Starting /dee2/code/volunteer_pipeline.sh SRR7170183 current disk space = 3051808440320 free memory = 1484095032 SRR7170183 SRAfilesize 14f9781cd5e5924942ae4b9546863d3c SRR7170183.sra SRR7170183.sra file validated SRR7170183 is paired end SRR7170183 is conventional basespace SRR7170183 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29675 34.0 33.0 34.0 33.0 34.0 2 33.446 34.0 33.0 34.0 33.0 34.0 3 33.43875 34.0 34.0 34.0 33.0 34.0 4 33.468 34.0 34.0 34.0 33.0 34.0 5 33.409 34.0 33.0 34.0 33.0 34.0 6 36.934 38.0 37.0 38.0 35.0 38.0 7 37.216 38.0 38.0 38.0 36.0 38.0 8 37.37375 38.0 38.0 38.0 37.0 38.0 9 37.426 38.0 38.0 38.0 37.0 38.0 10-14 37.42875 38.0 38.0 38.0 37.0 38.0 15-19 37.37915 38.0 38.0 38.0 37.0 38.0 20-24 37.287400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.27825 38.0 38.0 38.0 36.8 38.0 30-34 37.20695 38.0 38.0 38.0 36.6 38.0 35-39 37.1296 38.0 38.0 38.0 36.4 38.0 40-44 36.84165 38.0 38.0 38.0 35.2 38.0 45-49 36.64035 38.0 38.0 38.0 34.2 38.0 50-54 36.58064999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.48815 38.0 38.0 38.0 34.0 38.0 60-64 36.3794 38.0 37.4 38.0 34.0 38.0 65-69 36.3316 38.0 37.0 38.0 33.4 38.0 70-74 36.280100000000004 38.0 37.0 38.0 33.4 38.0 75-79 36.16420000000001 38.0 37.0 38.0 33.0 38.0 80-84 35.9867 38.0 37.0 38.0 32.2 38.0 85-89 35.80565 38.0 36.8 38.0 30.8 38.0 90-94 35.638149999999996 38.0 36.6 38.0 30.6 38.0 95-99 35.34135 38.0 36.0 38.0 29.0 38.0 100-104 35.16875 38.0 36.0 38.0 28.6 38.0 105-109 35.081450000000004 38.0 35.8 38.0 28.4 38.0 110-114 34.64335 38.0 35.2 38.0 26.2 38.0 115-119 34.2164 38.0 34.4 38.0 23.6 38.0 120-124 34.1274 38.0 34.0 38.0 23.0 38.0 125-129 33.5567 38.0 34.0 38.0 19.4 38.0 130-134 32.9462 37.4 33.2 38.0 15.0 38.0 135-139 32.69950000000001 37.2 33.0 38.0 15.0 38.0 140-144 32.050850000000004 36.4 31.6 38.0 14.2 38.0 145-149 31.076749999999997 36.0 31.0 38.0 8.8 38.0 150-151 25.899375 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 5.0 17 1.0 18 6.0 19 5.0 20 11.0 21 8.0 22 16.0 23 19.0 24 23.0 25 25.0 26 23.0 27 28.0 28 40.0 29 51.0 30 71.0 31 89.0 32 129.0 33 183.0 34 274.0 35 499.0 36 1032.0 37 1450.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.782347041123366 13.365095285857572 13.139418254764292 37.71313941825476 2 20.3 20.599999999999998 35.0 24.099999999999998 3 21.475 26.0 24.25 28.275 4 23.7 34.849999999999994 19.675 21.775 5 21.475 37.4 22.275 18.85 6 17.150000000000002 38.4 25.0 19.45 7 12.85 24.099999999999998 43.6 19.45 8 18.025 23.7 29.675 28.599999999999998 9 17.75 23.65 32.0 26.6 10-14 19.395 30.235 26.595000000000002 23.775 15-19 19.515 28.84 27.845 23.799999999999997 20-24 20.055 28.349999999999998 27.339999999999996 24.255 25-29 20.485 28.970000000000002 26.974999999999998 23.57 30-34 19.869999999999997 28.685 27.37 24.075 35-39 19.675 28.79 27.425 24.11 40-44 20.044999999999998 28.48 28.1 23.375 45-49 20.41 28.144999999999996 27.215 24.23 50-54 19.785 29.035 26.91 24.27 55-59 20.455000000000002 28.87 26.865 23.810000000000002 60-64 20.715 28.89 26.810000000000002 23.585 65-69 20.175 29.099999999999998 26.755000000000003 23.97 70-74 19.55 29.270000000000003 27.169999999999998 24.01 75-79 20.09 28.88 27.05 23.98 80-84 20.535 28.345 26.950000000000003 24.169999999999998 85-89 20.22 27.97 27.525 24.285 90-94 20.6652973297931 28.570712890135763 27.117879865738185 23.64610991433295 95-99 19.997997196074504 27.638694171840577 27.984177848988583 