Starting /dee2/code/volunteer_pipeline.sh SRR7170184 current disk space = 3051795275776 free memory = 999751008 SRR7170184 SRAfilesize 9ddcb64a08fe7be5b12657e895e48539 SRR7170184.sra SRR7170184.sra file validated SRR7170184 is paired end SRR7170184 is conventional basespace SRR7170184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80425 34.0 33.0 34.0 33.0 34.0 2 33.352 34.0 33.0 34.0 33.0 34.0 3 33.44125 34.0 34.0 34.0 33.0 34.0 4 33.39625 34.0 34.0 34.0 33.0 34.0 5 33.234 34.0 34.0 34.0 33.0 34.0 6 37.0405 38.0 37.0 38.0 36.0 38.0 7 37.311 38.0 38.0 38.0 37.0 38.0 8 37.37975 38.0 38.0 38.0 37.0 38.0 9 37.41975 38.0 38.0 38.0 37.0 38.0 10-14 37.365750000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.346199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.3065 38.0 38.0 38.0 37.0 38.0 25-29 37.22709999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.14855 38.0 38.0 38.0 36.6 38.0 35-39 37.0844 38.0 38.0 38.0 36.2 38.0 40-44 36.79270000000001 38.0 38.0 38.0 34.8 38.0 45-49 36.6455 38.0 38.0 38.0 34.2 38.0 50-54 36.52455 38.0 38.0 38.0 34.0 38.0 55-59 36.4456 38.0 38.0 38.0 34.0 38.0 60-64 36.3177 38.0 37.6 38.0 33.4 38.0 65-69 36.27055 38.0 37.0 38.0 33.4 38.0 70-74 36.1814 38.0 37.0 38.0 33.2 38.0 75-79 35.9915 38.0 37.0 38.0 32.0 38.0 80-84 35.86729999999999 38.0 37.0 38.0 31.4 38.0 85-89 35.6202 38.0 36.6 38.0 30.0 38.0 90-94 35.46055 38.0 36.4 38.0 29.4 38.0 95-99 35.21535 38.0 36.0 38.0 29.0 38.0 100-104 35.01565 38.0 36.0 38.0 28.4 38.0 105-109 34.67965 38.0 35.0 38.0 26.6 38.0 110-114 34.314949999999996 38.0 34.6 38.0 24.6 38.0 115-119 33.856 38.0 34.0 38.0 19.8 38.0 120-124 33.72545 38.0 34.0 38.0 21.0 38.0 125-129 33.16925 38.0 33.6 38.0 15.0 38.0 130-134 32.584450000000004 37.2 32.6 38.0 15.0 38.0 135-139 31.949599999999997 36.4 31.4 38.0 14.2 38.0 140-144 31.090750000000003 36.0 31.0 38.0 13.4 38.0 145-149 29.4817 35.2 26.4 38.0 4.2 38.0 150-151 24.27 31.0 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 3.0 12 1.0 13 2.0 14 5.0 15 4.0 16 5.0 17 9.0 18 8.0 19 9.0 20 17.0 21 12.0 22 12.0 23 22.0 24 22.0 25 26.0 26 35.0 27 41.0 28 43.0 29 58.0 30 78.0 31 112.0 32 117.0 33 168.0 34 276.0 35 504.0 36 1044.0 37 1364.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1681100356597 14.620478858889454 11.64034640855833 33.57106469689251 2 21.625 19.875 33.95 24.55 3 18.8 28.125 26.05 27.025 4 23.400000000000002 34.175 21.4 21.025 5 21.141277023629964 37.07893413775767 22.77526395173454 19.004524886877828 6 18.099999999999998 36.8 24.45 20.65 7 14.799999999999999 23.925 41.85 19.425 8 18.95 24.25 28.975 27.825 9 18.85 23.3 32.550000000000004 25.3 10-14 19.77 30.380000000000003 26.085 23.765 15-19 20.115 28.849999999999998 27.935 23.1 20-24 20.51 29.12 27.295 23.075000000000003 25-29 20.8 28.585 26.855 23.76 30-34 20.34 29.2 27.21 23.25 35-39 20.66 28.975 27.150000000000002 23.215 40-44 20.895 28.804999999999996 27.155 23.145 45-49 20.150000000000002 28.83 27.325 23.695 50-54 20.865000000000002 28.384999999999998 27.27 23.48 55-59 20.495 28.595 27.425 23.485 60-64 20.405 29.28 26.61 23.705000000000002 65-69 20.29 28.875 26.82 24.015 70-74 20.305 28.315 27.529999999999998 23.849999999999998 75-79 21.04 28.79 26.775 23.395 80-84 20.335 28.749999999999996 27.095000000000002 23.82 