Starting /dee2/code/volunteer_pipeline.sh SRR7170179 current disk space = 3051546316800 free memory = 1578132252 SRR7170179 SRAfilesize f902404e373d2e80be592d5ca4a6ebdd SRR7170179.sra SRR7170179.sra file validated SRR7170179 is paired end SRR7170179 is conventional basespace SRR7170179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0035 34.0 33.0 34.0 33.0 34.0 2 33.3575 34.0 33.0 34.0 33.0 34.0 3 33.42275 34.0 33.0 34.0 33.0 34.0 4 33.39975 34.0 33.0 34.0 33.0 34.0 5 33.37525 34.0 33.0 34.0 33.0 34.0 6 37.10825 38.0 37.0 38.0 36.0 38.0 7 35.51975 38.0 37.0 38.0 29.0 38.0 8 37.103 38.0 38.0 38.0 36.0 38.0 9 37.403 38.0 38.0 38.0 37.0 38.0 10-14 37.05735 38.0 37.8 38.0 35.8 38.0 15-19 37.37714999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.490750000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.47425 38.0 38.0 38.0 37.8 38.0 30-34 37.4711 38.0 38.0 38.0 38.0 38.0 35-39 37.37455 38.0 38.0 38.0 37.0 38.0 40-44 37.25285 38.0 38.0 38.0 37.0 38.0 45-49 36.33 38.0 37.4 38.0 32.8 38.0 50-54 36.94025 38.0 37.8 38.0 35.4 38.0 55-59 36.971199999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.05215 38.0 38.0 38.0 36.0 38.0 65-69 37.06305 38.0 38.0 38.0 36.0 38.0 70-74 36.1183 38.0 37.4 38.0 32.0 38.0 75-79 36.7769 38.0 38.0 38.0 35.2 38.0 80-84 36.7615 38.0 38.0 38.0 35.0 38.0 85-89 36.55045 38.0 38.0 38.0 34.4 38.0 90-94 36.551849999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.477850000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.44495 38.0 38.0 38.0 34.0 38.0 105-109 36.16325 38.0 37.4 38.0 33.2 38.0 110-114 36.0839 38.0 37.6 38.0 33.6 38.0 115-119 35.789049999999996 38.0 36.8 38.0 31.8 38.0 120-124 35.809200000000004 38.0 37.0 38.0 32.0 38.0 125-129 35.650850000000005 38.0 36.8 38.0 31.4 38.0 130-134 35.3805 38.0 36.2 38.0 30.4 38.0 135-139 35.0769 38.0 36.0 38.0 29.0 38.0 140-144 34.67274999999999 38.0 35.2 38.0 27.4 38.0 145-149 34.38405 38.0 35.2 38.0 27.4 38.0 150-151 30.640124999999998 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 3.0 15 2.0 16 3.0 17 1.0 18 5.0 19 8.0 20 4.0 21 4.0 22 2.0 23 3.0 24 9.0 25 20.0 26 16.0 27 20.0 28 29.0 29 44.0 30 50.0 31 51.0 32 66.0 33 104.0 34 146.0 35 254.0 36 652.0 37 2501.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.81578947368421 15.612348178137653 13.006072874493926 32.56578947368421 2 20.25 19.675 34.4 25.674999999999997 3 19.900000000000002 26.275 26.05 27.775 4 22.55 32.875 22.35 22.225 5 21.060530265132567 34.44222111055527 24.262131065532767 20.23511755877939 6 17.325 34.5 26.375 21.8 7 13.775 24.075 43.1 19.05 8 19.35 23.7 28.9 28.050000000000004 9 18.7 25.525 31.1 24.675 10-14 20.064999999999998 29.195 26.965 23.775 15-19 19.09 29.354999999999997 27.76 23.794999999999998 20-24 19.905 28.610000000000003 27.205000000000002 24.279999999999998 25-29 20.235 29.015 27.465 23.285 30-34 19.62 28.345 27.52 24.515 35-39 20.150000000000002 29.225 26.945000000000004 23.68 40-44 20.255000000000003 28.24 27.515 23.990000000000002 45-49 20.575 28.475 27.105 23.845 50-54 20.14 28.535 27.08 24.245 55-59 20.615 28.265 27.415 23.705000000000002 60-64 20.305 28.315 27.045 24.335 65-69 