24.379130783096333 100-104 20.8 28.544999999999998 27.095000000000002 23.56 105-109 20.25 27.68 27.735 24.335 110-114 20.865000000000002 28.23 27.395000000000003 23.51 115-119 20.8 28.804999999999996 26.31 24.085 120-124 20.835 27.83 27.215 24.12 125-129 20.335 28.305000000000003 26.979999999999997 24.38 130-134 21.262757654592757 27.55153091855113 26.94616770062037 24.23954372623574 135-139 21.2419935948759 28.22257806244996 26.36609287429944 24.1693354683747 140-144 21.115000000000002 28.16 26.375 24.349999999999998 145-149 21.51 28.71 26.205000000000002 23.575 150-151 21.5375 27.950000000000003 25.9875 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 4.0 26 4.5 27 6.0 28 8.0 29 8.5 30 17.5 31 25.5 32 39.5 33 55.5 34 57.5 35 65.5 36 82.0 37 111.0 38 146.5 39 162.5 40 182.0 41 201.5 42 218.0 43 249.0 44 261.5 45 260.5 46 260.5 47 256.5 48 241.0 49 211.5 50 180.5 51 151.5 52 119.0 53 91.5 54 79.0 55 63.0 56 38.5 57 30.0 58 29.5 59 20.5 60 12.0 61 11.5 62 8.5 63 2.5 64 5.0 65 5.0 66 1.0 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.19499999999999998 95-99 0.13999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.06 135-139 0.08 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.487500000000001 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.487500000000001 0.0 0.0 0.0 0.0 136-137 7.05 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAATCC 10 0.006830828 145.0 3 ATATGTG 10 0.006830828 145.0 6 ATGCAAC 10 0.006830828 145.0 8 >>END_MODULE SRR7170183 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60375 33.0 33.0 34.0 32.0 34.0 2 32.72475 33.0 33.0 34.0 32.0 34.0 3 32.57875 34.0 33.0 34.0 32.0 34.0 4 32.36125 34.0 33.0 34.0 32.0 34.0 5 32.40375 34.0 33.0 34.0 32.0 34.0 6 36.64425 38.0 38.0 38.0 36.0 38.0 7 36.71825 38.0 38.0 38.0 36.0 38.0 8 36.691 38.0 38.0 38.0 36.0 38.0 9 36.69875 38.0 38.0 38.0 36.0 38.0 10-14 36.4587 38.0 38.0 38.0 35.6 38.0 15-19 36.283249999999995 38.0 38.0 38.0 35.2 38.0 20-24 36.26434999999999 38.0 38.0 38.0 35.0 38.0 25-29 36.3871 38.0 38.0 38.0 35.2 38.0 30-34 36.44685 38.0 38.0 38.0 35.8 38.0 35-39 36.317150000000005 38.0 38.0 38.0 35.2 38.0 40-44 36.04025 38.0 38.0 38.0 34.4 38.0 45-49 36.001 38.0 38.0 38.0 34.0 38.0 50-54 36.292049999999996 38.0 38.0 38.0 34.4 38.0 55-59 36.200900000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.14385 38.0 38.0 38.0 34.2 38.0 65-69 36.1897 38.0 38.0 38.0 34.0 38.0 70-74 36.1278 38.0 38.0 38.0 34.0 38.0 75-79 35.931749999999994 38.0 38.0 38.0 33.4 38.0 80-84 35.891149999999996 38.0 38.0 38.0 33.4 38.0 85-89 35.193949999999994 38.0 37.8 38.0 30.0 38.0 90-94 34.90335 38.0 37.2 38.0 28.2 38.0 95-99 35.39705 38.0 37.0 38.0 29.2 38.0 100-104 35.379000000000005 38.0 37.0 38.0 29.8 38.0 105-109 35.373450000000005 38.0 37.0 38.0 30.8 38.0 110-114 35.17 38.0 37.0 38.0 28.8 38.0 115-119 34.87265 38.0 36.4 38.0 27.6 38.0 120-124 34.61535 38.0 36.0 38.0 26.4 38.0 125-129 33.99209999999999 38.0 35.2 38.0 22.2 38.0 130-134 32.59 38.0 34.4 38.0 13.8 38.0 135-139 31.295000000000005 38.0 33.0 38.0 2.0 38.0 140-144 30.442349999999998 38.0 31.4 38.0 2.0 38.0 145-149 29.795049999999996 37.6 29.8 38.0 2.0 38.0 150-151 26.031625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 12.0 4 2.0 5 2.0 6 0.0 7 2.0 8 3.0 9 4.0 10 2.0 11 3.0 12 1.0 13 5.0 14 6.0 15 9.0 16 6.0 17 13.0 18 5.0 19 13.0 20 11.0 21 13.0 22 16.0 23 19.0 24 21.0 25 19.0 26 32.0 27 37.0 28 52.0 29 65.0 30 68.0 31 92.0 