Starting /dee2/code/volunteer_pipeline.sh SRR7170185 current disk space = 3051806650368 free memory = 1506543340 SRR7170185 SRAfilesize b23886f630cb5b589a8a270c1505fea7 SRR7170185.sra SRR7170185.sra file validated SRR7170185 is paired end SRR7170185 is conventional basespace SRR7170185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.927 34.0 33.0 34.0 33.0 34.0 2 33.3265 34.0 33.0 34.0 33.0 34.0 3 33.36025 34.0 33.0 34.0 33.0 34.0 4 33.3465 34.0 33.0 34.0 33.0 34.0 5 33.29725 34.0 33.0 34.0 33.0 34.0 6 37.04775 38.0 37.0 38.0 36.0 38.0 7 35.05375 38.0 37.0 38.0 26.0 38.0 8 36.819 38.0 38.0 38.0 34.0 38.0 9 37.255 38.0 38.0 38.0 36.0 38.0 10-14 36.9029 38.0 37.8 38.0 35.2 38.0 15-19 37.334500000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.468199999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.423899999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.42045 38.0 38.0 38.0 37.2 38.0 35-39 37.29495000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.19815 38.0 38.0 38.0 36.8 38.0 45-49 35.9606 38.0 36.8 38.0 29.0 38.0 50-54 36.705149999999996 38.0 37.8 38.0 34.2 38.0 55-59 36.9051 38.0 38.0 38.0 36.0 38.0 60-64 36.9947 38.0 38.0 38.0 36.0 38.0 65-69 36.9364 38.0 38.0 38.0 36.0 38.0 70-74 35.829150000000006 38.0 36.8 38.0 30.4 38.0 75-79 36.61900000000001 38.0 37.8 38.0 34.8 38.0 80-84 36.699149999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.38955 38.0 38.0 38.0 33.8 38.0 90-94 36.380849999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.3428 38.0 38.0 38.0 34.0 38.0 100-104 36.2033 38.0 38.0 38.0 33.8 38.0 105-109 36.0379 38.0 37.4 38.0 32.8 38.0 110-114 35.97195000000001 38.0 37.2 38.0 33.0 38.0 115-119 35.63685 38.0 36.8 38.0 30.8 38.0 120-124 35.72955 38.0 36.8 38.0 31.6 38.0 125-129 35.544450000000005 38.0 36.4 38.0 31.2 38.0 130-134 35.269400000000005 38.0 36.0 38.0 29.4 38.0 135-139 35.01155 38.0 36.0 38.0 28.2 38.0 140-144 34.54695 38.0 35.0 38.0 26.8 38.0 145-149 34.258950000000006 38.0 35.0 38.0 26.0 38.0 150-151 30.557375 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 5.0 18 5.0 19 4.0 20 5.0 21 5.0 22 2.0 23 8.0 24 11.0 25 18.0 26 24.0 27 23.0 28 35.0 29 37.0 30 35.0 31 49.0 32 76.0 33 105.0 34 198.0 35 311.0 36 675.0 37 2357.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.16227180527384 14.300202839756594 12.068965517241379 33.46855983772819 2 21.55 19.35 32.9 26.200000000000003 3 20.075000000000003 26.724999999999998 24.925 28.275 4 22.925 33.475 21.6 22.0 5 21.30696044066099 35.803705558337505 23.810716074111166 19.078617926890335 6 17.25 35.199999999999996 26.85 20.7 7 13.200000000000001 24.925 42.65 19.225 8 18.625 24.75 28.95 27.675 9 17.5 25.424999999999997 31.374999999999996 25.7 10-14 19.725 30.305 26.755000000000003 23.215 15-19 19.775000000000002 29.435 26.784999999999997 24.005000000000003 20-24 19.295 30.049999999999997 26.68 23.974999999999998 25-29 19.645000000000003 29.92 26.919999999999998 23.515 30-34 19.73 29.675 26.87 23.724999999999998 35-39 20.53 29.21 26.400000000000002 23.86 40-44 20.419999999999998 29.065 26.71 23.805 45-49 20.645 28.67 27.115000000000002 23.57 50-54 20.02 29.459999999999997 27.055 23.465 55-59 20.195 29.235 26.71 23.86 60-64 20.28 29.185 26.919999999999998 23.615 65-69 20.349999999999998 29.29 26.695 23.665 70-74 20.424999999999997 28.910000000000004 27.125 23.54 75-79 20.11 29.24 26.465 24.185000000000002 80-84 20.200000000000003 28.65 27.58 23.57 85-89 20.76 28.444999999999997 27.1 23.695 90-94 20.185 28.749999999999996 26.72 24.345 95-99 20.575 28.99 26.584999999999997 23.849999999999998 100-104 21.02 28.389999999999997 26.919999999999998 23.669999999999998 105-109 20.66 29.085 26.900000000000002 23.355 110-114 20.95 28.22 26.640000000000004 24.19 115-119 20.905 28.225 26.284999999999997 24.585 120-124 21.75 29.07 26.150000000000002 23.03 125-129 21.285 28.449999999999996 25.575 24.69 130-134 21.42 28.63 26.25 23.7 135-139 21.32 28.74 25.795 24.145 140-144 