Starting /dee2/code/volunteer_pipeline.sh SRR7170181 current disk space = 3051825586176 free memory = 1458323492 SRR7170181 SRAfilesize d4a93380bee41160087cbd27967814c7 SRR7170181.sra SRR7170181.sra file validated SRR7170181 is paired end SRR7170181 is conventional basespace SRR7170181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28725 34.0 33.0 34.0 33.0 34.0 2 33.34625 34.0 33.0 34.0 33.0 34.0 3 33.37525 34.0 33.0 34.0 33.0 34.0 4 33.38775 34.0 33.0 34.0 33.0 34.0 5 33.3205 34.0 33.0 34.0 33.0 34.0 6 36.81575 38.0 37.0 38.0 35.0 38.0 7 37.024 38.0 38.0 38.0 36.0 38.0 8 37.2165 38.0 38.0 38.0 36.0 38.0 9 37.273 38.0 38.0 38.0 37.0 38.0 10-14 37.24805 38.0 38.0 38.0 36.6 38.0 15-19 37.233850000000004 38.0 38.0 38.0 36.2 38.0 20-24 37.176449999999996 38.0 38.0 38.0 36.0 38.0 25-29 37.08290000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.0271 38.0 38.0 38.0 36.0 38.0 35-39 36.94385 38.0 38.0 38.0 35.6 38.0 40-44 36.53525 38.0 37.8 38.0 34.0 38.0 45-49 36.3323 38.0 37.0 38.0 33.4 38.0 50-54 36.20395 38.0 37.0 38.0 33.4 38.0 55-59 36.095150000000004 38.0 37.0 38.0 33.0 38.0 60-64 36.04665 38.0 37.0 38.0 32.6 38.0 65-69 35.9726 38.0 37.0 38.0 31.8 38.0 70-74 35.8055 38.0 36.6 38.0 31.2 38.0 75-79 35.70775 38.0 36.2 38.0 30.2 38.0 80-84 35.523849999999996 38.0 36.0 38.0 29.8 38.0 85-89 35.3779 38.0 36.0 38.0 29.0 38.0 90-94 35.13835 38.0 35.8 38.0 28.6 38.0 95-99 34.7924 38.0 35.0 38.0 26.8 38.0 100-104 34.6399 38.0 35.0 38.0 26.8 38.0 105-109 34.411649999999995 38.0 34.6 38.0 25.4 38.0 110-114 34.054199999999994 38.0 34.0 38.0 23.4 38.0 115-119 33.60665 37.8 34.0 38.0 19.0 38.0 120-124 33.2891 37.8 33.4 38.0 16.2 38.0 125-129 32.774950000000004 37.0 32.6 38.0 15.0 38.0 130-134 32.16015 36.4 31.0 38.0 15.0 38.0 135-139 31.648149999999998 36.0 31.0 38.0 14.2 38.0 140-144 31.063049999999997 36.0 29.2 38.0 13.8 38.0 145-149 29.959000000000003 35.8 27.4 38.0 6.4 38.0 150-151 24.5 32.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 3.0 15 4.0 16 4.0 17 5.0 18 5.0 19 7.0 20 14.0 21 15.0 22 18.0 23 20.0 24 16.0 25 34.0 26 40.0 27 39.0 28 71.0 29 58.0 30 74.0 31 127.0 32 156.0 33 220.0 34 330.0 35 597.0 36 1110.0 37 1027.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.969947407963936 15.627347858752819 12.346606561482593 32.05609817180065 2 22.55 20.375 34.300000000000004 22.775000000000002 3 20.150000000000002 27.375 25.900000000000002 26.575 4 21.45 34.875 22.7 20.974999999999998 5 22.025 36.475 21.725 19.775000000000002 6 18.025 36.425000000000004 25.1 20.45 7 13.65 23.125 43.824999999999996 19.400000000000002 8 18.675 22.45 29.475 29.4 9 18.125 23.7 31.825 26.35 10-14 19.605 30.45 26.36 23.585 15-19 20.305 28.660000000000004 27.465 23.57 20-24 19.63 28.794999999999998 27.27 24.305 25-29 19.885 29.24 27.58 23.294999999999998 30-34 19.855 28.395 28.015 23.735 35-39 20.14 28.994999999999997 27.860000000000003 23.005 40-44 20.325 28.535 27.725 23.415 45-49 19.96 28.895 27.205000000000002 23.94 50-54 20.195 28.73 27.389999999999997 23.685000000000002 55-59 20.365 28.189999999999998 27.295 24.15 60-64 20.315 28.994999999999997 27.445000000000004 23.244999999999997 65-69 20.36 28.525 27.694999999999997 23.419999999999998 70-74 19.814999999999998 28.749999999999996 27.255000000000003 24.18 75-79 20.285 28.28 27.13 24.305 80-84 20.599999999999998 28.199999999999996 27.875 23.325000000000003 85-89 20.28 28.485 27.595 23.64 90-94 20.647164896814267 27.965337607693847 27.339210579042277 24.04828691644961 95-99 20.641673757445318 28.630061564642872 