4 38.0 2.0 38.0 145-149 29.37165 36.6 27.6 38.0 2.0 38.0 150-151 25.46575 33.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 1.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 4.0 11 3.0 12 5.0 13 2.0 14 5.0 15 6.0 16 9.0 17 13.0 18 7.0 19 10.0 20 16.0 21 24.0 22 15.0 23 20.0 24 27.0 25 37.0 26 31.0 27 42.0 28 49.0 29 80.0 30 67.0 31 85.0 32 156.0 33 173.0 34 158.0 35 284.0 36 607.0 37 2042.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.57142857142858 17.644110275689222 17.36842105263158 26.416040100250626 2 26.071697167209827 23.965906242165957 31.411381298571072 18.551015292053147 3 21.721518987341774 27.974683544303797 30.55696202531645 19.746835443037973 4 22.66325224071703 35.8258642765685 22.535211267605636 18.975672215108837 5 23.966309341500764 35.60490045941807 21.235324144971923 19.19346605410924 6 19.85 35.925000000000004 23.525 20.7 7 19.900000000000002 18.2 40.675 21.224999999999998 8 21.475 22.725 27.175 28.625 9 21.525 25.05 28.325 25.1 10-14 22.882332314782346 28.482692982016733 26.849671893002053 21.785302810198868 15-19 22.824169732399334 27.062440155218464 28.32233029279847 21.791059819583733 20-24 22.599889707725474 28.234822279039456 27.8638391738106 21.301448839424474 25-29 22.74 28.13 27.584999999999997 21.545 30-34 23.080000000000002 27.46 27.915 21.545 35-39 22.88424856942074 27.698022286918984 27.933942375263527 21.483786768396747 40-44 22.862181909800956 28.027210884353742 27.66439909297052 21.44620811287478 45-49 22.898958909621285 27.551174370064878 28.40617613036262 21.143690589951213 50-54 22.67473858007705 27.262720768499527 28.37844598989343 21.684094661529997 55-59 23.33066373010311 27.695465011512667 28.336169786765442 20.63770147161878 60-64 23.42310772927513 27.347817380857027 28.248898678414097 20.980176211453745 65-69 23.590950045049556 27.239963960356395 28.075883471819 21.093202522775055 70-74 23.544999999999998 27.810000000000002 27.99 20.655 75-79 23.205000000000002 27.529999999999998 28.43 20.835 80-84 23.0 28.075 27.944999999999997 20.979999999999997 85-89 23.901723876447097 28.27460694605935 27.62752135887973 20.19614781861382 90-94 23.827687925948528 27.891364052487035 28.160919540229884 20.120028481334554 95-99 23.69 28.09 27.634999999999998 20.585 100-104 24.21 27.395000000000003 28.365000000000002 20.03 105-109 23.995 27.295 27.965 20.745 110-114 23.830000000000002 27.205000000000002 28.455000000000002 20.51 115-119 24.7 27.63 27.425 20.244999999999997 120-124 24.745 27.35 27.565 20.34 125-129 24.629303845187234 27.167630057803464 27.579793918069868 20.62327217893943 130-134 24.736322543773056 28.37325297448953 26.913285187301916 19.977139294435496 135-139 24.538103143576286 27.90124779092808 27.338938574412254 20.221710491083382 140-144 25.357239880467265 27.639228470524312 27.34582993751698 19.657701711491445 145-149 25.20408687169482 27.324536632951684 27.42722185141449 20.044154643939006 150-151 25.610677411231432 27.26013598589776 27.184588264920674 19.94459833795014 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 3.0 24 4.0 25 4.5 26 6.5 27 6.5 28 6.0 29 9.5 30 12.5 31 13.5 32 23.0 33 35.0 34 47.0 35 62.0 36 76.5 37 99.0 38 122.5 39 156.0 40 192.5 41 216.5 42 246.0 43 275.5 44 283.5 45 280.5 46 275.0 47 266.5 48 248.0 49 209.0 50 188.0 51 164.5 52 126.0 53 92.5 54 61.0 55 49.0 56 35.5 57 24.5 58 21.0 59 14.0 60 10.0 61 7.5 62 6.5 63 3.5 64 1.5 65 1.5 66 2.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.27499999999999997 3 1.25 4 2.375 5 2.0500000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.185 15-19 0.7849999999999999 20-24 0.265 25-29 0.0 30-34 0.0 35-39 0.38999999999999996 40-44 0.775 45-49 0.585 50-54 0.065 55-59 0.11 60-64 0.12 65-69 0.11 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.095 90-94 1.69 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.525 130-134 3.765 135-139 6.635000000000001 140-144 7.9750000000000005 145-149 2.6149999999999998 150-151 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.5875000000000004 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966892 spots for SRR7170178.sra Written 966892 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra Read 966891 spots for SRR7170178.sra Written 966891 spots for SRR7170178.sra SRR ids: ['SRR7170178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uxytzbrd SRR7170178.sra spots: 19337821 blocks: [[1, 966891], [966892, 1933782], [1933783, 2900673], [2900674, 3867564], [3867565, 4834455], [4834456, 5801346], [5801347, 6768237], [6768238, 7735128], [7735129, 8702019], [8702020, 9668910], [9668911, 10635801], [10635802, 11602692], [11602693, 12569583], [12569584, 13536474], [13536475, 14503365], [14503366, 15470256], [15470257, 16437147], [16437148, 17404038], [17404039, 18370929], [18370930, 19337821]] SRR7170178 file size 6531252 SRR7170178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170178 SRR7170178_1.fastq SRR7170178_2.fastq Input file: SRR7170178_1.fastq Paired file: SRR7170178_2.fastq trimmed: SRR7170178-trimmed-pair1.fastq, SRR7170178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:00:12 2025 >> started Wed Feb 12 17:00:37 2025 >> done (25.082s) 19337821 read pairs processed; of these: 37658 ( 0.19%) short read pairs filtered out after trimming by size control 34976 ( 0.18%) empty read pairs filtered out after trimming by size control 19265187 (99.62%) read pairs available; of these: 11181725 (58.04%) trimmed read pairs available after processing 8083462 (41.