21.416070803540176 28.61143057152858 25.951297564878246 24.021201060053002 145-149 21.09 28.65 26.025 24.235 150-151 20.482982982982982 28.59109109109109 25.975975975975974 24.94994994994995 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 1.5 22 0.5 23 0.5 24 0.5 25 2.5 26 4.5 27 9.0 28 12.5 29 15.5 30 25.0 31 28.5 32 32.0 33 44.0 34 61.5 35 85.0 36 99.0 37 114.0 38 133.5 39 159.0 40 185.0 41 198.0 42 231.0 43 252.5 44 242.0 45 238.0 46 252.0 47 266.5 48 239.5 49 200.5 50 169.5 51 139.5 52 116.5 53 96.0 54 84.0 55 71.0 56 52.0 57 37.5 58 23.0 59 13.0 60 12.0 61 7.5 62 5.5 63 9.0 64 8.0 65 2.5 66 2.5 67 4.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.554994954591322 1.0999999999999999 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025227043390514632 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAAGCAATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 5 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2875 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.6500000000000004 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.800000000000001 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.9625 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.15 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCAA 10 0.006843168 144.91249 7 >>END_MODULE SRR7170185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83525 33.0 33.0 34.0 32.0 34.0 2 32.96425 34.0 33.0 34.0 32.0 34.0 3 32.90725 34.0 33.0 34.0 32.0 34.0 4 32.7345 34.0 33.0 34.0 32.0 34.0 5 32.83675 34.0 33.0 34.0 32.0 34.0 6 36.86775 38.0 38.0 38.0 37.0 38.0 7 36.819 38.0 38.0 38.0 37.0 38.0 8 36.63925 38.0 38.0 38.0 36.0 38.0 9 36.75275 38.0 38.0 38.0 36.0 38.0 10-14 36.686400000000006 38.0 38.0 38.0 36.2 38.0 15-19 36.7726 38.0 38.0 38.0 36.4 38.0 20-24 36.5966 38.0 38.0 38.0 35.8 38.0 25-29 36.6368 38.0 38.0 38.0 35.8 38.0 30-34 36.63235 38.0 38.0 38.0 35.8 38.0 35-39 36.519999999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.51049999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.5098 38.0 38.0 38.0 35.8 38.0 50-54 36.574650000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.44405 38.0 38.0 38.0 35.2 38.0 60-64 36.48825000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.38065 38.0 38.0 38.0 35.2 38.0 70-74 36.2376 38.0 38.0 38.0 34.4 38.0 75-79 35.87155 38.0 38.0 38.0 31.8 38.0 80-84 36.10850000000001 38.0 38.0 38.0 33.8 38.0 85-89 36.22825 38.0 38.0 38.0 34.2 38.0 90-94 36.135949999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.06705 38.0 38.0 38.0 34.0 38.0 100-104 36.0027 38.0 38.0 38.0 34.0 38.0 105-109 35.83375 38.0 38.0 38.0 33.4 38.0 110-114 35.60985 38.0 38.0 38.0 32.2 38.0 115-119 35.53145 38.0 37.6 38.0 31.8 38.0 120-124 35.2864 38.0 37.0 38.0 31.0 38.0 125-129 35.1214 38.0 37.0 38.0 30.4 38.0 130-134 34.65375 38.0 35.8 38.0 27.0 38.0 135-139 34.2131 38.0 35.6 38.0 23.6 38.0 140-144 34.0567 38.0 35.4 38.0 22.8 38.0 145-149 33.37995 38.0 34.6 38.0 17.0 38.0 150-151 29.550625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 5.0 5 2.0 6 3.0 7 3.0 8 4.0 9 3.0 10 2.0 11 1.0 12 6.0 13 1.0 14 3.0 15 4.0 16 9.0 17 7.0 18 5.0 19 11.0 20 11.0 21 8.0 22 12.0 23 21.0 24 23.0 25 16.0 26 22.0 27 23.0 28 30.0 29 31.0 30 41.0 31 49.0 32 55.0 33 101.0 34 127.0 35 201.0 36 433.0 37 2698.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 16.3 18.224999999999998 24.65 2 25.85 24.474999999999998 30.825000000000003 18.85 3 22.025 27.925 29.175 20.875 4 23.7 32.85 22.075 21.375 5 24.175 35.25 21.375 19.2 6 21.2 34.375 24.5 19.925 7 18.925 19.675 38.7 22.7 8 21.325 24.099999999999998 26.400000000000002 28.175 9 22.15 26.325 25.95 25.575 10-14 23.59 28.175 26.284999999999997 21.95 15-19 23.555 26.91 27.82 21.715 20-24 23.505000000000003 27.775 27.37 21.349999999999998 25-29 23.565 27.744999999999997 27.250000000000004 21.44 30-34 23.445 27.74 27.655 21.16 35-39 23.64 27.445000000000004 27.534999999999997 21.38 40-44 24.12982596519304 27.08041608321664 