85-89 21.245 27.975 27.12 23.66 90-94 20.474999999999998 28.63 26.865 24.03 95-99 20.974999999999998 28.51 27.0 23.515 100-104 21.02 28.189999999999998 26.955000000000002 23.835 105-109 20.615 28.465 27.405 23.515 110-114 21.224999999999998 28.28 27.205000000000002 23.29 115-119 21.23 27.975 27.279999999999998 23.515 120-124 21.349999999999998 27.88 26.855 23.915 125-129 20.445 28.544999999999998 26.99 24.02 130-134 21.485000000000003 28.139999999999997 26.41 23.965 135-139 20.810000000000002 28.645 27.034999999999997 23.51 140-144 21.46 28.005000000000003 26.924999999999997 23.61 145-149 20.815 28.355000000000004 26.745 24.085 150-151 20.715630885122412 28.474576271186443 26.867545511613304 23.94224733207784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 2.0 25 4.0 26 7.0 27 6.5 28 7.0 29 11.5 30 16.5 31 21.0 32 38.5 33 47.5 34 56.5 35 81.5 36 101.0 37 117.5 38 129.0 39 143.0 40 170.5 41 204.0 42 221.5 43 235.0 44 255.5 45 274.0 46 265.5 47 258.0 48 239.0 49 201.5 50 177.5 51 143.0 52 121.5 53 105.5 54 84.0 55 54.5 56 37.0 57 32.0 58 23.5 59 22.0 60 17.5 61 13.5 62 11.0 63 6.0 64 5.0 65 6.0 66 4.5 67 3.0 68 1.5 69 1.0 70 2.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.012499999999999 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.825 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATATAA 10 0.006830828 145.0 5 ATATAAA 10 0.006830828 145.0 6 >>END_MODULE SRR7170184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76025 33.0 33.0 34.0 32.0 34.0 2 32.88475 34.0 33.0 34.0 32.0 34.0 3 32.71725 34.0 33.0 34.0 32.0 34.0 4 32.499 34.0 33.0 34.0 32.0 34.0 5 32.62475 34.0 33.0 34.0 32.0 34.0 6 36.76525 38.0 38.0 38.0 36.0 38.0 7 36.9565 38.0 38.0 38.0 36.0 38.0 8 36.81375 38.0 38.0 38.0 36.0 38.0 9 36.83925 38.0 38.0 38.0 36.0 38.0 10-14 36.552800000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.49545 38.0 38.0 38.0 36.0 38.0 20-24 36.67555 38.0 38.0 38.0 36.0 38.0 25-29 36.7664 38.0 38.0 38.0 36.0 38.0 30-34 36.7401 38.0 38.0 38.0 36.0 38.0 35-39 36.4279 38.0 38.0 38.0 36.0 38.0 40-44 36.2709 38.0 38.0 38.0 35.4 38.0 45-49 36.3171 38.0 38.0 38.0 34.8 38.0 50-54 36.486450000000005 38.0 38.0 38.0 35.4 38.0 55-59 36.45185 38.0 38.0 38.0 35.0 38.0 60-64 36.370799999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.3761 38.0 38.0 38.0 34.8 38.0 70-74 36.321850000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.243100000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.0891 38.0 38.0 38.0 34.0 38.0 85-89 35.493300000000005 38.0 38.0 38.0 31.2 38.0 90-94 35.228249999999996 38.0 38.0 38.0 29.0 38.0 95-99 35.553 38.0 38.0 38.0 30.8 38.0 100-104 35.655350000000006 38.0 38.0 38.0 32.2 38.0 105-109 35.5259 38.0 37.4 38.0 31.4 38.0 110-114 35.26245 38.0 37.0 38.0 29.4 38.0 115-119 34.989850000000004 38.0 36.4 38.0 28.0 38.0 120-124 34.8843 38.0 36.0 38.0 27.6 38.0 125-129 34.1077 38.0 35.4 38.0 22.4 38.0 130-134 32.84035 38.0 34.4 38.0 14.2 38.0 135-139 31.798399999999997 38.0 33.6 38.0 4.2 38.0 140-144 30.859950000000005 38.0 32.2 38.0 2.0 38.0 145-149 30.336900000000004 38.0 31.0 38.0 2.0 38.0 150-151 26.479 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 9.0 4 1.0 5 0.0 6 0.0 7 1.0 8 3.0 9 2.0 10 2.0 11 3.0 12 4.0 13 5.0 14 8.0 15 10.0 16 10.0 17 11.0 18 8.0 19 12.0 20 15.0 