Starting /dee2/code/volunteer_pipeline.sh SRR7170187 current disk space = 3051597156352 free memory = 1462976080 SRR7170187 SRAfilesize d8deed0567d3088c9af3d2c12fddaf42 SRR7170187.sra SRR7170187.sra file validated SRR7170187 is paired end SRR7170187 is conventional basespace SRR7170187 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170187_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3165 34.0 33.0 34.0 33.0 34.0 2 33.42675 34.0 33.0 34.0 33.0 34.0 3 33.4315 34.0 33.0 34.0 33.0 34.0 4 33.4125 34.0 34.0 34.0 33.0 34.0 5 33.44825 34.0 34.0 34.0 33.0 34.0 6 36.95025 38.0 37.0 38.0 36.0 38.0 7 37.207 38.0 38.0 38.0 36.0 38.0 8 37.40875 38.0 38.0 38.0 37.0 38.0 9 37.4355 38.0 38.0 38.0 37.0 38.0 10-14 37.45225000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.4118 38.0 38.0 38.0 37.0 38.0 20-24 37.332100000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3166 38.0 38.0 38.0 37.0 38.0 30-34 37.289300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.17605 38.0 38.0 38.0 36.4 38.0 40-44 36.86785 38.0 38.0 38.0 35.4 38.0 45-49 36.740750000000006 38.0 38.0 38.0 34.6 38.0 50-54 36.665049999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.6209 38.0 38.0 38.0 34.0 38.0 60-64 36.519850000000005 38.0 38.0 38.0 34.0 38.0 65-69 36.5028 38.0 38.0 38.0 34.0 38.0 70-74 36.41965 38.0 37.6 38.0 33.8 38.0 75-79 36.35119999999999 38.0 37.4 38.0 33.6 38.0 80-84 36.1336 38.0 37.0 38.0 33.0 38.0 85-89 36.00605 38.0 37.0 38.0 32.8 38.0 90-94 35.74245 38.0 37.0 38.0 31.0 38.0 95-99 35.542199999999994 38.0 36.0 38.0 29.6 38.0 100-104 35.42125 38.0 36.0 38.0 29.4 38.0 105-109 35.32505 38.0 36.0 38.0 29.4 38.0 110-114 34.92985 38.0 35.4 38.0 27.6 38.0 115-119 34.500150000000005 38.0 34.8 38.0 25.2 38.0 120-124 34.2365 38.0 34.6 38.0 24.0 38.0 125-129 33.928 38.0 34.0 38.0 23.0 38.0 130-134 33.315000000000005 38.0 33.8 38.0 16.2 38.0 135-139 32.8296 37.8 33.0 38.0 15.0 38.0 140-144 32.31965 37.4 33.0 38.0 14.0 38.0 145-149 31.463700000000006 36.4 32.0 38.0 11.2 38.0 150-151 26.773875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 1.0 14 5.0 15 4.0 16 3.0 17 2.0 18 9.0 19 3.0 20 7.0 21 15.0 22 13.0 23 17.0 24 12.0 25 15.0 26 26.0 27 36.0 28 41.0 29 47.0 30 66.0 31 91.0 32 94.0 33 184.0 34 249.0 35 416.0 36 1017.0 37 1624.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.478957915831664 14.804609218436873 10.220440881763528 35.49599198396793 2 21.15 20.599999999999998 37.425000000000004 20.825 3 18.325 26.775 26.575 28.325 4 22.75 34.325 22.650000000000002 20.275000000000002 5 21.305326331582897 35.50887721930482 23.605901475368842 19.579894973743436 6 16.7 35.675000000000004 27.250000000000004 20.375 7 13.425 22.775000000000002 43.25 20.549999999999997 8 18.425 21.825 30.95 28.799999999999997 9 17.325 23.375 32.475 26.825 10-14 19.935 29.565 26.634999999999998 23.865 15-19 20.200000000000003 28.465 26.71 24.625 20-24 20.125 29.154999999999998 26.77 23.95 25-29 20.265 28.689999999999998 27.089999999999996 23.955000000000002 30-34 20.57 28.499999999999996 26.66 24.27 35-39 20.605 29.095 26.345000000000002 23.955000000000002 40-44 