27.68553710742148 21.104220844168832 45-49 23.862386238623863 27.18771877187719 27.51775177517752 21.43214321432143 50-54 23.82 27.529999999999998 27.810000000000002 20.84 55-59 23.915 27.73 27.24 21.115000000000002 60-64 23.705000000000002 27.29 27.72 21.285 65-69 24.01 27.66 27.54 20.79 70-74 23.73 26.615 28.294999999999998 21.36 75-79 23.866193309665483 27.231361568078405 28.056402820141006 20.846042302115105 80-84 24.38 26.93 28.1 20.59 85-89 23.880000000000003 27.075 28.299999999999997 20.745 90-94 23.615 26.68 28.595 21.11 95-99 23.98 27.084999999999997 28.475 20.46 100-104 24.085 27.35 28.125 20.44 105-109 24.12 26.75 28.685 20.445 110-114 23.75 27.495000000000005 27.944999999999997 20.810000000000002 115-119 24.625 26.834999999999997 28.09 20.45 120-124 24.795 27.67 27.275 20.26 125-129 24.94 27.595 27.49 19.975 130-134 25.09 27.32 27.395000000000003 20.195 135-139 25.385 27.245 27.345000000000002 20.025000000000002 140-144 24.867486748674867 27.65776577657766 27.49274927492749 19.98199819981998 145-149 25.319999999999997 27.355 27.11 20.215 150-151 26.438510718315158 26.827127992979815 27.065312774225898 19.66904851447913 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 1.5 24 1.5 25 2.0 26 2.0 27 1.5 28 3.5 29 6.0 30 7.0 31 11.5 32 16.0 33 22.0 34 28.0 35 44.0 36 61.0 37 81.5 38 115.5 39 139.0 40 164.0 41 205.0 42 244.5 43 265.5 44 295.0 45 289.5 46 282.5 47 274.0 48 249.0 49 230.0 50 192.5 51 163.5 52 134.0 53 113.0 54 90.0 55 64.0 56 48.0 57 36.5 58 24.5 59 19.0 60 17.0 61 12.0 62 9.0 63 6.0 64 6.0 65 8.0 66 5.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.4025157232704402 0.8 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.7249999999999996 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.425000000000001 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 6.6375 0.0 0.0 0.0 0.0 132-133 7.175000000000001 0.0 0.0 0.0 0.0 134-135 7.550000000000001 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923367 spots for SRR7170185.sra Written 923367 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra Read 923359 spots for SRR7170185.sra Written 923359 spots for SRR7170185.sra SRR ids: ['SRR7170185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lkskkvaj SRR7170185.sra spots: 18467188 blocks: [[1, 923359], [923360, 1846718], [1846719, 2770077], [2770078, 3693436], [3693437, 4616795], [4616796, 5540154], [5540155, 6463513], [6463514, 7386872], [7386873, 8310231], [8310232, 9233590], [9233591, 10156949], [10156950, 11080308], [11080309, 12003667], [12003668, 12927026], [12927027, 13850385], [13850386, 14773744], [14773745, 15697103], [15697104, 16620462], [16620463, 17543821], [17543822, 18467188]] SRR7170185 file size 6236223 SRR7170185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170185 SRR7170185_1.fastq SRR7170185_2.fastq Input file: SRR7170185_1.fastq Paired file: SRR7170185_2.fastq trimmed: SRR7170185-trimmed-pair1.fastq, SRR7170185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:26:27 2025 >> started Wed Feb 12 17:26:50 2025 >> done (23.408s) 18467188 read pairs processed; of these: 52905 ( 0.29%) short read pairs filtered out after trimming by size control 50696 ( 0.27%) empty read pairs filtered out after trimming by size control 18363587 (99.44%) read pairs available; of these: 8532713 (46.47%) trimmed read pairs available after processing 9830874 (53.