Starting /dee2/code/volunteer_pipeline.sh SRR7170186 current disk space = 3051403186176 free memory = 1570868844 SRR7170186 SRAfilesize aac8dfa6ac6b99643f58016f66e4d769 SRR7170186.sra SRR7170186.sra file validated SRR7170186 is paired end SRR7170186 is conventional basespace SRR7170186 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170186_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76625 34.0 33.0 34.0 33.0 34.0 2 33.3315 34.0 33.0 34.0 33.0 34.0 3 33.3275 34.0 34.0 34.0 33.0 34.0 4 33.426 34.0 34.0 34.0 33.0 34.0 5 33.30925 34.0 34.0 34.0 33.0 34.0 6 36.9995 38.0 37.0 38.0 36.0 38.0 7 37.2495 38.0 38.0 38.0 36.0 38.0 8 37.35475 38.0 38.0 38.0 37.0 38.0 9 37.42225 38.0 38.0 38.0 37.0 38.0 10-14 37.38695 38.0 38.0 38.0 37.0 38.0 15-19 37.3624 38.0 38.0 38.0 37.0 38.0 20-24 37.32345 38.0 38.0 38.0 37.0 38.0 25-29 37.2392 38.0 38.0 38.0 36.8 38.0 30-34 37.14919999999999 38.0 38.0 38.0 36.2 38.0 35-39 37.058299999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.71005 38.0 38.0 38.0 34.4 38.0 45-49 36.60435 38.0 38.0 38.0 34.0 38.0 50-54 36.50355 38.0 37.8 38.0 34.0 38.0 55-59 36.3279 38.0 37.2 38.0 33.4 38.0 60-64 36.3002 38.0 37.0 38.0 33.8 38.0 65-69 36.21955 38.0 37.0 38.0 33.0 38.0 70-74 36.10245 38.0 37.0 38.0 32.6 38.0 75-79 35.90375 38.0 37.0 38.0 31.2 38.0 80-84 35.8294 38.0 37.0 38.0 31.0 38.0 85-89 35.6024 38.0 36.4 38.0 29.6 38.0 90-94 35.37905000000001 38.0 36.0 38.0 29.0 38.0 95-99 35.184000000000005 38.0 36.0 38.0 29.0 38.0 100-104 34.93485 38.0 35.6 38.0 27.8 38.0 105-109 34.704499999999996 38.0 35.0 38.0 26.4 38.0 110-114 34.396699999999996 38.0 34.6 38.0 25.0 38.0 115-119 33.926399999999994 38.0 34.0 38.0 22.6 38.0 120-124 33.753499999999995 38.0 34.0 38.0 21.2 38.0 125-129 33.1013 38.0 33.4 38.0 15.0 38.0 130-134 32.64019999999999 37.2 33.0 38.0 15.0 38.0 135-139 32.00865 36.4 31.6 38.0 14.4 38.0 140-144 31.305649999999996 36.0 31.0 38.0 13.8 38.0 145-149 29.7466 35.6 27.8 38.0 4.2 38.0 150-151 24.897624999999998 33.0 13.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 4.0 13 1.0 14 7.0 15 3.0 16 4.0 17 6.0 18 11.0 19 13.0 20 9.0 21 14.0 22 12.0 23 15.0 24 26.0 25 26.0 26 36.0 27 47.0 28 51.0 29 63.0 30 78.0 31 76.0 32 156.0 33 175.0 34 252.0 35 510.0 36 1058.0 37 1346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.76883910386965 13.492871690427698 12.296334012219958 38.44195519348269 2 20.935467733866933 19.634817408704354 37.218609304652325 22.211105552776388 3 19.775000000000002 25.474999999999998 25.35 29.4 4 21.85 34.8 20.849999999999998 22.5 5 20.642086782041634 38.073739653875094 22.498118886380738 18.78605467770253 6 18.125 35.775 25.825 20.275000000000002 7 13.875000000000002 21.725 43.375 21.025 8 17.95 23.425 29.975 28.65 9 17.375 23.45 32.074999999999996 27.1 10-14 20.315 29.794999999999998 25.86 24.03 15-19 19.650000000000002 28.53 27.805000000000003 24.015 20-24 19.665 28.475 27.595 24.265 25-29 19.675 28.904999999999998 27.284999999999997 24.135 30-34 19.965 28.03 27.655 24.349999999999998 35-39 19.805 28.799999999999997 27.21 24.185000000000002 40-44 20.45 28.425 27.37 23.755000000000003 45-49 20.27 28.375 27.595 23.76 50-54 20.044999999999998 28.555000000000003 27.48 23.919999999999998 55-59 20.395 28.53 27.295 23.78 60-64 20.74 28.560000000000002 26.645000000000003 24.055 65-69 20.415 28.825 27.27 23.49 70-74 20.674999999999997 28.345 