20.585 28.96 26.545 23.91 45-49 20.495 28.395 26.669999999999998 24.44 50-54 20.52 28.110000000000003 27.18 24.19 55-59 20.345 28.575 27.155 23.925 60-64 20.11 28.465 27.500000000000004 23.925 65-69 20.585 28.315 27.46 23.64 70-74 20.810000000000002 27.794999999999998 27.105 24.29 75-79 20.84 28.465 26.815 23.880000000000003 80-84 20.625 28.244999999999997 27.034999999999997 24.095 85-89 20.630000000000003 28.03 26.740000000000002 24.6 90-94 20.804125776086522 28.169437212096938 27.062888043260564 23.96354896855598 95-99 20.28223990391833 28.16393934844618 27.523394885652802 24.030425861982685 100-104 20.64 28.265 26.884999999999998 24.21 105-109 20.595 28.525 26.695 24.185000000000002 110-114 21.45 28.655 26.555 23.34 115-119 21.102110211021103 28.102810281028102 27.34773477347735 23.447344734473447 120-124 21.74608730436522 28.111405570278514 26.45632281614081 23.68618430921546 125-129 21.145 28.084999999999997 26.765 24.005000000000003 130-134 22.05551387846962 27.976994248562143 26.346586646661663 23.620905226306576 135-139 21.564704116852585 28.547846530938926 25.41143514581562 24.476014206392875 140-144 21.82 27.994999999999997 25.895000000000003 24.29 145-149 21.58 28.055000000000003 26.075 24.29 150-151 21.990248781097637 28.178522315289413 26.20327540942618 23.627953494186773 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 5.5 26 5.0 27 4.5 28 10.0 29 16.5 30 20.0 31 24.0 32 26.0 33 37.0 34 51.5 35 66.0 36 81.5 37 99.5 38 129.0 39 156.5 40 175.5 41 202.0 42 234.0 43 252.0 44 259.5 45 265.0 46 259.5 47 239.0 48 228.5 49 213.0 50 183.5 51 158.0 52 126.5 53 98.0 54 79.5 55 58.5 56 43.5 57 39.5 58 28.5 59 22.0 60 19.5 61 16.0 62 16.0 63 10.5 64 7.0 65 7.0 66 4.5 67 5.0 68 5.0 69 1.0 70 1.0 71 0.5 72 0.5 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.13999999999999999 95-99 0.08499999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.005 125-129 0.0 130-134 0.025 135-139 0.045 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98657208006081 97.675 2 0.8107423359513555 1.6 3 0.10134279199391943 0.3 4 0.07600709399543958 0.3 5 0.02533569799847986 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5125 0.025 0.0 0.0 0.0 96-97 0.6875 0.025 0.0 0.0 0.0 98-99 0.7625 0.025 0.0 0.0 0.0 100-101 0.9375 0.025 0.0 0.0 0.0 102-103 1.1 0.025 0.0 0.0 0.0 104-105 1.2875 0.025 0.0 0.0 0.0 106-107 1.5375 0.025 0.0 0.0 0.0 108-109 1.7875 0.025 0.0 0.0 0.0 110-111 2.0625 0.025 0.0 0.0 0.0 112-113 2.2625 0.025 0.0 0.0 0.0 114-115 2.6875 0.025 0.0 0.0 0.0 116-117 3.0125 0.025 0.0 0.0 0.0 118-119 3.2875 0.025 0.0 0.0 0.0 120-121 3.525 0.025 0.0 0.0 0.0 122-123 3.9375 0.025 0.0 0.0 0.0 124-125 4.45 0.025 0.0 0.0 0.0 126-127 5.15 0.025 0.0 0.0 0.0 128-129 5.7875 0.025 0.0 0.0 0.0 130-131 6.175 0.025 0.0 0.0 0.0 132-133 6.7125 0.025 0.0 0.0 0.0 134-135 7.1875 0.025 0.0 0.0 0.0 136-137 7.725 0.025 0.0 0.0 0.0 138-139 8.3625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGAA 10 0.006832588 144.9875 5 >>END_MODULE SRR7170187 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170187_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67175 