Starting /dee2/code/volunteer_pipeline.sh SRR7170180 current disk space = 3051918667776 free memory = 1467601924 SRR7170180 SRAfilesize 07837a35520b8dafbae11a4d0e81ba0d SRR7170180.sra SRR7170180.sra file validated SRR7170180 is paired end SRR7170180 is conventional basespace SRR7170180 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170180_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02225 34.0 33.0 34.0 33.0 34.0 2 33.48975 34.0 34.0 34.0 33.0 34.0 3 33.5585 34.0 34.0 34.0 33.0 34.0 4 33.6015 34.0 34.0 34.0 33.0 34.0 5 33.61925 34.0 34.0 34.0 33.0 34.0 6 37.3215 38.0 38.0 38.0 37.0 38.0 7 37.44725 38.0 38.0 38.0 37.0 38.0 8 37.63975 38.0 38.0 38.0 38.0 38.0 9 37.65725 38.0 38.0 38.0 38.0 38.0 10-14 37.3551 38.0 38.0 38.0 37.2 38.0 15-19 37.6048 38.0 38.0 38.0 38.0 38.0 20-24 37.66205 38.0 38.0 38.0 38.0 38.0 25-29 37.64955 38.0 38.0 38.0 38.0 38.0 30-34 37.61505 38.0 38.0 38.0 38.0 38.0 35-39 37.447250000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.41395 38.0 38.0 38.0 37.8 38.0 45-49 37.34815 38.0 38.0 38.0 37.2 38.0 50-54 37.334050000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.33045 38.0 38.0 38.0 37.0 38.0 60-64 37.308749999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2445 38.0 38.0 38.0 37.0 38.0 70-74 37.16555 38.0 38.0 38.0 37.0 38.0 75-79 36.93705 38.0 38.0 38.0 36.0 38.0 80-84 37.01705 38.0 38.0 38.0 36.0 38.0 85-89 37.00834999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.921400000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.8793 38.0 38.0 38.0 36.0 38.0 100-104 36.7412 38.0 38.0 38.0 35.6 38.0 105-109 36.70365 38.0 38.0 38.0 35.6 38.0 110-114 36.6135 38.0 38.0 38.0 34.8 38.0 115-119 36.4754 38.0 38.0 38.0 34.6 38.0 120-124 36.2898 38.0 38.0 38.0 34.0 38.0 125-129 36.20725 38.0 38.0 38.0 33.8 38.0 130-134 36.00815 38.0 37.8 38.0 33.4 38.0 135-139 35.8175 38.0 37.8 38.0 33.0 38.0 140-144 35.6273 38.0 37.0 38.0 33.0 38.0 145-149 35.301550000000006 38.0 36.0 38.0 32.2 38.0 150-151 32.39325 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 1.0 13 0.0 14 4.0 15 3.0 16 4.0 17 4.0 18 2.0 19 6.0 20 6.0 21 6.0 22 6.0 23 3.0 24 11.0 25 8.0 26 11.0 27 9.0 28 14.0 29 16.0 30 23.0 31 35.0 32 37.0 33 78.0 34 96.0 35 155.0 36 406.0 37 3052.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.726374461616416 12.79452748923233 13.959969597162402 33.51912845198885 2 21.925 18.025 33.7 26.35 3 20.25 25.874999999999996 25.85 28.025 4 23.775 32.025 22.400000000000002 21.8 5 21.075 35.425000000000004 24.65 18.85 6 17.45 36.05 25.575 20.925 7 13.775 24.65 42.175000000000004 19.400000000000002 8 17.5 24.575 29.375 28.549999999999997 9 17.599999999999998 24.775 32.75 24.875 10-14 19.875 30.73 26.365 23.03 15-19 19.794999999999998 29.360000000000003 27.46 23.385 20-24 19.939999999999998 29.465000000000003 26.905 23.69 25-29 19.725 29.62 26.950000000000003 23.705000000000002 30-34 19.215 29.799999999999997 27.345000000000002 23.64 35-39 19.975 29.235 27.525 23.265 40-44 19.825 28.92 27.61 23.645 45-49 20.271013550677534 28.656432821641083 27.266363318165908 23.806190309515475 50-54 19.81 29.220000000000002 26.865 24.104999999999997 55-59 20.075000000000003 28.79 27.025 24.11 60-64 20.11 28.95 27.57 23.369999999999997 65-69 20.25 29.049999999999997 27.1 