20.294999999999998 28.689999999999998 27.310000000000002 23.705000000000002 70-74 20.76 28.775000000000002 26.715 23.75 75-79 20.43 28.26 27.060000000000002 24.25 80-84 20.244999999999997 27.889999999999997 27.365000000000002 24.5 85-89 21.165 27.765 27.365000000000002 23.705000000000002 90-94 20.75 28.249999999999996 26.995 24.005000000000003 95-99 20.549999999999997 28.13 27.55 23.77 100-104 21.16 28.310000000000002 26.555 23.974999999999998 105-109 20.585 28.01 26.82 24.585 110-114 20.36 28.27 27.36 24.01 115-119 21.165 28.605000000000004 26.224999999999998 24.005000000000003 120-124 21.075 28.485 26.395000000000003 24.044999999999998 125-129 21.235 27.765 27.015 23.985 130-134 21.34 28.105000000000004 26.575 23.98 135-139 21.37 27.74 26.625 24.265 140-144 20.77707770777078 28.83788378837884 25.687568756875688 24.697469746974697 145-149 21.47 28.294999999999998 25.915 24.32 150-151 21.567891972993248 28.51962990747687 25.056264066016503 24.85621405351338 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 4.0 26 4.5 27 7.0 28 11.5 29 15.0 30 20.0 31 25.0 32 34.5 33 48.0 34 56.5 35 76.5 36 96.5 37 106.5 38 120.0 39 153.0 40 179.0 41 192.0 42 220.0 43 232.0 44 239.5 45 249.5 46 256.5 47 257.0 48 237.5 49 213.5 50 181.5 51 144.5 52 129.5 53 120.5 54 92.5 55 59.0 56 42.5 57 33.5 58 29.5 59 33.0 60 22.0 61 10.5 62 12.5 63 8.0 64 2.0 65 2.5 66 3.0 67 2.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.3772635814889336 0.75 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025150905432595575 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 8 0.2 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.3625 0.0 0.0 0.0 0.0 122-123 4.775 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.8375 0.0 0.0 0.0 0.0 136-137 8.4625 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAAAT 10 0.006577216 146.82278 1 AGAGCCT 10 0.006832588 144.9875 7 AAAGTTC 10 0.006832588 144.9875 9 >>END_MODULE SRR7170179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.818 33.0 33.0 34.0 32.0 34.0 2 32.9255 34.0 33.0 34.0 32.0 34.0 3 32.851 34.0 33.0 34.0 32.0 34.0 4 32.743 34.0 33.0 34.0 32.0 34.0 5 32.8465 34.0 33.0 34.0 32.0 34.0 6 36.87575 38.0 38.0 38.0 37.0 38.0 7 36.88 38.0 38.0 38.0 37.0 38.0 8 36.77325 38.0 38.0 38.0 36.0 38.0 9 36.81925 38.0 38.0 38.0 36.0 38.0 10-14 36.718 38.0 38.0 38.0 36.0 38.0 15-19 36.8311 38.0 38.0 38.0 36.8 38.0 20-24 36.6297 38.0 38.0 38.0 35.8 38.0 25-29 36.679750000000006 38.0 38.0 38.0 36.6 38.0 30-34 36.70360000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.570449999999994 38.0 38.0 38.0 35.6 38.0 40-44 36.461200000000005 38.0 38.0 38.0 35.2 38.0 45-49 36.49634999999999 38.0 38.0 38.0 35.6 38.0 50-54 36.505849999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.53005 38.0 38.0 38.0 35.8 38.0 60-64 36.53255 38.0 38.0 38.0 36.0 38.0 65-69 36.50875 38.0 38.0 38.0 35.8 38.0 70-74 36.291650000000004 38.0 38.0 38.0 34.8 38.0 75-79 35.94775 38.0 38.0 38.0 33.2 38.0 80-84 36.1178 38.0 38.0 38.0 34.2 38.0 85-89 36.1863 38.0 38.0 38.0 34.4 38.0 90-94 36.11765 38.0 38.0 38.0 34.2 38.0 95-99 36.11815 38.0 38.0 38.0 34.2 38.0 100-104 35.95334999999999 