21 7.0 22 23.0 23 15.0 24 14.0 25 25.0 26 32.0 27 44.0 28 47.0 29 52.0 30 64.0 31 92.0 32 116.0 33 156.0 34 126.0 35 245.0 36 538.0 37 2276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.36276969392875 16.708479678876067 17.46111389864526 26.467636728549927 2 26.48310387984981 23.829787234042556 32.065081351689614 17.622027534418024 3 21.083123425692698 28.89168765743073 30.277078085642316 19.748110831234257 4 24.714828897338403 33.89100126742712 22.078580481622307 19.315589353612168 5 23.639112903225808 35.78629032258064 22.177419354838708 18.397177419354836 6 20.54380664652568 35.750251762336354 23.96777442094663 19.73816717019134 7 18.941294530858002 19.04164576016056 39.31259407927747 22.70446562970396 8 22.308853118712275 23.46579476861167 27.03722334004024 27.188128772635817 9 21.99097291875627 25.275827482447344 27.482447342026077 25.25075225677031 10-14 23.029843196762773 28.42185128983308 26.398583712696006 22.149721800708143 15-19 23.428947901885262 27.45286843705656 27.336306507196433 21.781877153861746 20-24 22.63112726538442 28.2497854510576 27.275480842041492 21.843606441516485 25-29 23.000351917952845 27.57025790558544 27.680860690764668 21.74852948569705 30-34 23.073828203580767 28.14323073828204 27.42908871454436 21.353852343592838 35-39 23.3873417721519 27.574683544303795 27.235443037974683 21.80253164556962 40-44 23.460619311537094 27.777495296689885 27.39614582803681 21.36573956373621 45-49 23.54730757529662 27.192982456140353 27.507352195517697 21.75235777304533 50-54 22.928941934834064 28.352721962028504 27.20954827013144 21.508787833005993 55-59 23.522601429578174 27.78113359508708 27.469042585321656 21.227222390013086 60-64 23.31569664902998 27.84580498866213 27.755102040816325 21.08339632149156 65-69 23.73034610940875 27.116089817652085 27.985130858491985 21.16843321444718 70-74 23.61159797686414 27.988381992087735 27.157093494917124 21.242926536131005 75-79 23.411387971580105 27.559291504052837 27.879515660962674 21.149804863404384 80-84 23.33015506599087 27.058764490389926 28.13770261454308 21.473377829076128 85-89 24.04062053480302 27.505613390487856 27.337211675852213 21.11655439885691 90-94 23.615234974915534 27.142418347496672 28.166274188594247 21.07607248899355 95-99 23.874077421298388 27.393683787719038 27.7752673595421 20.956971431440476 100-104 23.656129452432243 27.2581533991283 27.69901307549722 21.386704072942237 105-109 23.849204357210986 27.563877315395814 27.915265297926812 20.67165302946639 110-114 24.25931505473536 27.52335040674902 27.31244350708045 20.90489103143517 115-119 24.180061088578437 27.23449001051525 27.880426618596964 20.70502228230935 120-124 23.664580725907385 27.969962453066334 27.95994993742178 20.405506883604506 125-129 24.143168126360553 27.975497392801092 27.32749455778869 20.55383992304966 130-134 24.725074269036327 27.492573096367334 26.89320894355553 20.88914369104081 135-139 24.313223449085186 27.908465354456713 27.167013388808876 20.611297807649223 140-144 24.689819580646912 26.759495042531288 27.80516877065612 20.74551660616568 145-149 25.020686801820442 27.69445593711212 27.09971038477451 20.185146876292926 150-151 25.354270394484875 27.154346993489085 27.256478999106342 20.234903612919698 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.5 