32 113.0 33 166.0 34 154.0 35 281.0 36 547.0 37 2165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.39043325820185 16.15326821938392 17.50563486100676 28.95066366140746 2 24.284279256654948 24.008036162732296 33.952787543947764 17.754897036664993 3 22.34311740890688 28.213562753036435 28.846153846153843 20.597165991902834 4 25.958851917703836 33.45186690373381 20.548641097282193 20.040640081280163 5 23.213380638621388 36.64470349721237 22.12366953877344 18.018246325392802 6 19.166666666666668 37.348484848484844 24.141414141414142 19.343434343434343 7 18.204740292486132 17.549167927382754 42.25920322743318 21.986888552697934 8 21.911245587493696 23.2476046394352 26.32375189107413 28.517397881996974 9 21.534591194968552 24.40251572327044 27.949685534591197 26.113207547169807 10-14 23.306439336276448 28.634495356979755 26.280002029735627 21.77906327700817 15-19 23.028728606356967 27.246332518337407 28.193765281173594 21.53117359413203 20-24 23.34669847231386 27.604933258894587 27.625234735827032 21.42313353296452 25-29 23.42912071233431 28.220176059900844 27.319639785490235 21.031063442274615 30-34 23.61336032388664 27.388663967611336 28.18825910931174 20.809716599190285 35-39 23.90387644159935 27.714271198496164 27.587258039932937 20.794594319971548 40-44 23.833878887070377 27.439648117839603 27.89995908346972 20.826513911620296 45-49 23.903833392884486 27.221683426062988 28.222142820682965 20.652340360369557 50-54 23.957332794095343 27.758960618775593 27.632576715029572 20.65112987209949 55-59 23.78952694156337 27.680242853528963 27.54869719200607 20.981533012901593 60-64 24.008520133887817 27.629577036210566 27.95922507353687 20.402677756364742 65-69 23.53445234134785 27.85926710015626 27.76349614395887 20.84278441453702 70-74 24.17185304155792 27.61995583216222 27.419192933145954 20.78899819313391 75-79 24.41019977913864 27.467121774922198 27.808452966569618 20.31422547936954 80-84 23.612512613521695 27.991927346115038 27.260343087790112 21.135216952573156 85-89 24.28284492970078 27.156615337075756 27.635577071638256 20.92496266158521 90-94 24.28859164385684 27.650673965811084 27.18070546919382 20.88002892113825 95-99 23.625790139064478 28.106194690265486 27.60556257901391 20.66245259165613 100-104 24.612823487867626 27.558896231650102 27.104878171820612 20.723402108661656 105-109 24.466205643329463 27.4695876028469 27.989500782393616 20.074705971430014 110-114 24.06781371411272 27.599777990816893 27.46354508300116 20.86886321206923 115-119 24.316981132075473 27.718238993710692 27.516981132075475 20.447798742138364 120-124 24.748057157182252 27.505640511406366 27.856605665580346 19.889696665831035 125-129 25.067481538069774 27.9755538579068 27.282913165266105 19.67405143875732 130-134 25.70782022944953 27.46026734027997 26.849805283654355 19.982107146616144 135-139 24.931002759889605 27.66924617132962 27.60971914064614 19.79003192813464 140-144 25.68787265466878 28.034571412942398 26.956949838630273 19.320606093758546 145-149 25.553991344699934 27.837739193910004 26.831430210125657 19.776839251264402 150-151 26.256698137279916 27.519775452921664 25.912222505741262 20.31130390405716 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 3.0 2 3.0 3 3.5 4 6.5 5 7.0 6 4.5 7 2.0 8 1.0 9 1.0 10 0.5 11 0.5 12 0.5 13 1.0 14 2.5 15 1.5 16 1.0 17 2.5 18 2.