23.599999999999998 70-74 20.18 29.48 26.945000000000004 23.395 75-79 20.19 29.044999999999998 27.305 23.46 80-84 20.625 29.025000000000002 26.705000000000002 23.645 85-89 20.265 28.16 27.55 24.025 90-94 19.91 28.845 27.224999999999998 24.02 95-99 20.13 28.985 27.529999999999998 23.355 100-104 20.54116234870461 28.403521056316894 26.788036410923276 24.267280184055217 105-109 20.66 28.99 26.85 23.5 110-114 20.49 28.799999999999997 26.795 23.915 115-119 20.169999999999998 28.189999999999998 27.189999999999998 24.45 120-124 20.599999999999998 28.665000000000003 27.250000000000004 23.485 125-129 20.706035301765088 27.986399319965997 27.191359567978402 24.116205810290513 130-134 21.279999999999998 27.735 26.965 24.02 135-139 20.885 28.15 27.175 23.79 140-144 21.125 27.235 27.865000000000002 23.775 145-149 20.755000000000003 28.044999999999998 27.189999999999998 24.01 150-151 21.2625 27.525 26.7125 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 2.5 21 4.0 22 3.0 23 4.5 24 4.0 25 3.5 26 4.5 27 4.5 28 11.0 29 19.0 30 20.5 31 29.0 32 41.0 33 48.0 34 60.0 35 78.5 36 101.5 37 121.0 38 131.5 39 149.0 40 176.5 41 203.5 42 228.0 43 252.0 44 263.5 45 266.5 46 268.5 47 246.5 48 222.0 49 208.0 50 170.0 51 135.0 52 127.5 53 110.0 54 81.5 55 52.0 56 32.0 57 29.0 58 23.0 59 13.0 60 11.0 61 9.0 62 5.5 63 5.0 64 3.5 65 1.5 66 2.5 67 3.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5283018867924528 1.05 3 0.0 0.0 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 5 0.125 TruSeq Adapter, Index 10 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1624999999999996 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.5125 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTGT 10 0.006830828 145.0 2 GAAAAGG 10 0.006830828 145.0 3 GAAAAAC 10 0.006830828 145.0 9 TCAATTC 10 0.006830828 145.0 8 >>END_MODULE SRR7170180 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170180_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09925 34.0 33.0 34.0 32.0 34.0 2 33.1385 34.0 33.0 34.0 33.0 34.0 3 33.16725 34.0 33.0 34.0 33.0 34.0 4 33.09575 34.0 33.0 34.0 33.0 34.0 5 33.16725 34.0 33.0 34.0 33.0 34.0 6 37.2175 38.0 38.0 38.0 38.0 38.0 7 37.11975 38.0 38.0 38.0 38.0 38.0 8 37.19925 38.0 38.0 38.0 38.0 38.0 9 37.197 38.0 38.0 38.0 38.0 38.0 10-14 37.182249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.170100000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.212599999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.149 38.0 38.0 38.0 38.0 38.0 30-34 37.128550000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.0214 38.0 38.0 38.0 37.0 38.0 40-44 37.1391 38.0 38.0 38.0 37.8 38.0 45-49 37.07555 38.0 38.0 38.0 37.6 38.0 50-54 37.00085 38.0 38.0 38.0 37.0 38.0 55-59 37.00505 38.0 38.0 38.0 37.0 38.0 60-64 37.06015 38.0 38.0 38.0 37.0 38.0 65-69 36.9868 38.0 38.0 38.0 37.0 38.0 70-74 36.852650000000004 38.0 38.0 38.0 37.0 38.0 75-79 36.865500000000004 38.0 38.0 38.0 36.8 38.0 80-84 36.843399999999995 38.0 38.0 38.0 36.6 38.0 85-89 36.7763 38.0 38.0 38.0 36.6 38.0 90-94 36.7444 38.0 38.0 38.0 36.0 38.0 95-99 36.69685 38.0 38.0 38.0 36.0 38.0 100-104 36.6303 38.0 38.0 38.0 36.0 38.0 105-109 36.48025 38.0 38.0 38.0 35.6 38.0 110-114 36.372299999999996 38.0 38.0 38.0 35.0 38.0 115-119 36.263549999999995 