27.200000000000003 23.78 75-79 20.9 27.705000000000002 27.560000000000002 23.835 80-84 20.855 28.18 27.405 23.56 85-89 20.705000000000002 28.675 27.02 23.599999999999998 90-94 21.09 28.33 27.139999999999997 23.44 95-99 20.349999999999998 28.9 26.87 23.880000000000003 100-104 21.145 28.444999999999997 26.625 23.785 105-109 21.065 28.12 27.08 23.735 110-114 21.27 27.815 27.005000000000003 23.91 115-119 21.295 28.015 26.965 23.724999999999998 120-124 20.875 28.925 26.87 23.330000000000002 125-129 21.375 28.134999999999998 27.029999999999998 23.46 130-134 21.42 27.73 27.065 23.785 135-139 21.634999999999998 27.900000000000002 26.83 23.635 140-144 21.415 27.93 27.325 23.330000000000002 145-149 21.490000000000002 28.475 26.415 23.62 150-151 21.42677719166039 27.593569454910828 26.45064054257724 24.529012810851544 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 3.0 26 6.0 27 6.5 28 7.0 29 11.0 30 17.0 31 29.5 32 36.0 33 33.0 34 46.5 35 68.0 36 82.5 37 99.0 38 120.0 39 151.0 40 182.0 41 210.5 42 249.5 43 255.5 44 262.0 45 269.5 46 262.5 47 259.5 48 241.5 49 221.5 50 192.5 51 160.0 52 130.0 53 93.5 54 66.5 55 56.5 56 42.0 57 28.0 58 23.5 59 18.5 60 9.5 61 10.0 62 9.0 63 3.5 64 3.5 65 3.0 66 3.0 67 4.5 68 3.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.05 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.012499999999999 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170186 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170186_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7785 33.0 33.0 34.0 32.0 34.0 2 32.95125 33.0 33.0 34.0 32.0 34.0 3 32.73925 34.0 33.0 34.0 32.0 34.0 4 32.52825 34.0 33.0 34.0 32.0 34.0 5 32.65325 34.0 33.0 34.0 32.0 34.0 6 36.78125 38.0 38.0 38.0 36.0 38.0 7 36.8505 38.0 38.0 38.0 37.0 38.0 8 36.83675 38.0 38.0 38.0 37.0 38.0 9 36.8985 38.0 38.0 38.0 37.0 38.0 10-14 36.6519 38.0 38.0 38.0 36.4 38.0 15-19 36.56605 38.0 38.0 38.0 36.0 38.0 20-24 36.67985 38.0 38.0 38.0 36.0 38.0 25-29 36.69195 38.0 38.0 38.0 36.0 38.0 30-34 36.676300000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.4736 38.0 38.0 38.0 35.8 38.0 40-44 36.374900000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.34695 38.0 38.0 38.0 35.0 38.0 50-54 36.57535 38.0 38.0 38.0 35.6 38.0 55-59 36.471900000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.44065 38.0 38.0 38.0 35.0 38.0 65-69 36.416399999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.36035 38.0 38.0 38.0 34.4 38.0 75-79 36.25795000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.14495 38.0 38.0 38.0 34.0 38.0 85-89 35.6833 38.0 38.0 38.0 32.8 38.0 90-94 35.4632 38.0 38.0 38.0 31.0 38.0 95-99 35.7048 38.0 37.6 38.0 31.0 38.0 100-104 35.740449999999996 38.0 37.6 38.0 32.6 38.0 105-109 35.577549999999995 38.0 37.4 38.0 31.4 38.0 110-114 35.32445 38.0 37.0 38.0 30.2 38.0 115-119 35.10815 38.0 36.8 38.0 28.4 38.0 120-124 34.96915 38.0 36.2 38.0 28.2 38.0 125-129 34.222950000000004 38.0 35.4 38.0 24.4 38.0 130-134 32.897499999999994 38.0 34.6 38.0 14.2 38.0 135-139 31.919099999999997 38.0 34.0 38.0 6.4 38.0 140-144 31.19285 38.0 33.0 38.0 2.0 38.0 145-149 30.450849999999996 38.0 31.4 38.0 2.0 38.0 150-151 26.399250000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 3.0 4 3.0 5 1.0 6 3.