Starting /dee2/code/volunteer_pipeline.sh SRR7170182 current disk space = 3051671711744 free memory = 1579153908 SRR7170182 SRAfilesize a7d72860e60d460eb3feb7b92f572d12 SRR7170182.sra SRR7170182.sra file validated SRR7170182 is paired end SRR7170182 is conventional basespace SRR7170182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.17675 34.0 33.0 34.0 33.0 34.0 2 33.45225 34.0 34.0 34.0 33.0 34.0 3 33.44475 34.0 34.0 34.0 33.0 34.0 4 33.4225 34.0 34.0 34.0 33.0 34.0 5 33.40525 34.0 34.0 34.0 33.0 34.0 6 36.98775 38.0 37.0 38.0 36.0 38.0 7 37.20775 38.0 38.0 38.0 36.0 38.0 8 37.30775 38.0 38.0 38.0 37.0 38.0 9 37.414 38.0 38.0 38.0 37.0 38.0 10-14 37.4565 38.0 38.0 38.0 37.2 38.0 15-19 37.453950000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.4315 38.0 38.0 38.0 37.0 38.0 25-29 37.40315 38.0 38.0 38.0 37.0 38.0 30-34 37.3972 38.0 38.0 38.0 37.0 38.0 35-39 37.2165 38.0 38.0 38.0 36.4 38.0 40-44 36.86805 38.0 38.0 38.0 35.2 38.0 45-49 36.743849999999995 38.0 38.0 38.0 34.6 38.0 50-54 36.72185 38.0 38.0 38.0 34.4 38.0 55-59 36.64565 38.0 38.0 38.0 34.0 38.0 60-64 36.525 38.0 38.0 38.0 34.0 38.0 65-69 36.46085000000001 38.0 37.8 38.0 34.0 38.0 70-74 36.39425 38.0 37.2 38.0 34.0 38.0 75-79 36.248250000000006 38.0 37.0 38.0 33.4 38.0 80-84 36.09155 38.0 37.0 38.0 33.0 38.0 85-89 35.896100000000004 38.0 37.0 38.0 31.4 38.0 90-94 35.7388 38.0 36.8 38.0 31.0 38.0 95-99 35.5784 38.0 36.4 38.0 30.0 38.0 100-104 35.416 38.0 36.0 38.0 29.0 38.0 105-109 35.081599999999995 38.0 35.6 38.0 28.2 38.0 110-114 34.70405 38.0 35.0 38.0 27.0 38.0 115-119 34.51265000000001 38.0 35.0 38.0 26.2 38.0 120-124 34.12505 38.0 34.4 38.0 23.4 38.0 125-129 33.6534 38.0 34.0 38.0 20.6 38.0 130-134 33.2233 38.0 33.8 38.0 15.0 38.0 135-139 32.737899999999996 37.8 33.0 38.0 15.0 38.0 140-144 32.075700000000005 36.6 31.8 38.0 14.0 38.0 145-149 30.801650000000002 36.0 31.0 38.0 8.6 38.0 150-151 26.334125 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 3.0 13 2.0 14 2.0 15 2.0 16 2.0 17 3.0 18 4.0 19 10.0 20 5.0 21 12.0 22 13.0 23 10.0 24 27.0 25 18.0 26 31.0 27 31.0 28 43.0 29 51.0 30 75.0 31 83.0 32 121.0 33 165.0 34 245.0 35 465.0 36 1000.0 37 1575.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.90380256862251 14.202971543691763 9.770838579702845 34.122387307982876 2 20.05 21.325 36.175000000000004 22.45 3 18.375 28.075 25.900000000000002 27.650000000000002 4 21.625 36.075 20.775 21.525 5 20.205307961942914 37.63144717075613 22.8843264897346 19.278918377566352 6 16.400000000000002 37.5 26.025 20.075000000000003 7 14.2 22.95 43.025000000000006 19.825 8 18.775 23.275000000000002 27.900000000000002 30.049999999999997 9 17.424999999999997 22.6 32.85 27.125 10-14 20.095 29.549999999999997 26.889999999999997 23.465 15-19 20.48 28.395 27.175 23.95 20-24 20.175 29.04 26.61 24.175 25-29 19.885 29.04 27.41 23.665 30-34 19.63 28.825 27.005000000000003 24.54 35-39 19.925 28.76 26.895000000000003 24.42 40-44 20.18 28.49 27.279999999999998 24.05 45-49 20.36 28.735 27.015 23.89 50-54 20.165 28.785 27.58 23.47 55-59 20.535 27.91 27.439999999999998 24.115000000000002 60-64 20.345 28.96 27.18 23.515 65-69 20.285 28.999999999999996 26.875 23.84 70-74 20.595 29.28 26.775 23.35 75-79 20.630000000000003 28.645 26.795 23.93 80-84 20.415 28.499999999999996 27.295 23.79 85-89 21.12 28.975 26.61 23.294999999999998 90-94 20.54 28.76 26.615 24.085 95-99 20.27 28.48 26.93 24.32 100-104 