5 2.5 6 2.5 7 2.5 8 1.5 9 2.5 10 3.0 11 1.5 12 2.0 13 1.5 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.5 20 1.5 21 2.0 22 2.5 23 2.5 24 3.0 25 2.0 26 1.5 27 4.5 28 6.0 29 5.0 30 7.5 31 13.0 32 15.0 33 23.5 34 37.0 35 49.5 36 68.5 37 83.0 38 109.5 39 154.5 40 205.5 41 227.0 42 228.5 43 257.0 44 281.0 45 288.0 46 294.5 47 278.5 48 236.5 49 205.0 50 182.5 51 161.5 52 126.0 53 92.5 54 78.5 55 55.5 56 40.0 57 36.0 58 30.0 59 18.0 60 10.0 61 9.5 62 8.0 63 8.5 64 7.5 65 4.0 66 1.5 67 1.5 68 2.0 69 3.0 70 2.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.35000000000000003 2 0.125 3 0.75 4 1.375 5 0.8 6 0.7000000000000001 7 0.35000000000000003 8 0.6 9 0.3 10-14 1.15 15-19 1.34 20-24 0.955 25-29 0.545 30-34 0.58 35-39 1.25 40-44 1.6650000000000003 45-49 1.39 50-54 0.715 55-59 0.67 60-64 0.775 65-69 0.46499999999999997 70-74 0.155 75-79 0.06999999999999999 80-84 0.365 85-89 2.02 90-94 2.33 95-99 0.415 100-104 0.19499999999999998 105-109 0.395 110-114 0.43 115-119 0.145 120-124 0.125 125-129 1.2349999999999999 130-134 4.0649999999999995 135-139 6.265 140-144 7.715 145-149 3.32 150-151 2.0875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra Read 829206 spots for SRR7170184.sra Written 829206 spots for SRR7170184.sra SRR ids: ['SRR7170184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9n6_odqm SRR7170184.sra spots: 16584120 blocks: [[1, 829206], [829207, 1658412], [1658413, 2487618], [2487619, 3316824], [3316825, 4146030], [4146031, 4975236], [4975237, 5804442], [5804443, 6633648], [6633649, 7462854], [7462855, 8292060], [8292061, 9121266], [9121267, 9950472], [9950473, 10779678], [10779679, 11608884], [11608885, 12438090], [12438091, 13267296], [13267297, 14096502], [14096503, 14925708], [14925709, 15754914], [15754915, 16584120]] SRR7170184 file size 5598113 SRR7170184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170184 SRR7170184_1.fastq SRR7170184_2.fastq Input file: SRR7170184_1.fastq Paired file: SRR7170184_2.fastq trimmed: SRR7170184-trimmed-pair1.fastq, SRR7170184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:27:29 2025 >> started Wed Feb 12 17:27:51 2025 >> done (21.238s) 16584120 read pairs processed; of these: 28708 ( 0.17%) short read pairs filtered out after trimming by size control 36366 ( 0.22%) empty read pairs filtered out after trimming by size control 16519046 (99.61%) read pairs available; of these: 10102152 (61.15%) trimmed read pairs available after processing 6416894 (38.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 1 0.00% 23 4 0.00% 24 9 0.00% 25 2 0.00% 26 5 0.00% 27 4 0.00% 28 11 0.00% 29 7 0.00% 30 8 0.00% 31 10 0.00% 32 9 0.00% 33 9 0.00% 34 14 0.00% 35 9 0.00% 36 16 0.00% 37 27 0.00% 38 14 0.00% 39 24 0.00% 40 26 0.00% 41 23 0.00% 42 30 0.00% 43 31 0.00% 44 41 0.00% 45 39 0.00% 46 55 0.00% 47 62 0.00% 48 74 0.00% 49 95 0.00% 50 94 0.00% 51 83 0.00% 52 111 0.00% 53 137 0.00% 54 140 0.00% 55 149 0.00% 56 169 0.00% 57 223 0.00% 58 252 0.00% 59 268 0.00% 60 288 0.00% 61 340 0.00% 62 383 0.00% 63 446 0.00% 64 497 0.00% 65 577 0.00% 66 702 0.00% 67 782 0.00% 68 898 0.01% 69 1305 0.01% 70 1716 0.01% 71 1529 0.01% 72 1606 0.01% 73 1610 0.01% 74 1766 0.01% 75 1996 0.01% 76 2166 0.01% 77 2426 0.01% 78 2710 0.02% 79 2996 0.02% 80 3352 0.02% 