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 4.0 27 2.5 28 3.5 29 6.5 30 11.5 31 12.0 32 14.0 33 26.5 34 35.5 35 54.5 36 69.5 37 87.5 38 123.0 39 151.0 40 178.0 41 214.0 42 249.5 43 285.0 44 299.0 45 282.0 46 267.0 47 264.0 48 259.5 49 219.5 50 177.5 51 153.0 52 116.5 53 89.5 54 72.0 55 59.0 56 47.0 57 33.5 58 26.5 59 16.0 60 7.5 61 5.5 62 5.0 63 3.5 64 2.5 65 3.5 66 3.5 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.44999999999999996 3 1.2 4 1.575 5 1.35 6 1.0 7 0.8500000000000001 8 0.8500000000000001 9 0.625 10-14 1.465 15-19 1.8399999999999999 20-24 1.485 25-29 1.17 30-34 1.2 35-39 1.585 40-44 2.2399999999999998 45-49 2.045 50-54 1.095 55-59 1.175 60-64 1.41 65-69 0.8049999999999999 70-74 0.38 75-79 0.38999999999999996 80-84 0.8999999999999999 85-89 2.915 90-94 3.1850000000000005 95-99 1.125 100-104 0.885 105-109 0.9450000000000001 110-114 0.905 115-119 0.625 120-124 0.27499999999999997 125-129 1.825 130-134 4.99 135-139 7.605 140-144 8.595 145-149 4.105 150-151 2.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.0503651473180559 0.15 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947227 spots for SRR7170183.sra Written 947227 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra Read 947226 spots for SRR7170183.sra Written 947226 spots for SRR7170183.sra SRR ids: ['SRR7170183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2fh_i0_s SRR7170183.sra spots: 18944521 blocks: [[1, 947226], [947227, 1894452], [1894453, 2841678], [2841679, 3788904], [3788905, 4736130], [4736131, 5683356], [5683357, 6630582], [6630583, 7577808], [7577809, 8525034], [8525035, 9472260], [9472261, 10419486], [10419487, 11366712], [11366713, 12313938], [12313939, 13261164], [13261165, 14208390], [14208391, 15155616], [15155617, 16102842], [16102843, 17050068], [17050069, 17997294], [17997295, 18944521]] SRR7170183 file size 6397976 SRR7170183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170183 SRR7170183_1.fastq SRR7170183_2.fastq Input file: SRR7170183_1.fastq Paired file: SRR7170183_2.fastq trimmed: SRR7170183-trimmed-pair1.fastq, SRR7170183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:27:30 2025 >> started Wed Feb 12 17:28:03 2025 >> done (32.901s) 18944521 read pairs processed; of these: 31382 ( 0.17%) short read pairs filtered out after trimming by size control 46917 ( 0.25%) empty read pairs filtered out after trimming by size control 18866222 (99.59%) read pairs available; of these: 10751203 (56.99%) trimmed read pairs available after processing 8115019 (43.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 4 0.00% 25 7 0.00% 26 5 0.00% 27 11 0.00% 28 8 0.00% 29 5 0.00% 30 7 0.00% 31 4 0.00% 32 10 0.00% 33 15 0.00% 34 8 0.00% 35 12 0.00% 36 21 0.00% 37 20 0.00% 38 26 0.00% 39 23 0.00% 40 33 0.00% 41 29 0.00% 42 41 0.00% 43 50 0.00% 44 63 0.00% 45 50 0.00% 46 60 0.00% 47 73 0.00% 48 85 0.00% 49 103 0.00% 50 128 0.00% 51 143 0.00% 52 165 0.00% 53 183 0.00% 54 167 0.00% 55 202 0.00% 56 205 0.00% 57 263 0.00% 58 312 0.00% 59 349 0.00% 60 390 0.00% 61 420 0.00% 62 475 0.00% 63 593 0.00% 64 631 0.00% 65 738 0.00% 66 959 0.01% 67 1338 0.01% 68 1526 0.01% 69 1641 0.01% 70 2053 0.01% 71 1806 0.01% 72 1853 0.01% 73 2027 0.01% 74 2287 0.01% 75 2475 0.01% 76 2733 0.01% 77 3063 0.02% 78 3458 0.02% 79 3984 0.02% 80 4298 0.02% 81 5007 0.03% 82 5633 0.03% 83 6443 0.03% 84 7821 0.04% 85 8903 0.05% 86 9820 0.05% 87 9818 0.05% 88 10856 0.06% 89 11397 0.06% 90 12153 0.06% 91 13343 0.07% 92 13846 0.07% 93 14882 0.08% 94 15903 0.08% 95 16829 0.09% 96 17764 