21.055 28.615000000000002 26.8 23.53 105-109 20.935000000000002 28.494999999999997 26.884999999999998 23.685000000000002 110-114 21.310000000000002 27.534999999999997 27.08 24.075 115-119 21.12 28.79 26.5 23.59 120-124 21.505 29.054999999999996 25.615 23.825 125-129 20.95 28.110000000000003 26.795 24.145 130-134 20.979999999999997 27.82 26.47 24.73 135-139 21.060000000000002 28.18 26.779999999999998 23.98 140-144 21.52 27.345000000000002 26.784999999999997 24.349999999999998 145-149 21.32 27.794999999999998 26.779999999999998 24.104999999999997 150-151 21.403552664498374 27.958468851638727 26.832624468351263 23.805354015511636 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 4.5 26 5.5 27 5.5 28 6.5 29 8.5 30 14.5 31 21.0 32 35.5 33 45.5 34 51.0 35 72.5 36 97.0 37 110.5 38 129.0 39 152.5 40 170.0 41 196.5 42 244.0 43 265.0 44 263.5 45 272.0 46 246.5 47 245.0 48 243.5 49 207.0 50 177.5 51 156.0 52 132.0 53 99.0 54 81.0 55 60.0 56 42.0 57 36.5 58 26.5 59 15.5 60 12.5 61 11.0 62 7.5 63 4.5 64 6.5 65 5.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.325 0.0 0.0 0.0 0.0 94-95 1.675 0.0 0.0 0.0 0.0 96-97 1.9375 0.0 0.0 0.0 0.0 98-99 2.0875 0.0 0.0 0.0 0.0 100-101 2.375 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.5625 0.0 0.0 0.0 0.0 112-113 4.949999999999999 0.0 0.0 0.0 0.0 114-115 5.3875 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.2625 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.3625 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.4875 0.0 0.0 0.0 0.0 128-129 8.95 0.0 0.0 0.0 0.0 130-131 9.5 0.0 0.0 0.0 0.0 132-133 10.125 0.0 0.0 0.0 0.0 134-135 10.725 0.0 0.0 0.0 0.0 136-137 11.375 0.0 0.0 0.0 0.0 138-139 11.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.826 33.0 33.0 34.0 32.0 34.0 2 32.969 34.0 33.0 34.0 32.0 34.0 3 32.88725 34.0 33.0 34.0 32.0 34.0 4 32.62975 34.0 33.0 34.0 32.0 34.0 5 32.73875 34.0 33.0 34.0 32.0 34.0 6 37.01775 38.0 38.0 38.0 36.0 38.0 7 37.03925 38.0 38.0 38.0 37.0 38.0 8 37.077 38.0 38.0 38.0 37.0 38.0 9 37.10175 38.0 38.0 38.0 37.0 38.0 10-14 37.00005 38.0 38.0 38.0 36.8 38.0 15-19 36.9007 38.0 38.0 38.0 36.4 38.0 20-24 36.9597 38.0 38.0 38.0 36.6 38.0 25-29 37.013 38.0 38.0 38.0 36.6 38.0 30-34 37.0353 38.0 38.0 38.0 37.0 38.0 35-39 36.80069999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.6915 38.0 38.0 38.0 36.0 38.0 45-49 36.56355 38.0 38.0 38.0 35.6 38.0 50-54 36.7766 38.0 38.0 38.0 36.0 38.0 55-59 36.749900000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.67810000000001 38.0 38.0 38.0 35.4 38.0 65-69 36.6322 38.0 38.0 38.0 35.0 38.0 70-74 36.615700000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.442949999999996 38.0 38.0 38.0 34.6 38.0 80-84 36.37515 38.0 38.0 38.0 34.0 38.0 85-89 35.917199999999994 38.0 38.0 38.0 33.6 38.0 90-94 35.607299999999995 38.0 38.0 38.0 31.8 38.0 95-99 35.984049999999996 38.0 38.0 38.0 32.8 38.0 100-104 35.934250000000006 38.0 38.0 38.0 33.0 38.0 105-109 35.82365 38.0 37.6 38.0 32.4 38.0 110-114 35.55825 38.0 37.0 38.0 31.0 38.0 115-119 35.299850000000006 38.0 36.8 38.0 29.6 38.0 120-124 35.089 38.0 36.4 38.0 28.4 38.0 125-129 34.50064999999999 38.0 35.8 38.0 25.6 38.0 130-134 33.253750000000004 38.0 34.8 38.0 16.0 38.0 135-139 32.0983 38.0 34.0 38.0 11.0 38.0 140-144 31.115550000000002 38.0 32.4 38.0 2.0 38.0 145-149 30.338599999999996 38.0 31.0 38.0 2.0 38.0 150-151 26.572499999999998 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 