38.0 38.0 38.0 33.8 38.0 105-109 35.825849999999996 38.0 38.0 38.0 33.4 38.0 110-114 35.717549999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.47485 38.0 38.0 38.0 31.4 38.0 120-124 35.4827 38.0 37.8 38.0 32.6 38.0 125-129 35.1522 38.0 37.0 38.0 30.6 38.0 130-134 34.74805 38.0 36.2 38.0 28.2 38.0 135-139 34.32795 38.0 35.6 38.0 25.0 38.0 140-144 34.10745 38.0 35.8 38.0 23.4 38.0 145-149 33.55615 38.0 34.8 38.0 17.2 38.0 150-151 29.668625000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 3.0 4 3.0 5 4.0 6 4.0 7 8.0 8 3.0 9 1.0 10 3.0 11 9.0 12 3.0 13 4.0 14 3.0 15 6.0 16 7.0 17 13.0 18 2.0 19 6.0 20 10.0 21 11.0 22 12.0 23 15.0 24 11.0 25 24.0 26 14.0 27 24.0 28 27.0 29 28.0 30 36.0 31 49.0 32 55.0 33 83.0 34 120.0 35 202.0 36 462.0 37 2712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 16.175 18.0 25.874999999999996 2 24.775 25.45 30.475 19.3 3 23.575 28.15 28.9 19.375 4 25.35 33.0 21.325 20.325 5 24.675 35.199999999999996 22.125 18.0 6 19.975 35.775 24.975 19.275000000000002 7 20.4 19.625 38.074999999999996 21.9 8 23.150000000000002 22.8 26.224999999999998 27.825 9 22.35 25.900000000000002 27.750000000000004 24.0 10-14 24.025 27.47 25.990000000000002 22.515 15-19 24.13 28.24 26.435 21.195 20-24 23.645 28.444999999999997 26.765 21.145 25-29 24.015 28.38 26.505000000000003 21.099999999999998 30-34 23.905 28.384999999999998 26.784999999999997 20.925 35-39 23.86 28.29 26.565 21.285 40-44 24.217265179553866 27.788336500950283 26.85805741722517 21.136340902270682 45-49 23.65973194638928 27.895579115823168 27.000400080016 21.444288857771554 50-54 23.925 28.16 27.26 20.655 55-59 24.215 27.215 27.66 20.91 60-64 23.625 28.744999999999997 26.895000000000003 20.735 65-69 24.135 27.839999999999996 26.955000000000002 21.07 70-74 24.04 27.189999999999998 27.73 21.04 75-79 24.107410741074105 27.367736773677372 27.567756775677566 20.957095709570957 80-84 24.25 27.439999999999998 27.189999999999998 21.12 85-89 23.94 27.950000000000003 27.605 20.505000000000003 90-94 24.68 27.644999999999996 26.924999999999997 20.75 95-99 24.295 27.705000000000002 27.3 20.7 100-104 24.555 28.08 27.150000000000002 20.215 105-109 24.55 27.744999999999997 27.134999999999998 20.57 110-114 24.68 27.98 26.889999999999997 20.45 115-119 24.55 27.779999999999998 26.965 20.705000000000002 120-124 25.124999999999996 27.825 26.779999999999998 20.27 125-129 25.41 28.03 26.540000000000003 20.02 130-134 25.324999999999996 27.750000000000004 27.060000000000002 19.865 135-139 25.569999999999997 28.345 26.090000000000003 19.994999999999997 140-144 25.468820323048458 28.149222383357504 26.293944091613742 20.0880132019803 145-149 25.540000000000003 28.03 26.700000000000003 19.73 150-151 25.735754539762052 26.612398246712587 27.388854101440202 20.26299311208516 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 2.0 21 0.5 22 0.0 23 0.5 24 2.0 25 1.5 26 1.0 27 1.5 28 1.5 29 2.0 30 4.0 31 9.0 32 13.0 33 18.5 34 28.5 35 40.5 36 52.5 37 81.5 38 124.5 39 158.0 40 177.5 41 197.0 42 237.0 43 272.5 44 271.0 45 275.5 46 296.0 47 273.0 48 252.0 49 230.5 50 194.0 51 162.5 52 129.5 53 117.0 54 99.5 55 70.5 56 46.5 57 