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 9.0 15 2.0 16 7.0 17 8.0 18 10.0 19 16.0 20 13.0 21 8.0 22 13.0 23 21.0 24 24.0 25 20.0 26 34.0 27 44.0 28 37.0 29 58.0 30 68.0 31 83.0 32 104.0 33 159.0 34 132.0 35 227.0 36 556.0 37 2298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.09719438877755 16.783567134268537 17.034068136272545 30.085170340681362 2 23.792844633475106 25.01876407305479 34.05053790342757 17.137853390042533 3 20.958385876418664 28.32282471626734 29.482976040353087 21.235813366960908 4 24.62591935074816 35.201623129596754 21.55718995688562 18.615267562769464 5 24.552106989654302 35.957607872823615 21.725965177895535 17.764319959626544 6 18.86031265758951 38.149268784669694 23.751891074130103 19.23852748361069 7 18.07198590485779 18.6257236345331 42.788824565819276 20.51346589478983 8 21.547379032258064 21.875 28.578629032258064 27.99899193548387 9 21.93158953722334 23.843058350100605 29.351106639839035 24.87424547283702 10-14 22.767563186952337 28.085903864660892 26.20675682520387 22.939776123182902 15-19 22.781215133380666 27.441931230347905 28.233086519931028 21.5437671163404 20-24 22.842126541338185 27.941176470588236 27.900747928037195 21.315949060036385 25-29 23.361564831619276 27.455132083081267 27.79794313369631 21.385359951603146 30-34 22.942718838241227 27.969947559499797 28.020371117386045 21.066962484872935 35-39 23.010240292000404 27.85663591199432 27.77552468822873 21.35759910777654 40-44 23.574009057141403 27.49198595634254 27.90922505469903 21.024779931817026 45-49 22.936338714590313 27.601786983450094 27.845466544826884 21.616407757132706 50-54 23.310964226247542 28.099298652807914 27.86719814319592 20.722538977748624 55-59 23.474225764148088 27.968324422475536 27.5496822354484 21.007767577927975 60-64 23.465576418332322 27.175449222693317 28.144558853220268 21.21441550575409 65-69 23.21159070329007 27.221048395210783 28.38313713653285 21.184223764966294 70-74 23.596012223836482 27.874354992234856 27.523671158759583 21.00596162516908 75-79 23.571785892946473 27.528764382191095 27.848924462231118 21.050525262631314 80-84 23.646952505271614 27.02078521939954 27.738728788030926 21.593533487297922 85-89 23.717916007552176 27.9175383987345 27.48890136245344 20.875644231259887 90-94 23.491478581298942 27.570500025589844 27.616561748298274 21.321459644812936 95-99 23.714343109682602 27.666733627963037 27.480916030534353 21.13800723182001 100-104 24.143114852675886 27.941471236720787 27.435357787131693 20.480056123471638 105-109 24.020125786163522 27.71320754716981 27.808805031446543 20.457861635220127 110-114 24.073701167942005 28.423278292388236 27.16975432944019 20.33326621022956 115-119 24.34029342546693 27.71518702118071 27.164388363126534 20.780131190225827 120-124 23.94535355051794 27.908722414051944 27.76860331281589 20.377320722614222 125-129 24.281732961743096 27.93514061312389 27.200405371167975 20.582721053965038 130-134 24.93616134243577 27.937881077700766 27.109281359111993 20.01667622075147 135-139 24.745726609510623 27.31774854891102 27.599978699611267 20.33654614196709 140-144 25.17226528854436 27.6916451335056 26.873385012919897 20.262704565030145 145-149 25.553143093465675 27.956989247311824 26.705955334987593 19.783912324234905 150-151 25.331463539010706 27.434982151963283 27.447730749617545 19.785823559408467 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 1.5 6 3.5 7 2.5 8 3.0 9 5.0 10 6.5 11 4.