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 5 0.00% 23 4 0.00% 24 5 0.00% 25 5 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 11 0.00% 30 17 0.00% 31 7 0.00% 32 8 0.00% 33 17 0.00% 34 11 0.00% 35 10 0.00% 36 17 0.00% 37 24 0.00% 38 20 0.00% 39 28 0.00% 40 23 0.00% 41 30 0.00% 42 37 0.00% 43 42 0.00% 44 46 0.00% 45 50 0.00% 46 51 0.00% 47 82 0.00% 48 77 0.00% 49 84 0.00% 50 109 0.00% 51 90 0.00% 52 133 0.00% 53 132 0.00% 54 164 0.00% 55 149 0.00% 56 186 0.00% 57 180 0.00% 58 230 0.00% 59 255 0.00% 60 295 0.00% 61 361 0.00% 62 394 0.00% 63 435 0.00% 64 473 0.00% 65 520 0.00% 66 671 0.00% 67 864 0.00% 68 1008 0.01% 69 1190 0.01% 70 1590 0.01% 71 1453 0.01% 72 1384 0.01% 73 1527 0.01% 74 1582 0.01% 75 1765 0.01% 76 2036 0.01% 77 2227 0.01% 78 2404 0.01% 79 2750 0.01% 80 3070 0.02% 81 3701 0.02% 82 4107 0.02% 83 4898 0.03% 84 6274 0.03% 85 6903 0.04% 86 7508 0.04% 87 7641 0.04% 88 7973 0.04% 89 8731 0.05% 90 9235 0.05% 91 9965 0.05% 92 10589 0.05% 93 11348 0.06% 94 12142 0.06% 95 12747 0.07% 96 13573 0.07% 97 14203 0.07% 98 14867 0.08% 99 15625 0.08% 100 16559 0.09% 101 17490 0.09% 102 18434 0.10% 103 19590 0.10% 104 21032 0.11% 105 21950 0.11% 106 23234 0.12% 107 24119 0.13% 108 25231 0.13% 109 26260 0.14% 110 26841 0.14% 111 28510 0.15% 112 30172 0.16% 113 31585 0.16% 114 33566 0.17% 115 34862 0.18% 116 36065 0.19% 117 38068 0.20% 118 38921 0.20% 119 40602 0.21% 120 42063 0.22% 121 44758 0.23% 122 47222 0.25% 123 50527 0.26% 124 52810 0.27% 125 55663 0.29% 126 58789 0.31% 127 60899 0.32% 128 64096 0.33% 129 67011 0.35% 130 71010 0.37% 131 75192 0.39% 132 80753 0.42% 133 85651 0.44% 134 92415 0.48% 135 99674 0.52% 136 107505 0.56% 137 115440 0.60% 138 126689 0.66% 139 138802 0.72% 140 152041 0.79% 141 167206 0.87% 142 188114 0.98% 143 210515 1.09% 144 245049 1.27% 145 293159 1.52% 146 361778 1.88% 147 485887 2.52% 148 723128 3.75% 149 1338130 6.95% 150 4714262 24.47% 151 8083462 41.96% 19265187 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=264.24 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=23 prefix-density=0.44 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=76.95 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.3 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7170178 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:01:32 Started mapping on | Feb 12 17:01:33 Finished on | Feb 12 17:03:30 Mapping speed, Million of reads per hour | 592.77 Number of input reads | 19265187 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18255278 Uniquely mapped reads % | 94.76% Average mapped length | 292.29 Number of splices: Total | 17292930 Number of splices: Annotated (sjdb) | 17001780 Number of splices: GT/AG | 17033978 Number of splices: GC/AG | 205432 Number of splices: AT/AC | 14873 Number of splices: Non-canonical | 38647 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350359 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 33637 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689903 689903 689903 N_multimapping 350359 350359 350359 N_noFeature 412382 18074994 490879 N_ambiguous 177551 816 75290 UnstrandedReadsAssigned:17665345 PositiveStrandReadsAssigned:179468 NegativeStrandReadsAssigned:17689109 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170178-trimmed-pair1.fastq SRR7170178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,265,187 reads, 17,558,612 reads pseudoaligned [quant] estimated average fragment length: 255.103 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7170178.ke.tsv 34699 SRR7170178.se.tsv 87100 total ==> SRR7170178.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.9 450 14.2477 Potri.005G024800.1.v4.1 1035 780.897 53 3.79041 Potri.004G059700.1.v4.1 961 706.942 1 0.0789988 Potri.007G009000.2.v4.1 1416 1161.9 0 0 Potri.003G141000.2.v4.1 2943 2688.9 303 6.29322 Potri.016G087400.1.v4.1 270 79.7988 1701 1190.45 Potri.015G069301.1.v4.1 564 318.034 0 0 Potri.010G195200.1.v4.1 1773 1518.9 31 1.13982 Potri.012G127500.1.v4.1 977 722.923 5841 451.232 ==> SRR7170178.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1043 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7170178 completed mapping pipeline successfully