33.0 58 28.5 59 24.0 60 17.0 61 13.0 62 8.5 63 6.5 64 6.5 65 4.0 66 3.5 67 2.5 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42021678850517 98.6 2 0.4789513486261659 0.95 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025207965717166627 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.449999999999999 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.625 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 8.0625 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACTGG 10 0.006830828 145.0 8 >>END_MODULE Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787715 spots for SRR7170179.sra Written 787715 spots for SRR7170179.sra Read 787727 spots for SRR7170179.sra Written 787727 spots for SRR7170179.sra SRR ids: ['SRR7170179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vqqntq4q SRR7170179.sra spots: 15754312 blocks: [[1, 787715], [787716, 1575430], [1575431, 2363145], [2363146, 3150860], [3150861, 3938575], [3938576, 4726290], [4726291, 5514005], [5514006, 6301720], [6301721, 7089435], [7089436, 7877150], [7877151, 8664865], [8664866, 9452580], [9452581, 10240295], [10240296, 11028010], [11028011, 11815725], [11815726, 12603440], [12603441, 13391155], [13391156, 14178870], [14178871, 14966585], [14966586, 15754312]] SRR7170179 file size 5316919 SRR7170179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170179 SRR7170179_1.fastq SRR7170179_2.fastq Input file: SRR7170179_1.fastq Paired file: SRR7170179_2.fastq trimmed: SRR7170179-trimmed-pair1.fastq, SRR7170179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:56:56 2025 >> started Wed Feb 12 17:57:13 2025 >> done (16.832s) 15754312 read pairs processed; of these: 52511 ( 0.33%) short read pairs filtered out after trimming by size control 60286 ( 0.38%) empty read pairs filtered out after trimming by size control 15641515 (99.28%) read pairs available; of these: 7239245 (46.28%) trimmed read pairs available after processing 8402270 (53.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 8 0.00% 21 10 0.00% 22 11 0.00% 23 13 0.00% 24 13 0.00% 25 7 0.00% 26 17 0.00% 27 13 0.00% 28 14 0.00% 29 20 0.00% 30 16 0.00% 31 13 0.00% 32 19 0.00% 33 11 0.00% 34 19 0.00% 35 28 0.00% 36 30 0.00% 37 31 0.00% 38 30 0.00% 39 20 0.00% 40 27 0.00% 41 51 0.00% 42 55 0.00% 43 50 0.00% 44 58 0.00% 45 87 0.00% 46 71 0.00% 47 92 0.00% 48 80 0.00% 49 97 0.00% 50 128 0.00% 51 129 0.00% 52 152 0.00% 53 154 0.00% 54 175 0.00% 55 178 0.00% 56 177 0.00% 57 249 0.00% 58 235 0.00% 59 311 0.00% 60 320 0.00% 61 390 0.00% 62 407 0.00% 63 477 0.00% 64 507 0.00% 65 678 0.00% 66 736 0.00% 67 860 0.01% 68 1180 0.01% 69 3201 0.02% 70 4726 0.03% 71 2455 0.02% 72 1936 0.01% 73 1880 0.01% 74 2010 0.01% 75 2221 0.01% 76 2265 0.01% 77 2612 0.02% 78 2725 0.02% 79 2953 0.02% 80 3355 0.02% 81 3968 0.03% 82 4715 0.03% 83 5464 0.03% 84 8036 0.05% 85 9649 0.06% 86 9956 0.06% 87 10612 0.07% 88 10870 0.07% 89 11339 0.07% 90 11765 0.08% 91 12420 0.08% 92 13148 0.08% 93 14159 0.09% 94 14757 0.09% 95 15481 0.10% 96 16277 0.10% 97 16807 0.11% 98 17125 0.11% 99 18356 0.12% 100 19567 0.13% 101 20337 0.13% 102 21821 0.14% 103 23049 0.15% 104 24283 