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 9 0.00% 22 10 0.00% 23 4 0.00% 24 9 0.00% 25 12 0.00% 26 7 0.00% 27 8 0.00% 28 13 0.00% 29 8 0.00% 30 15 0.00% 31 20 0.00% 32 18 0.00% 33 25 0.00% 34 19 0.00% 35 29 0.00% 36 33 0.00% 37 37 0.00% 38 39 0.00% 39 54 0.00% 40 49 0.00% 41 37 0.00% 42 67 0.00% 43 59 0.00% 44 81 0.00% 45 83 0.00% 46 107 0.00% 47 97 0.00% 48 118 0.00% 49 149 0.00% 50 179 0.00% 51 195 0.00% 52 206 0.00% 53 182 0.00% 54 237 0.00% 55 278 0.00% 56 287 0.00% 57 297 0.00% 58 402 0.00% 59 465 0.00% 60 522 0.00% 61 531 0.00% 62 574 0.00% 63 696 0.00% 64 849 0.00% 65 886 0.00% 66 1020 0.01% 67 1120 0.01% 68 1460 0.01% 69 3036 0.02% 70 4324 0.02% 71 3540 0.02% 72 2795 0.02% 73 2600 0.01% 74 2706 0.01% 75 2864 0.02% 76 3059 0.02% 77 3323 0.02% 78 3719 0.02% 79 4172 0.02% 80 4542 0.02% 81 5144 0.03% 82 6141 0.03% 83 6912 0.04% 84 9789 0.05% 85 11357 0.06% 86 11816 0.06% 87 12333 0.07% 88 12758 0.07% 89 13128 0.07% 90 13901 0.08% 91 15046 0.08% 92 15931 0.09% 93 17211 0.09% 94 18039 0.10% 95 18750 0.10% 96 19331 0.11% 97 19996 0.11% 98 20500 0.11% 99 21551 0.12% 100 22909 0.12% 101 24304 0.13% 102 25445 0.14% 103 26663 0.15% 104 28300 0.15% 105 29675 0.16% 106 30187 0.16% 107 30455 0.17% 108 31767 0.17% 109 32622 0.18% 110 33871 0.18% 111 35193 0.19% 112 37503 0.20% 113 39246 0.21% 114 40614 0.22% 115 41912 0.23% 116 42671 0.23% 117 43807 0.24% 118 44454 0.24% 119 45109 0.25% 120 46166 0.25% 121 47588 0.26% 122 49923 0.27% 123 53337 0.29% 124 54839 0.30% 125 56683 0.31% 126 58253 0.32% 127 59293 0.32% 128 61224 0.33% 129 62157 0.34% 130 64126 0.35% 131 65739 0.36% 132 69548 0.38% 133 72765 0.40% 134 76443 0.42% 135 80683 0.44% 136 84612 0.46% 137 88880 0.48% 138 92043 0.50% 139 95495 0.52% 140 100037 0.54% 141 108019 0.59% 142 116728 0.64% 143 128958 0.70% 144 146852 0.80% 145 171601 0.93% 146 204845 1.12% 147 266823 1.45% 148 384258 2.09% 149 704574 3.84% 150 3851586 20.97% 151 9830874 53.53% 18363587 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=39 prefix-density=0.32 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=70.47 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.7 sequence=AATTGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAACGCGTCATAGCAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=15.00 fanout-score-rank=5 prefix-density=0.51 prefix-fanout=6.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCTTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=43.01 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=11.1 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7170185 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:27:48 Started mapping on | Feb 12 17:27:48 Finished on | Feb 12 17:29:42 Mapping speed, Million of reads per hour | 579.90 Number of input reads | 18363587 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17163965 Uniquely mapped reads % | 93.47% Average mapped length | 291.82 Number of splices: Total | 14468404 Number of splices: Annotated (sjdb) | 14212681 Number of splices: GT/AG | 14257978 Number of splices: GC/AG | 165194 Number of splices: AT/AC | 12206 Number of splices: Non-canonical | 33026 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351727 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 34675 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 894260 894260 894260 N_multimapping 351727 351727 351727 N_noFeature 429822 16943310 505361 N_ambiguous 213355 1164 67412 UnstrandedReadsAssigned:16520788 PositiveStrandReadsAssigned:219491 NegativeStrandReadsAssigned:16591192 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170185-trimmed-pair1.fastq SRR7170185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,363,587 reads, 16,579,069 reads pseudoaligned [quant] estimated average fragment length: 230.147 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR7170185.ke.tsv 34699 SRR7170185.se.tsv 87100 total ==> SRR7170185.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.85 311 9.46485 Potri.005G024800.1.v4.1 1035 805.853 48 3.24275 Potri.004G059700.1.v4.1 961 731.878 3 0.223157 Potri.007G009000.2.v4.1 1416 1186.85 0 0 Potri.003G141000.2.v4.1 2943 2713.85 312.04 6.25967 Potri.016G087400.1.v4.1 270 86.2019 1737.53 1097.35 Potri.015G069301.1.v4.1 564 338.842 0 0 Potri.010G195200.1.v4.1 1773 1543.85 33 1.16369 Potri.012G127500.1.v4.1 977 747.865 6688 486.856 ==> SRR7170185.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1363 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170185 completed mapping pipeline successfully