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.5 23 2.5 24 2.5 25 3.5 26 4.5 27 2.5 28 3.0 29 9.0 30 14.0 31 17.0 32 21.5 33 29.0 34 40.0 35 50.0 36 67.0 37 101.0 38 127.0 39 147.0 40 183.0 41 213.0 42 236.0 43 264.5 44 280.5 45 286.0 46 279.0 47 270.5 48 252.0 49 220.0 50 186.0 51 153.0 52 140.0 53 119.0 54 71.5 55 39.0 56 30.5 57 23.0 58 17.5 59 13.5 60 11.0 61 7.5 62 3.0 63 3.0 64 6.0 65 5.5 66 2.5 67 1.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.075 3 0.8750000000000001 4 1.425 5 0.9249999999999999 6 0.8500000000000001 7 0.675 8 0.8 9 0.6 10-14 1.2850000000000001 15-19 1.41 20-24 1.06 25-29 0.8200000000000001 30-34 0.84 35-39 1.37 40-44 1.735 45-49 1.51 50-54 0.905 55-59 0.8699999999999999 60-64 0.9400000000000001 65-69 0.61 70-74 0.19499999999999998 75-79 0.05 80-84 0.41000000000000003 85-89 2.015 90-94 2.305 95-99 0.44 100-104 0.22 105-109 0.625 110-114 0.6799999999999999 115-119 0.145 120-124 0.08499999999999999 125-129 1.325 130-134 4.055000000000001 135-139 6.105 140-144 7.12 145-149 3.2800000000000002 150-151 1.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.301659125188537 0.6 3 0.050276520864756154 0.15 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.22499999999999998 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra Read 820669 spots for SRR7170186.sra Written 820669 spots for SRR7170186.sra Read 820654 spots for SRR7170186.sra Written 820654 spots for SRR7170186.sra SRR ids: ['SRR7170186.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f62zl3cz SRR7170186.sra spots: 16413095 blocks: [[1, 820654], [820655, 1641308], [1641309, 2461962], [2461963, 3282616], [3282617, 4103270], [4103271, 4923924], [4923925, 5744578], [5744579, 6565232], [6565233, 7385886], [7385887, 8206540], [8206541, 9027194], [9027195, 9847848], [9847849, 10668502], [10668503, 11489156], [11489157, 12309810], [12309811, 13130464], [13130465, 13951118], [13951119, 14771772], [14771773, 15592426], [15592427, 16413095]] SRR7170186 file size 5540158 SRR7170186 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170186 SRR7170186_1.fastq SRR7170186_2.fastq Input file: SRR7170186_1.fastq Paired file: SRR7170186_2.fastq trimmed: SRR7170186-trimmed-pair1.fastq, SRR7170186-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:21:00 2025 >> started Wed Feb 12 18:21:26 2025 >> done (25.126s) 16413095 read pairs processed; of these: 27187 ( 0.17%) short read pairs filtered out after trimming by size control 30461 ( 0.19%) empty read pairs filtered out after trimming by size control 16355447 (99.65%) read pairs available; of these: 9208879 (56.30%) trimmed read pairs available after processing 7146568 (43.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 6 0.00% 22 3 0.00% 23 0 0.00% 24 4 0.00% 25 1 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 6 0.00% 30 11 0.00% 31 5 0.00% 32 9 0.00% 33 11 0.00% 34 9 0.00% 35 12 0.00% 36 16 0.00% 37 14 0.00% 38 12 0.00% 39 15 0.00% 40 21 0.00% 41 21 0.00% 42 24 0.00% 43 40 0.00% 44 29 0.00% 45 38 0.00% 46 39 0.00% 47 51 0.00% 48 56 0.00% 49 54 0.00% 50 76 0.00% 51 71 0.00% 52 85 0.00% 53 121 0.00% 54 125 0.00% 55 130 0.00% 56 173 0.00% 57 170 0.00% 58 180 0.00% 59 190 0.00% 60 219 0.00% 61 277 0.00% 62 308 0.00% 63 324 0.00% 64 331 0.00% 65 418 0.00% 66 499 0.00% 67 571 0.00% 68 678 0.00% 69 814 0.00% 70 957 0.01% 71 938 0.01% 72 1023 0.01% 73 1170 0.01% 74 1310 0.01% 75 1480 0.01% 76 1581 0.01% 77 1810 0.01% 78 1952 0.01% 79 