0.16% 105 25825 0.17% 106 26421 0.17% 107 26669 0.17% 108 27504 0.18% 109 28812 0.18% 110 29327 0.19% 111 31310 0.20% 112 32704 0.21% 113 34327 0.22% 114 35891 0.23% 115 37338 0.24% 116 38092 0.24% 117 38627 0.25% 118 38965 0.25% 119 40000 0.26% 120 40888 0.26% 121 42604 0.27% 122 44435 0.28% 123 46621 0.30% 124 48437 0.31% 125 50179 0.32% 126 51813 0.33% 127 52697 0.34% 128 53972 0.35% 129 55147 0.35% 130 55956 0.36% 131 58100 0.37% 132 60953 0.39% 133 64037 0.41% 134 67277 0.43% 135 70581 0.45% 136 73536 0.47% 137 77401 0.49% 138 79783 0.51% 139 83468 0.53% 140 86655 0.55% 141 92244 0.59% 142 100334 0.64% 143 111001 0.71% 144 125216 0.80% 145 145010 0.93% 146 173735 1.11% 147 223957 1.43% 148 323031 2.07% 149 585659 3.74% 150 3227947 20.64% 151 8402270 53.72% 15641515 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=42 prefix-density=0.27 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=55.20 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=14.2 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=35.35 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=10.1 sequence=TCAAGGAAGCTTTCAG SRR7170179 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:58:01 Started mapping on | Feb 12 17:58:01 Finished on | Feb 12 18:00:25 Mapping speed, Million of reads per hour | 391.04 Number of input reads | 15641515 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14029994 Uniquely mapped reads % | 89.70% Average mapped length | 291.76 Number of splices: Total | 12791301 Number of splices: Annotated (sjdb) | 12555556 Number of splices: GT/AG | 12595512 Number of splices: GC/AG | 151307 Number of splices: AT/AC | 10983 Number of splices: Non-canonical | 33499 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298797 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 28791 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.15% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1354020 1354020 1354020 N_multimapping 298797 298797 298797 N_noFeature 287827 13856261 351745 N_ambiguous 169918 1117 59284 UnstrandedReadsAssigned:13572249 PositiveStrandReadsAssigned:172616 NegativeStrandReadsAssigned:13618965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170179-trimmed-pair1.fastq SRR7170179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,641,515 reads, 13,638,244 reads pseudoaligned [quant] estimated average fragment length: 226.466 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7170179.ke.tsv 34699 SRR7170179.se.tsv 87100 total ==> SRR7170179.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.53 282 9.98016 Potri.005G024800.1.v4.1 1035 809.534 34 2.6644 Potri.004G059700.1.v4.1 961 735.561 11 0.948702 Potri.007G009000.2.v4.1 1416 1190.53 0 0 Potri.003G141000.2.v4.1 2943 2717.53 276 6.44302 Potri.016G087400.1.v4.1 270 87.3023 1615 1173.55 Potri.015G069301.1.v4.1 564 342.087 0 0 Potri.010G195200.1.v4.1 1773 1547.53 7 0.286955 Potri.012G127500.1.v4.1 977 751.545 5501 464.347 ==> SRR7170179.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 623 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170179 completed mapping pipeline successfully