27.513889584063268 23.214375093848542 100-104 20.74 28.335 27.279999999999998 23.645 105-109 20.665 28.525 27.060000000000002 23.75 110-114 20.635 28.110000000000003 27.42 23.835 115-119 21.107110711071105 28.897889788978897 26.41764176417642 23.577357735773578 120-124 21.016050802540125 28.801440072003597 26.251312565628282 23.931196559827992 125-129 21.365000000000002 27.875 27.11 23.65 130-134 20.624280926416887 27.997598919513784 27.44234905707568 23.935771096993648 135-139 20.758493020463302 28.043228098263874 27.127632961424926 24.0706459198479 140-144 21.515 27.889999999999997 26.375 24.22 145-149 21.125 28.439999999999998 25.77 24.665 150-151 21.61520190023753 27.753469183647955 25.928241030128767 24.70308788598575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 1.5 22 2.5 23 2.0 24 1.5 25 2.5 26 7.0 27 9.5 28 11.0 29 18.5 30 19.0 31 20.0 32 31.5 33 42.5 34 56.5 35 69.5 36 90.5 37 112.0 38 124.0 39 152.0 40 184.5 41 210.5 42 229.5 43 248.0 44 268.0 45 283.5 46 289.0 47 276.5 48 243.0 49 200.5 50 163.0 51 137.5 52 125.5 53 96.5 54 66.0 55 51.0 56 38.5 57 27.5 58 18.5 59 13.5 60 14.5 61 12.5 62 6.5 63 3.5 64 3.5 65 4.5 66 3.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.18 95-99 0.105 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.005 125-129 0.0 130-134 0.045 135-139 0.065 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.3625 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.2 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 6.0125 0.0 0.0 0.0 0.0 128-129 6.4625 0.0 0.0 0.0 0.0 130-131 6.9625 0.0 0.0 0.0 0.0 132-133 7.475 0.0 0.0 0.0 0.0 134-135 8.1625 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTAC 10 0.006871484 144.71251 4 AAATCTA 10 0.006871484 144.71251 3 >>END_MODULE SRR7170181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57625 33.0 33.0 34.0 32.0 34.0 2 32.67725 33.0 33.0 34.0 32.0 34.0 3 32.43625 33.0 33.0 34.0 32.0 34.0 4 32.32 33.0 33.0 34.0 32.0 34.0 5 32.35675 34.0 33.0 34.0 32.0 34.0 6 36.376 38.0 38.0 38.0 35.0 38.0 7 36.5015 38.0 38.0 38.0 36.0 38.0 8 36.53925 38.0 38.0 38.0 36.0 38.0 9 36.58275 38.0 38.0 38.0 36.0 38.0 10-14 36.38505 38.0 38.0 38.0 35.6 38.0 15-19 36.18155 38.0 38.0 38.0 35.0 38.0 20-24 36.213049999999996 38.0 38.0 38.0 35.0 38.0 25-29 36.27005 38.0 38.0 38.0 35.0 38.0 30-34 36.3273 38.0 38.0 38.0 35.2 38.0 35-39 36.203500000000005 38.0 38.0 38.0 35.0 38.0 40-44 35.9491 38.0 38.0 38.0 34.2 38.0 45-49 35.904849999999996 38.0 38.0 38.0 33.8 38.0 50-54 36.1648 38.0 38.0 38.0 34.0 38.0 55-59 36.092 38.0 38.0 38.0 34.2 38.0 60-64 36.021 38.0 38.0 38.0 34.0 38.0 65-69 36.00165 38.0 38.0 38.0 34.0 38.0 70-74 35.9971 38.0 38.0 38.0 34.0 38.0 75-79 35.810649999999995 38.0 38.0 38.0 33.2 38.0 80-84 35.74255 38.0 38.0 38.0 33.0 38.0 85-89 35.197500000000005 38.0 37.8 38.0 30.4 38.0 90-94 34.8717 38.0 37.0 38.0 28.6 38.0 95-99 35.31224999999999 38.0 37.0 38.0 29.4 38.0 100-104 35.28295000000001 38.0 37.0 38.0 30.2 38.0 105-109 35.11615 38.0 37.0 38.0 29.2 38.0 110-114 34.97035 38.0 37.0 38.0 28.6 38.0 115-119 34.65324999999999 38.0 36.2 38.0 26.8 38.0 120-124 34.37230000000001 38.0 36.0 38.0 24.6 38.0 125-129 33.91805 38.0 35.0 38.0 21.2 38.0 130-134 32.63205 38.0 34.4 38.0 13.8 38.0 135-139 31.3342 38.0 33.0 38.0 2.0 38.0 140-144 30.255149999999997 38.0 30.2 38.0 2.0 38.0 145-149 29.647000000000002 36.6 28.6 38.0 2.0 38.0 150-151 26.07575 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 58.0 3 13.0 4 3.