38.0 38.0 38.0 34.6 38.0 120-124 36.1263 38.0 38.0 38.0 34.0 38.0 125-129 36.00175 38.0 38.0 38.0 34.0 38.0 130-134 35.8158 38.0 38.0 38.0 33.6 38.0 135-139 35.718399999999995 38.0 38.0 38.0 33.2 38.0 140-144 35.35815 38.0 37.4 38.0 32.2 38.0 145-149 34.7589 38.0 36.0 38.0 28.8 38.0 150-151 31.876125000000002 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 12.0 4 0.0 5 1.0 6 2.0 7 0.0 8 3.0 9 0.0 10 1.0 11 4.0 12 2.0 13 0.0 14 3.0 15 0.0 16 6.0 17 13.0 18 5.0 19 9.0 20 2.0 21 9.0 22 6.0 23 6.0 24 13.0 25 10.0 26 15.0 27 15.0 28 25.0 29 16.0 30 17.0 31 48.0 32 37.0 33 54.0 34 76.0 35 126.0 36 300.0 37 3154.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.759689922480625 17.329332333083272 19.35483870967742 24.55613903475869 2 26.156539134783696 24.381095273818453 31.30782695673918 18.154538634658664 3 23.45 27.900000000000002 29.299999999999997 19.35 4 25.900000000000002 32.300000000000004 21.349999999999998 20.45 5 25.156289072268066 35.43385846461615 23.005751437859466 16.404101025256317 6 20.549999999999997 36.375 23.474999999999998 19.6 7 20.95 20.175 37.574999999999996 21.3 8 22.15 22.8 27.400000000000002 27.650000000000002 9 21.325 25.624999999999996 28.975 24.075 10-14 24.121206060303017 28.0114005700285 26.161308065403272 21.706085304265212 15-19 23.986199309965496 27.1963598179909 27.30636531826591 21.51107555377769 20-24 23.971198559928 27.376368818440923 27.931396569828493 20.721036051802592 25-29 23.905 28.18 26.784999999999997 21.13 30-34 23.72 28.015 27.16 21.105 35-39 23.33116655832792 27.641382069103454 27.521376068803438 21.506075303765186 40-44 23.985 27.72 26.965 21.33 45-49 23.52 27.994999999999997 27.63 20.855 50-54 23.849999999999998 27.800000000000004 27.38 20.97 55-59 24.386219310965547 27.461373068653433 27.536376818840942 20.616030801540077 60-64 23.810000000000002 27.13 28.055000000000003 21.005 65-69 23.661183059152957 27.181359067953398 27.68638431921596 21.471073553677684 70-74 23.97 27.355 27.405 21.27 75-79 23.715 26.955000000000002 27.735 21.595 80-84 23.86 27.955000000000002 27.665 20.52 85-89 23.5 27.639999999999997 27.884999999999998 20.974999999999998 90-94 24.035 27.46 28.005000000000003 20.5 95-99 23.461173058652932 27.386369318465924 28.47642382119106 20.676033801690085 100-104 23.951197559877993 27.896394819740987 27.726386319315964 20.426021301065052 105-109 23.988395938578503 27.119491822137746 28.46996448757065 20.422147751713098 110-114 24.03543011559826 27.738577791122452 27.958764950207676 20.26722714307161 115-119 24.17780447514642 27.726885918806627 27.937127696851377 20.158181909195573 120-124 24.80748074807481 27.582758275827583 27.437743774377438 20.172017201720173 125-129 24.32621631081554 28.001400070003502 27.316365818290915 20.356017800890044 130-134 24.31851147901766 27.699694893212623 27.734707147501624 20.247086480268095 135-139 23.961198059902994 27.901395069753487 27.66638331916596 20.47102355117756 140-144 25.115 27.375 27.169999999999998 20.34 145-149 25.07128207693462 27.252263518583362 27.747486368865992 19.928968035616027 150-151 24.603075384423054 27.353419177397175 27.890986373296663 20.15251906488311 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 4.0 29 4.5 30 5.5 31 11.5 32 12.5 33 12.5 34 23.0 35 38.5 36 60.0 37 85.0 