0.09% 97 18753 0.10% 98 19807 0.10% 99 20789 0.11% 100 21715 0.12% 101 22947 0.12% 102 24615 0.13% 103 26002 0.14% 104 27204 0.14% 105 28705 0.15% 106 30131 0.16% 107 31078 0.16% 108 32271 0.17% 109 32875 0.17% 110 33918 0.18% 111 35155 0.19% 112 37195 0.20% 113 39008 0.21% 114 40698 0.22% 115 42525 0.23% 116 43614 0.23% 117 45533 0.24% 118 46634 0.25% 119 47779 0.25% 120 49748 0.26% 121 51781 0.27% 122 54563 0.29% 123 57205 0.30% 124 59900 0.32% 125 62743 0.33% 126 64840 0.34% 127 67244 0.36% 128 69581 0.37% 129 73220 0.39% 130 76336 0.40% 131 79989 0.42% 132 83748 0.44% 133 89361 0.47% 134 94882 0.50% 135 100658 0.53% 136 107009 0.57% 137 114980 0.61% 138 124497 0.66% 139 132951 0.70% 140 143990 0.76% 141 157568 0.84% 142 173201 0.92% 143 193101 1.02% 144 221788 1.18% 145 261978 1.39% 146 322343 1.71% 147 428909 2.27% 148 630817 3.34% 149 1166363 6.18% 150 4464877 23.67% 151 8115019 43.01% 18866222 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=261.06 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.3 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAACGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=3.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=54.06 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.2 sequence=TGTTGGTGGTGGTACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAACATGTTGGTGGGGACATGTTTGTTAGTGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCGTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAA SRR7170183 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:28:47 Started mapping on | Feb 12 17:28:47 Finished on | Feb 12 17:32:03 Mapping speed, Million of reads per hour | 346.52 Number of input reads | 18866222 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17945256 Uniquely mapped reads % | 95.12% Average mapped length | 291.17 Number of splices: Total | 16730231 Number of splices: Annotated (sjdb) | 16444746 Number of splices: GT/AG | 16490107 Number of splices: GC/AG | 191260 Number of splices: AT/AC | 13966 Number of splices: Non-canonical | 34898 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343976 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 34598 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598895 598895 598895 N_multimapping 343976 343976 343976 N_noFeature 388653 17745884 463986 N_ambiguous 194865 810 70304 UnstrandedReadsAssigned:17361738 PositiveStrandReadsAssigned:198562 NegativeStrandReadsAssigned:17410966 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170183-trimmed-pair1.fastq SRR7170183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,866,222 reads, 17,338,177 reads pseudoaligned [quant] estimated average fragment length: 236.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7170183.ke.tsv 34699 SRR7170183.se.tsv 87100 total ==> SRR7170183.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.95 242 7.40578 Potri.005G024800.1.v4.1 1035 799.948 41 2.79651 Potri.004G059700.1.v4.1 961 726.016 2 0.150307 Potri.007G009000.2.v4.1 1416 1180.95 0 0 Potri.003G141000.2.v4.1 2943 2707.95 322.158 6.49117 Potri.016G087400.1.v4.1 270 85.5923 2002 1276.21 Potri.015G069301.1.v4.1 564 334.44 0 0 Potri.010G195200.1.v4.1 1773 1537.95 21 0.745027 Potri.012G127500.1.v4.1 977 741.979 5689 418.349 ==> SRR7170183.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1048 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170183 completed mapping pipeline successfully