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 2.0 11 2.0 12 3.0 13 5.0 14 6.0 15 7.0 16 6.0 17 5.0 18 9.0 19 5.0 20 18.0 21 16.0 22 14.0 23 19.0 24 28.0 25 24.0 26 33.0 27 37.0 28 43.0 29 67.0 30 68.0 31 88.0 32 112.0 33 148.0 34 179.0 35 252.0 36 611.0 37 2115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.85231539424281 17.822277847309138 14.943679599499374 25.381727158948685 2 25.68347128166541 24.956107348883872 31.72811637822924 17.63230499122147 3 21.971616827166752 28.05372529143436 30.3091738469336 19.66548403446528 4 23.730964467005077 35.50761421319797 21.903553299492387 18.85786802030457 5 24.074074074074073 36.22526636225266 21.537290715372905 18.163368848300355 6 20.010131712259373 35.790273556231 24.164133738601823 20.0354609929078 7 19.82823945440768 17.984339479666584 39.706996716342516 22.480424349583227 8 20.767095634620237 23.92127176381529 25.763310623265202 29.54832197829927 9 21.313537996980372 26.019124308002013 28.736789129340718 23.930548565676897 10-14 23.131600324939075 27.660438667749798 26.83285946385053 22.3751015434606 15-19 22.960509554140128 27.18471337579618 28.346496815286628 21.50828025477707 20-24 22.589000050784623 27.911228480016252 28.012797724848916 21.48697374435021 25-29 23.142046030619486 27.511913210990567 28.17601135557133 21.170029402818617 30-34 23.260175376349537 27.659790156622233 27.563485224795986 21.516549242232248 35-39 23.31350719333028 28.046362665853287 27.23298256316405 21.40714757765238 40-44 23.22204611687714 28.012679584845852 27.27133289022956 21.493941408047444 45-49 23.216290701235074 27.78401551495356 27.73808308665918 21.26161069715219 50-54 23.39305597732564 27.49266120052637 27.92286668691163 21.19141613523636 55-59 23.299888517279822 28.265936961589134 27.75412992804297 20.68004459308807 60-64 23.396590217170694 28.775116703876595 26.983965902171708 20.844327176781004 65-69 22.92328642759873 28.73858879305997 27.39698391082867 20.941140868512633 70-74 24.02388838703202 27.481682224229647 27.577035029609554 20.917394359128778 75-79 23.532660541246173 28.091580057237536 28.156850931365163 20.218908470151128 80-84 23.24053958470166 27.873490627999796 28.126105188703075 20.759864598595463 85-89 24.140592836558255 27.68629065459037 27.83552902428983 20.33758748456155 90-94 24.277307454057404 27.38488540161057 28.19533347098906 20.14247367334297 95-99 23.825435398946944 27.389631429728635 28.179424868367757 20.60550830295666 100-104 24.1438529144358 27.376502677038083 28.053338721082937 20.426305687443175 105-109 23.845881579612684 27.4965869444304 27.92132274864742 20.736208727309503 110-114 23.89765372168285 28.10477346278317 27.52831715210356 20.46925566343042 115-119 24.574650156045504 27.287828450619152 27.670391623879997 20.46712976945535 120-124 24.545135582176332 27.82817903864468 27.61766327502381 20.00902210415518 125-129 24.768306344841633 28.03238619003972 27.268560953253896 19.930746511864754 130-134 24.961964220135354 28.298620219295945 26.326005980798488 20.41340957977021 135-139 24.873288040547827 28.200150975951686 27.278119271001835 19.648441712498652 140-144 24.623720650210718 28.509660117125502 26.862240709320783 20.004378523343004 145-149 25.414997137950774 28.37591715668419 26.846021751574128 19.363063953790917 150-151 26.16189989785496 27.74514811031665 26.48110316649642 19.611848825331972 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 3.0 3 4.0 4 5.5 5 4.5 6 3.5 7 4.0 8 2.5 9 3.0 10 5.0 11 4.0 12 1.5 13 1.5 14 1.5 15 1.0 16 1.5 17 2.0 18 2.5 19 1.5 20 1.5 21 2.0 22 1.0 23 0.5 24 1.5 25 2.0 26 2.0 27 3.0 28 3.5 29 7.0 30 9.5 31 13.0 32 19.5 33 32.0 34 47.0 35 58.5 36 73.0 37 98.5 38 126.5 39 157.0 40 192.0 41 207.0 42 236.0 43 279.5 44 289.0 45 284.5 46 278.0 47 272.0 48 235.0 49 206.5 50 184.0 51 138.5 52 118.0 53 93.5 54 72.0 55 55.0 56 37.5 57 30.5 58 23.5 59 16.5 60 10.5 61 6.5 62 5.0 63 5.0 64 4.0 65 2.