81 3969 0.02% 82 4612 0.03% 83 5162 0.03% 84 6282 0.04% 85 7018 0.04% 86 7740 0.05% 87 7948 0.05% 88 8602 0.05% 89 9005 0.05% 90 9489 0.06% 91 10455 0.06% 92 11139 0.07% 93 12418 0.08% 94 13141 0.08% 95 13797 0.08% 96 14863 0.09% 97 15324 0.09% 98 16113 0.10% 99 17202 0.10% 100 18124 0.11% 101 19268 0.12% 102 20575 0.12% 103 22131 0.13% 104 23199 0.14% 105 24778 0.15% 106 25773 0.16% 107 26018 0.16% 108 26988 0.16% 109 28199 0.17% 110 29001 0.18% 111 30512 0.18% 112 32324 0.20% 113 34218 0.21% 114 35880 0.22% 115 37670 0.23% 116 38356 0.23% 117 39226 0.24% 118 40180 0.24% 119 41862 0.25% 120 43447 0.26% 121 45191 0.27% 122 47563 0.29% 123 50932 0.31% 124 53181 0.32% 125 55913 0.34% 126 58792 0.36% 127 60533 0.37% 128 62660 0.38% 129 65376 0.40% 130 68421 0.41% 131 72289 0.44% 132 76281 0.46% 133 82055 0.50% 134 86944 0.53% 135 93775 0.57% 136 100107 0.61% 137 108190 0.65% 138 117374 0.71% 139 127297 0.77% 140 137492 0.83% 141 150718 0.91% 142 168536 1.02% 143 191816 1.16% 144 223031 1.35% 145 264861 1.60% 146 327223 1.98% 147 438756 2.66% 148 641951 3.89% 149 1186202 7.18% 150 4074293 24.66% 151 6416894 38.85% 16519046 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=207.50 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=9 fanout-score=53.56 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7170184 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:28:39 Started mapping on | Feb 12 17:28:39 Finished on | Feb 12 17:30:52 Mapping speed, Million of reads per hour | 447.13 Number of input reads | 16519046 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15368441 Uniquely mapped reads % | 93.03% Average mapped length | 290.94 Number of splices: Total | 14029847 Number of splices: Annotated (sjdb) | 13791594 Number of splices: GT/AG | 13831589 Number of splices: GC/AG | 157881 Number of splices: AT/AC | 11698 Number of splices: Non-canonical | 28679 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289556 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 19694 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 881544 881544 881544 N_multimapping 289556 289556 289556 N_noFeature 326057 15191614 390878 N_ambiguous 175038 1122 62180 UnstrandedReadsAssigned:14867346 PositiveStrandReadsAssigned:175705 NegativeStrandReadsAssigned:14915383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170184-trimmed-pair1.fastq SRR7170184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,519,046 reads, 14,879,568 reads pseudoaligned [quant] estimated average fragment length: 238.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7170184.ke.tsv 34699 SRR7170184.se.tsv 87100 total ==> SRR7170184.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.34 345 12.4031 Potri.005G024800.1.v4.1 1035 797.336 60 4.8164 Potri.004G059700.1.v4.1 961 723.369 1 0.0884816 Potri.007G009000.2.v4.1 1416 1178.34 0 0 Potri.003G141000.2.v4.1 2943 2705.34 305.035 7.21675 Potri.016G087400.1.v4.1 270 85.3546 1506 1129.3 Potri.015G069301.1.v4.1 564 332.769 0 0 Potri.010G195200.1.v4.1 1773 1535.34 6 0.250127 Potri.012G127500.1.v4.1 977 739.341 4169 360.911 ==> SRR7170184.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 936 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170184 completed mapping pipeline successfully