3.0 6 2.0 7 0.0 8 1.0 9 1.0 10 3.0 11 0.0 12 2.0 13 7.0 14 2.0 15 4.0 16 5.0 17 12.0 18 5.0 19 9.0 20 17.0 21 15.0 22 12.0 23 18.0 24 15.0 25 29.0 26 28.0 27 48.0 28 37.0 29 70.0 30 60.0 31 58.0 32 125.0 33 167.0 34 156.0 35 256.0 36 537.0 37 2287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.66032064128257 16.107214428857716 14.478957915831664 26.753507014028056 2 24.13620430645969 24.486730095142715 33.14972458688032 18.227341011517275 3 21.245605223505777 27.448518332496235 30.78854846810648 20.51732797589151 4 24.823053589484328 34.52982810920122 21.359959555106165 19.28715874620829 5 22.163522012578614 36.9559748427673 22.38993710691824 18.49056603773585 6 19.15 36.15 24.525 20.175 7 18.775 17.5 41.199999999999996 22.525000000000002 8 21.9 23.7 27.175 27.224999999999998 9 22.225 22.875 28.7 26.200000000000003 10-14 23.12124248496994 27.82565130260521 26.96392785571142 22.089178356713425 15-19 23.216347843550736 27.41376713360446 27.795350705427524 21.57453431741728 20-24 23.28492739108663 27.616424636955433 27.611417125688533 21.487230846269405 25-29 23.21 27.944999999999997 27.925 20.919999999999998 30-34 23.150000000000002 27.445000000000004 28.185 21.22 35-39 23.208191126279864 28.41296928327645 27.46938365790002 20.909455932543665 40-44 23.143620507133136 27.972979785249784 27.76629530675001 21.117104400867067 45-49 23.655481209438044 27.388438899230266 27.519243346581472 21.436836544750214 50-54 23.349339735894358 27.961184473789512 27.67607042817127 21.01340536214486 55-59 23.325000000000003 27.644999999999996 28.15 20.880000000000003 60-64 23.565891472868216 27.38184546136534 27.741935483870968 21.310327581895475 65-69 23.661563094165917 27.534273991794254 27.879515660962674 20.924647253077154 70-74 24.044999999999998 27.810000000000002 27.72 20.424999999999997 75-79 23.7 27.32 28.17 20.810000000000002 80-84 23.74 28.194999999999997 27.644999999999996 20.419999999999998 85-89 23.63140069756862 27.346711823282615 27.92296416114846 21.098923318000303 90-94 23.669659615482168 27.570638664840462 28.113427687312942 20.646274032364428 95-99 23.74831190916821 27.314560096033613 27.664682638923622 21.272445355874556 100-104 24.095 27.134999999999998 28.444999999999997 20.325 105-109 24.490000000000002 27.33 27.560000000000002 20.62 110-114 24.585 27.205000000000002 27.715 20.495 115-119 24.845 28.185 27.065 19.905 120-124 24.735 27.400000000000002 28.265 19.6 125-129 24.66931549564955 27.65176281245285 27.34496806316954 20.33395362872806 130-134 25.38191577208918 27.50309661436829 27.08505367464905 20.02993393889348 135-139 25.53852636014115 27.23969031442566 27.418760204350345 19.80302312108285 140-144 25.52714461111408 27.977366145305076 26.423957721667644 20.0715315219132 145-149 26.17171510437986 27.962546049938602 26.25358166189112 19.612157183790423 150-151 25.683679899180845 28.506616257088847 26.96912413358538 18.84057971014493 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 3.0 26 3.5 27 2.5 28 4.5 29 8.5 30 12.5 31 16.0 32 25.0 33 32.5 34 39.0 35 56.0 36 79.0 37 103.0 38 127.0 39 152.5 40 176.0 41 216.0 42 250.5 43 259.5 44 279.0 45 283.0 46 272.0 47 272.5 48 252.5 49 218.0 50 178.5 51 154.0 52 142.0 53 103.0 54 69.5 55 54.0 56 41.0 57 27.0 58 13.5 59 10.0 60 9.5 61 8.0 62 10.5 63 9.0 64 3.5 65 4.5 66 4.0 67 3.0 68 4.0 69 1.5 70 0.0 71 1.5 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.15 3 0.44999999999999996 4 1.0999999999999999 5 0.625 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.2 15-19 0.415 20-24 0.15 25-29 0.0 30-34 0.0 35-39 0.38 40-44 0.815 45-49 0.615 50-54 0.04 55-59 0.0 60-64 0.025 65-69 0.06999999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.085 90-94 1.435 95-99 0.034999999999999996 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.585 130-134 3.1199999999999997 135-139 5.065 140-144 6.335 145-149 2.2800000000000002 150-151 0.