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.325 3 1.35 4 1.5 5 1.4500000000000002 6 1.3 7 1.0250000000000001 8 0.9249999999999999 9 0.65 10-14 1.52 15-19 1.875 20-24 1.545 25-29 1.37 30-34 1.355 35-39 1.645 40-44 2.205 45-49 2.03 50-54 1.21 55-59 1.3299999999999998 60-64 1.46 65-69 0.865 70-74 0.37 75-79 0.415 80-84 1.035 85-89 2.8400000000000003 90-94 3.1399999999999997 95-99 1.24 100-104 1.01 105-109 1.115 110-114 1.1199999999999999 115-119 0.67 120-124 0.245 125-129 1.81 130-134 4.695 135-139 7.2700000000000005 140-144 8.645 145-149 3.9149999999999996 150-151 2.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.42821158690176325 0.8500000000000001 3 0.12594458438287154 0.375 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.05 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 5.0125 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 6.8875 0.0 0.0 0.0 0.0 132-133 7.387499999999999 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.5 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 10 0.0061835926 149.72603 145 >>END_MODULE Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960168 spots for SRR7170181.sra Written 960168 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra Read 960167 spots for SRR7170181.sra Written 960167 spots for SRR7170181.sra SRR ids: ['SRR7170181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ft_c7c32 SRR7170181.sra spots: 19203341 blocks: [[1, 960167], [960168, 1920334], [1920335, 2880501], [2880502, 3840668], [3840669, 4800835], [4800836, 5761002], [5761003, 6721169], [6721170, 7681336], [7681337, 8641503], [8641504, 9601670], [9601671, 10561837], [10561838, 11522004], [11522005, 12482171], [12482172, 13442338], [13442339, 14402505], [14402506, 15362672], [15362673, 16322839], [16322840, 17283006], [17283007, 18243173], [18243174, 19203341]] SRR7170181 file size 6485681 SRR7170181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170181 SRR7170181_1.fastq SRR7170181_2.fastq Input file: SRR7170181_1.fastq Paired file: SRR7170181_2.fastq trimmed: SRR7170181-trimmed-pair1.fastq, SRR7170181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:26:34 2025 >> started Wed Feb 12 17:26:56 2025 >> done (22.252s) 19203341 read pairs processed; of these: 31703 ( 0.17%) short read pairs filtered out after trimming by size control 31393 ( 0.16%) empty read pairs filtered out after trimming by size control 19140245 (99.67%) read pairs available; of these: 11533413 (60.26%) trimmed read pairs available after processing 7606832 (39.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 8 0.00% 20 2 0.00% 21 2 0.00% 22 9 0.00% 23 5 0.00% 24 8 0.00% 25 7 0.00% 26 4 0.00% 27 6 0.00% 28 12 0.00% 29 13 0.00% 30 17 0.00% 31 11 0.00% 32 13 0.00% 33 13 0.00% 34 22 0.00% 35 30 0.00% 36 23 0.00% 37 19 0.00% 38 44 0.00% 39 40 0.00% 40 42 0.00% 41 36 0.00% 42 43 0.00% 43 62 0.00% 44 76 0.00% 45 75 0.00% 46 85 0.00% 47 87 0.00% 48 112 0.00% 49 158 0.00% 50 138 0.00% 51 194 0.00% 52 215 0.00% 53 239 0.00% 54 246 0.00% 55 259 0.00% 56 299 0.00% 57 363 0.00% 58 376 0.00% 59 474 0.00% 60 507 0.00% 61 575 0.00% 62 691 0.00% 63 775 0.00% 64 852 0.00% 65 908 0.00% 66 1106 0.01% 67 1237 0.01% 68 1563 0.01% 69 1893 0.01% 70 2160 0.01% 71 2086 0.01% 72 2332 0.01% 73 