38 115.5 39 154.0 40 188.0 41 214.5 42 248.5 43 283.0 44 289.5 45 287.0 46 305.0 47 287.0 48 253.0 49 219.0 50 182.0 51 160.0 52 127.0 53 101.5 54 77.5 55 61.0 56 50.0 57 36.0 58 25.5 59 17.5 60 12.5 61 9.0 62 6.0 63 5.0 64 3.5 65 4.5 66 4.0 67 1.5 68 2.5 69 1.5 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.005 105-109 0.034999999999999996 110-114 0.08499999999999999 115-119 0.11499999999999999 120-124 0.01 125-129 0.005 130-134 0.034999999999999996 135-139 0.005 140-144 0.0 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.45294413688978363 0.8999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.2874999999999996 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.9749999999999996 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554491 spots for SRR7170180.sra Written 554491 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra Read 554486 spots for SRR7170180.sra Written 554486 spots for SRR7170180.sra SRR ids: ['SRR7170180.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ag6vx847 SRR7170180.sra spots: 11089725 blocks: [[1, 554486], [554487, 1108972], [1108973, 1663458], [1663459, 2217944], [2217945, 2772430], [2772431, 3326916], [3326917, 3881402], [3881403, 4435888], [4435889, 4990374], [4990375, 5544860], [5544861, 6099346], [6099347, 6653832], [6653833, 7208318], [7208319, 7762804], [7762805, 8317290], [8317291, 8871776], [8871777, 9426262], [9426263, 9980748], [9980749, 10535234], [10535235, 11089725]] SRR7170180 file size 3736243 SRR7170180 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170180 SRR7170180_1.fastq SRR7170180_2.fastq Input file: SRR7170180_1.fastq Paired file: SRR7170180_2.fastq trimmed: SRR7170180-trimmed-pair1.fastq, SRR7170180-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:11:19 2025 >> started Wed Feb 12 17:11:33 2025 >> done (13.266s) 11089725 read pairs processed; of these: 22089 ( 0.20%) short read pairs filtered out after trimming by size control 20535 ( 0.19%) empty read pairs filtered out after trimming by size control 11047101 (99.62%) read pairs available; of these: 4318701 (39.09%) trimmed read pairs available after processing 6728400 (60.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 7 0.00% 23 8 0.00% 24 5 0.00% 25 8 0.00% 26 7 0.00% 27 10 0.00% 28 7 0.00% 29 11 0.00% 30 11 0.00% 31 6 0.00% 32 11 0.00% 33 5 0.00% 34 13 0.00% 35 10 0.00% 36 9 0.00% 37 7 0.00% 38 10 0.00% 39 11 0.00% 40 14 0.00% 41 21 0.00% 42 20 0.00% 43 20 0.00% 44 25 0.00% 45 29 0.00% 46 33 0.00% 47 36 0.00% 48 45 0.00% 49 28 0.00% 50 52 0.00% 51 47 0.00% 52 45 0.00% 53 44 0.00% 54 68 0.00% 55 89 0.00% 56 76 0.00% 57 89 0.00% 58 108 0.00% 59 100 0.00% 60 112 0.00% 61 130 0.00% 62 188 0.00% 63 178 0.00% 64 174 0.00% 65 238 0.00% 66 282 0.00% 67 384 0.00% 68 610 0.01% 69 1625 0.01% 70 2849 0.03% 71 1293 0.01% 72 853 0.01% 73 851 0.01% 74 836 0.01% 75 918 0.01% 76 1028 0.01% 77 1050 0.01% 78 1111 0.01% 79 1262 0.01% 80 1424 0.01% 81 1664 0.02% 82 1805 0.02% 83 2121 0.02% 84 3335 0.03% 85 4136 0.04% 86 4398 0.04% 87 4808 0.04% 88 5140 0.05% 89 5241 0.05% 90 5564 0.05% 91 5921 0.05% 92 6063 0.05% 93 6382 0.06% 94 6667 0.06% 95 6938 0.06% 96 7517 0.07% 97 7704 0.07% 98 8124 0.07% 99 8478 0.08% 100 9060 0.08% 101 9347 0.08% 102 10118 0.09% 103 10644 0.10% 