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.3 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.025 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.0875 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 4.0625 0.0 0.0 0.0 0.0 110-111 4.512499999999999 0.0 0.0 0.0 0.0 112-113 4.925000000000001 0.0 0.0 0.0 0.0 114-115 5.3625 0.0 0.0 0.0 0.0 116-117 5.725 0.0 0.0 0.0 0.0 118-119 6.25 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.325 0.0 0.0 0.0 0.0 124-125 7.875 0.0 0.0 0.0 0.0 126-127 8.462499999999999 0.0 0.0 0.0 0.0 128-129 8.9875 0.0 0.0 0.0 0.0 130-131 9.4875 0.0 0.0 0.0 0.0 132-133 10.0875 0.0 0.0 0.0 0.0 134-135 10.662500000000001 0.0 0.0 0.0 0.0 136-137 11.3 0.0 0.0 0.0 0.0 138-139 11.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 115 1.1777556E-4 11.982261 135-139 >>END_MODULE Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra Read 880979 spots for SRR7170182.sra Written 880979 spots for SRR7170182.sra SRR ids: ['SRR7170182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_osmool3q SRR7170182.sra spots: 17619580 blocks: [[1, 880979], [880980, 1761958], [1761959, 2642937], [2642938, 3523916], [3523917, 4404895], [4404896, 5285874], [5285875, 6166853], [6166854, 7047832], [7047833, 7928811], [7928812, 8809790], [8809791, 9690769], [9690770, 10571748], [10571749, 11452727], [11452728, 12333706], [12333707, 13214685], [13214686, 14095664], [14095665, 14976643], [14976644, 15857622], [15857623, 16738601], [16738602, 17619580]] SRR7170182 file size 5948997 SRR7170182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170182 SRR7170182_1.fastq SRR7170182_2.fastq Input file: SRR7170182_1.fastq Paired file: SRR7170182_2.fastq trimmed: SRR7170182-trimmed-pair1.fastq, SRR7170182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:49:23 2025 >> started Wed Feb 12 17:49:42 2025 >> done (19.526s) 17619580 read pairs processed; of these: 26593 ( 0.15%) short read pairs filtered out after trimming by size control 30582 ( 0.17%) empty read pairs filtered out after trimming by size control 17562405 (99.68%) read pairs available; of these: 10421643 (59.34%) trimmed read pairs available after processing 7140762 (40.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 6 0.00% 24 11 0.00% 25 10 0.00% 26 9 0.00% 27 10 0.00% 28 10 0.00% 29 9 0.00% 30 12 0.00% 31 14 0.00% 32 22 0.00% 33 24 0.00% 34 23 0.00% 35 23 0.00% 36 35 0.00% 37 40 0.00% 38 46 0.00% 39 61 0.00% 40 84 0.00% 41 74 0.00% 42 89 0.00% 43 108 0.00% 44 131 0.00% 45 129 0.00% 46 164 0.00% 47 188 0.00% 48 216 0.00% 49 234 0.00% 50 300 0.00% 51 308 0.00% 52 377 0.00% 53 388 0.00% 54 453 0.00% 55 475 0.00% 56 479 0.00% 57 587 0.00% 58 617 0.00% 59 778 0.00% 60 861 0.00% 61 985 0.01% 62 1083 0.01% 63 1309 0.01% 64 1473 0.01% 65 1571 0.01% 66 1787 0.01% 67 2138 0.01% 68 2321 0.01% 69 3051 0.02% 70 3529 0.02% 71 3560 0.02% 72 3733 0.02% 73 4342 0.02% 74 4470 0.03% 75 4977 0.03% 76 5259 0.03% 77 