2632 0.01% 74 2854 0.01% 75 3218 0.02% 76 3389 0.02% 77 3837 0.02% 78 4292 0.02% 79 4744 0.02% 80 5370 0.03% 81 6296 0.03% 82 7240 0.04% 83 8166 0.04% 84 9762 0.05% 85 10838 0.06% 86 11317 0.06% 87 11886 0.06% 88 12831 0.07% 89 13406 0.07% 90 14336 0.07% 91 16045 0.08% 92 17224 0.09% 93 18720 0.10% 94 19893 0.10% 95 21108 0.11% 96 22340 0.12% 97 23159 0.12% 98 23568 0.12% 99 25281 0.13% 100 26707 0.14% 101 28433 0.15% 102 30395 0.16% 103 32519 0.17% 104 34190 0.18% 105 35850 0.19% 106 36967 0.19% 107 37669 0.20% 108 39076 0.20% 109 39913 0.21% 110 40717 0.21% 111 43458 0.23% 112 45539 0.24% 113 48187 0.25% 114 50471 0.26% 115 52447 0.27% 116 53575 0.28% 117 54557 0.29% 118 55810 0.29% 119 56761 0.30% 120 59013 0.31% 121 61825 0.32% 122 64521 0.34% 123 67698 0.35% 124 71681 0.37% 125 74639 0.39% 126 77343 0.40% 127 78952 0.41% 128 81469 0.43% 129 84348 0.44% 130 87122 0.46% 131 90747 0.47% 132 96622 0.50% 133 102344 0.53% 134 108221 0.57% 135 115863 0.61% 136 123064 0.64% 137 130125 0.68% 138 139251 0.73% 139 149191 0.78% 140 159416 0.83% 141 174276 0.91% 142 192410 1.01% 143 214109 1.12% 144 247168 1.29% 145 293624 1.53% 146 359021 1.88% 147 475512 2.48% 148 690144 3.61% 149 1244094 6.50% 150 4432034 23.16% 151 7606832 39.74% 19140245 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=263.55 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=29.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=224.55 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=24.9 sequence=GAAGAAGAAGAAA SRR7170181 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:27:47 Started mapping on | Feb 12 17:27:47 Finished on | Feb 12 17:29:27 Mapping speed, Million of reads per hour | 689.05 Number of input reads | 19140245 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18187386 Uniquely mapped reads % | 95.02% Average mapped length | 289.43 Number of splices: Total | 17227222 Number of splices: Annotated (sjdb) | 16945816 Number of splices: GT/AG | 16972106 Number of splices: GC/AG | 206150 Number of splices: AT/AC | 14186 Number of splices: Non-canonical | 34780 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338172 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 27316 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637465 637465 637465 N_multimapping 338172 338172 338172 N_noFeature 398545 17994039 485989 N_ambiguous 178940 1021 72290 UnstrandedReadsAssigned:17609901 PositiveStrandReadsAssigned:192326 NegativeStrandReadsAssigned:17629107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7170181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170181-trimmed-pair1.fastq SRR7170181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,140,245 reads, 17,558,021 reads pseudoaligned [quant] estimated average fragment length: 230.848 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7170181.ke.tsv 34699 SRR7170181.se.tsv 87100 total ==> SRR7170181.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.15 292 9.41486 Potri.005G024800.1.v4.1 1035 805.152 45 3.22233 Potri.004G059700.1.v4.1 961 731.208 5 0.394244 Potri.007G009000.2.v4.1 1416 1186.15 0 0 Potri.003G141000.2.v4.1 2943 2713.15 412.037 8.75585 Potri.016G087400.1.v4.1 270 90.793 1827 1160.17 Potri.015G069301.1.v4.1 564 340.839 0 0 Potri.010G195200.1.v4.1 1773 1543.15 27 1.00877 Potri.012G127500.1.v4.1 977 747.187 7103 548.085 ==> SRR7170181.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1234 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170181 completed mapping pipeline successfully