104 11194 0.10% 105 11970 0.11% 106 12329 0.11% 107 12655 0.11% 108 13053 0.12% 109 13638 0.12% 110 14241 0.13% 111 15072 0.14% 112 15715 0.14% 113 16894 0.15% 114 17827 0.16% 115 18061 0.16% 116 18636 0.17% 117 19006 0.17% 118 19268 0.17% 119 19638 0.18% 120 20622 0.19% 121 21355 0.19% 122 22174 0.20% 123 23016 0.21% 124 23997 0.22% 125 25077 0.23% 126 25792 0.23% 127 26434 0.24% 128 27195 0.25% 129 27805 0.25% 130 28827 0.26% 131 29583 0.27% 132 31073 0.28% 133 32861 0.30% 134 34182 0.31% 135 36005 0.33% 136 37490 0.34% 137 39440 0.36% 138 41340 0.37% 139 43385 0.39% 140 45477 0.41% 141 48395 0.44% 142 52367 0.47% 143 57597 0.52% 144 65640 0.59% 145 75753 0.69% 146 91942 0.83% 147 119625 1.08% 148 173159 1.57% 149 336443 3.05% 150 2245728 20.33% 151 6728400 60.91% 11047101 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=10.72 fanout-score-rank=10 prefix-density=0.42 prefix-fanout=6.4 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=283.45 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.3 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=41 fanout-score=114.88 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=13.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170180 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:12:18 Started mapping on | Feb 12 17:12:18 Finished on | Feb 12 17:13:58 Mapping speed, Million of reads per hour | 397.70 Number of input reads | 11047101 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10117338 Uniquely mapped reads % | 91.58% Average mapped length | 294.64 Number of splices: Total | 9254980 Number of splices: Annotated (sjdb) | 9094834 Number of splices: GT/AG | 9117905 Number of splices: GC/AG | 107993 Number of splices: AT/AC | 7495 Number of splices: Non-canonical | 21587 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195735 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 18831 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.43% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 756423 756423 756423 N_multimapping 195735 195735 195735 N_noFeature 193205 9995189 234529 N_ambiguous 121771 708 40515 UnstrandedReadsAssigned:9802362 PositiveStrandReadsAssigned:121441 NegativeStrandReadsAssigned:9842294 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170180 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170180-trimmed-pair1.fastq SRR7170180-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,047,101 reads, 9,817,896 reads pseudoaligned [quant] estimated average fragment length: 242.764 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7170180.ke.tsv 34699 SRR7170180.se.tsv 87100 total ==> SRR7170180.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.24 187 9.54019 Potri.005G024800.1.v4.1 1035 793.236 33 3.76988 Potri.004G059700.1.v4.1 961 719.3 1 0.125981 Potri.007G009000.2.v4.1 1416 1174.24 0 0 Potri.003G141000.2.v4.1 2943 2701.24 216 7.24615 Potri.016G087400.1.v4.1 270 80.2036 1145 1293.68 Potri.015G069301.1.v4.1 564 327.491 0 0 Potri.010G195200.1.v4.1 1773 1531.24 26 1.53868 Potri.012G127500.1.v4.1 977 735.251 3296 406.226 ==> SRR7170180.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1209 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170180 completed mapping pipeline successfully