5708 0.03% 78 6259 0.04% 79 7063 0.04% 80 8089 0.05% 81 9347 0.05% 82 10412 0.06% 83 11746 0.07% 84 13543 0.08% 85 14648 0.08% 86 15464 0.09% 87 15980 0.09% 88 16928 0.10% 89 18029 0.10% 90 19492 0.11% 91 21187 0.12% 92 22862 0.13% 93 25165 0.14% 94 26087 0.15% 95 27602 0.16% 96 28677 0.16% 97 29375 0.17% 98 29866 0.17% 99 31549 0.18% 100 33104 0.19% 101 34723 0.20% 102 37088 0.21% 103 38752 0.22% 104 40938 0.23% 105 43154 0.25% 106 43716 0.25% 107 44047 0.25% 108 45105 0.26% 109 45534 0.26% 110 46743 0.27% 111 48918 0.28% 112 51544 0.29% 113 53458 0.30% 114 56245 0.32% 115 58608 0.33% 116 59080 0.34% 117 59668 0.34% 118 60608 0.35% 119 61422 0.35% 120 62985 0.36% 121 64876 0.37% 122 67940 0.39% 123 71460 0.41% 124 73796 0.42% 125 77064 0.44% 126 78606 0.45% 127 80738 0.46% 128 81884 0.47% 129 83702 0.48% 130 85828 0.49% 131 88518 0.50% 132 93409 0.53% 133 97298 0.55% 134 103283 0.59% 135 109206 0.62% 136 114049 0.65% 137 119729 0.68% 138 126815 0.72% 139 133291 0.76% 140 142144 0.81% 141 153897 0.88% 142 169448 0.96% 143 188317 1.07% 144 206140 1.17% 145 240165 1.37% 146 290372 1.65% 147 380904 2.17% 148 555525 3.16% 149 996925 5.68% 150 3852781 21.94% 151 7140762 40.66% 17562405 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=45 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=211.76 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=234.06 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.4 sequence=GAAGAAGAAGAAA SRR7170182 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:50:27 Started mapping on | Feb 12 17:50:27 Finished on | Feb 12 17:51:57 Mapping speed, Million of reads per hour | 702.50 Number of input reads | 17562405 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16553550 Uniquely mapped reads % | 94.26% Average mapped length | 287.40 Number of splices: Total | 15571430 Number of splices: Annotated (sjdb) | 15310620 Number of splices: GT/AG | 15342311 Number of splices: GC/AG | 181806 Number of splices: AT/AC | 12891 Number of splices: Non-canonical | 34422 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319848 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 234350 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 708217 708217 708217 N_multimapping 319848 319848 319848 N_noFeature 374296 16383969 448527 N_ambiguous 159115 1175 62899 UnstrandedReadsAssigned:16020139 PositiveStrandReadsAssigned:168406 NegativeStrandReadsAssigned:16042124 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170182-trimmed-pair1.fastq SRR7170182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,562,405 reads, 16,109,690 reads pseudoaligned [quant] estimated average fragment length: 216.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170182.ke.tsv 34699 SRR7170182.se.tsv 87100 total ==> SRR7170182.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.12 266 9.47015 Potri.005G024800.1.v4.1 1035 819.123 40 3.13307 Potri.004G059700.1.v4.1 961 745.148 2 0.172205 Potri.007G009000.2.v4.1 1416 1200.12 0 0 Potri.003G141000.2.v4.1 2943 2727.12 362.117 8.51928 Potri.016G087400.1.v4.1 270 96.5713 1545.48 1026.77 Potri.015G069301.1.v4.1 564 353.405 0 0 Potri.010G195200.1.v4.1 1773 1557.12 10 0.412037 Potri.012G127500.1.v4.1 977 761.123 3605 303.885 ==> SRR7170182.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1146 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170182 completed mapping pipeline successfully