2245 0.01% 80 2494 0.02% 81 2805 0.02% 82 3275 0.02% 83 3762 0.02% 84 4794 0.03% 85 5553 0.03% 86 6005 0.04% 87 6048 0.04% 88 6417 0.04% 89 6941 0.04% 90 7458 0.05% 91 8154 0.05% 92 8793 0.05% 93 9615 0.06% 94 10098 0.06% 95 11047 0.07% 96 11633 0.07% 97 12274 0.08% 98 12712 0.08% 99 13019 0.08% 100 14140 0.09% 101 15018 0.09% 102 16393 0.10% 103 17377 0.11% 104 18517 0.11% 105 19769 0.12% 106 20859 0.13% 107 21423 0.13% 108 22038 0.13% 109 22692 0.14% 110 23871 0.15% 111 24909 0.15% 112 26266 0.16% 113 27976 0.17% 114 29589 0.18% 115 31065 0.19% 116 32036 0.20% 117 33137 0.20% 118 33938 0.21% 119 35028 0.21% 120 36392 0.22% 121 38146 0.23% 122 40624 0.25% 123 42947 0.26% 124 45287 0.28% 125 47522 0.29% 126 49893 0.31% 127 51685 0.32% 128 53982 0.33% 129 56883 0.35% 130 59080 0.36% 131 62274 0.38% 132 66502 0.41% 133 71380 0.44% 134 75937 0.46% 135 80961 0.50% 136 87904 0.54% 137 93509 0.57% 138 102940 0.63% 139 112056 0.69% 140 121264 0.74% 141 131913 0.81% 142 147597 0.90% 143 167607 1.02% 144 192798 1.18% 145 230003 1.41% 146 283728 1.73% 147 380421 2.33% 148 561729 3.43% 149 1066446 6.52% 150 3989773 24.39% 151 7146568 43.70% 16355447 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=209.47 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=46.90 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=12.5 sequence=TGTTGGTGGTGG SRR7170186 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:22:06 Started mapping on | Feb 12 18:22:06 Finished on | Feb 12 18:23:30 Mapping speed, Million of reads per hour | 700.95 Number of input reads | 16355447 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15554859 Uniquely mapped reads % | 95.11% Average mapped length | 292.58 Number of splices: Total | 14685914 Number of splices: Annotated (sjdb) | 14446969 Number of splices: GT/AG | 14482547 Number of splices: GC/AG | 163786 Number of splices: AT/AC | 11700 Number of splices: Non-canonical | 27881 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277404 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 83310 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541947 541947 541947 N_multimapping 277404 277404 277404 N_noFeature 315922 15383668 383663 N_ambiguous 166421 763 62439 UnstrandedReadsAssigned:15072516 PositiveStrandReadsAssigned:170428 NegativeStrandReadsAssigned:15108757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170186 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170186-trimmed-pair1.fastq SRR7170186-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,355,447 reads, 15,045,144 reads pseudoaligned [quant] estimated average fragment length: 245.976 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7170186.ke.tsv 34699 SRR7170186.se.tsv 87100 total ==> SRR7170186.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.02 365 13.7888 Potri.005G024800.1.v4.1 1035 790.024 51 4.32391 Potri.004G059700.1.v4.1 961 716.084 2 0.187074 Potri.007G009000.2.v4.1 1416 1171.02 0 0 Potri.003G141000.2.v4.1 2943 2698.02 295.032 7.32437 Potri.016G087400.1.v4.1 270 80.9512 1145 947.391 Potri.015G069301.1.v4.1 564 326.418 0 0 Potri.010G195200.1.v4.1 1773 1528.02 16 0.701353 Potri.012G127500.1.v4.1 977 732.058 2988 273.39 ==> SRR7170186.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1407 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170186 completed mapping pipeline successfully