33.0 33.0 34.0 32.0 34.0 2 32.75 33.0 33.0 34.0 32.0 34.0 3 32.5655 33.0 33.0 34.0 32.0 34.0 4 32.279 34.0 33.0 34.0 32.0 34.0 5 32.37175 34.0 33.0 34.0 32.0 34.0 6 36.49575 38.0 38.0 38.0 35.0 38.0 7 36.652 38.0 38.0 38.0 36.0 38.0 8 36.62975 38.0 38.0 38.0 36.0 38.0 9 36.59175 38.0 38.0 38.0 36.0 38.0 10-14 36.3917 38.0 38.0 38.0 35.2 38.0 15-19 36.194849999999995 38.0 38.0 38.0 35.0 38.0 20-24 36.2578 38.0 38.0 38.0 35.0 38.0 25-29 36.335249999999995 38.0 38.0 38.0 35.2 38.0 30-34 36.3442 38.0 38.0 38.0 35.0 38.0 35-39 36.1631 38.0 38.0 38.0 34.6 38.0 40-44 35.916399999999996 38.0 38.0 38.0 34.0 38.0 45-49 35.92315 38.0 38.0 38.0 34.0 38.0 50-54 36.244 38.0 38.0 38.0 34.4 38.0 55-59 36.163599999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.092650000000006 38.0 38.0 38.0 34.2 38.0 65-69 36.11 38.0 38.0 38.0 34.0 38.0 70-74 36.0342 38.0 38.0 38.0 33.6 38.0 75-79 35.9045 38.0 38.0 38.0 33.4 38.0 80-84 35.84085 38.0 38.0 38.0 33.2 38.0 85-89 35.134949999999996 38.0 37.8 38.0 29.4 38.0 90-94 34.87429999999999 38.0 37.0 38.0 28.2 38.0 95-99 35.345200000000006 38.0 37.0 38.0 29.4 38.0 100-104 35.312650000000005 38.0 37.0 38.0 30.2 38.0 105-109 35.2193 38.0 37.0 38.0 29.4 38.0 110-114 34.984500000000004 38.0 37.0 38.0 28.0 38.0 115-119 34.72665 38.0 36.2 38.0 27.2 38.0 120-124 34.527300000000004 38.0 36.0 38.0 25.8 38.0 125-129 33.81735 38.0 35.2 38.0 19.8 38.0 130-134 32.41575 38.0 34.0 38.0 11.2 38.0 135-139 31.259300000000003 38.0 33.0 38.0 2.0 38.0 140-144 30.352650000000004 38.0 31.0 38.0 2.0 38.0 145-149 29.7933 37.6 30.0 38.0 2.0 38.0 150-151 25.941375 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 13.0 4 5.0 5 1.0 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 8.0 15 9.0 16 6.0 17 9.0 18 15.0 19 8.0 20 16.0 21 18.0 22 14.0 23 18.0 24 30.0 25 36.0 26 31.0 27 48.0 28 43.0 29 58.0 30 60.0 31 101.0 32 120.0 33 159.0 34 139.0 35 228.0 36 567.0 37 2185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.05310621242485 16.90881763527054 13.527054108216433 30.511022044088175 2 23.657802308078274 25.087807325639737 34.89713998996488 16.357250376317108 3 21.27659574468085 27.228976697061803 31.0790273556231 20.415400202634245 4 24.637312293204378 34.20717739882922 22.143038941206413 19.01247136675999 5 25.273328248156623 35.11314518179507 20.59496567505721 19.0185608949911 6 19.174265450861196 35.916919959473155 24.493414387031407 20.415400202634245 7 18.544719555330975 18.873168266801414 42.1677614957049 20.414350682162706 8 22.47983870967742 21.673387096774192 27.268145161290324 28.578629032258064 9 22.69414425735109 24.05126916310631 28.424227192762004 24.8303593867806 10-14 23.600936100936103 28.123728123728124 25.605413105413106 22.66992266992267 15-19 22.972006538618718 27.753371475275845 27.53371475275848 21.740907233346956 20-24 23.72062264726829 27.663037948926643 27.43921049954217 21.177128904262897 25-29 23.187744128240247 27.35250849693096 27.570638664840462 21.889108709988335 30-34 22.75932031448136 27.501902104996194 27.720010144559982 22.018767435962467 35-39 23.35591666242168 27.904844378788653 27.26809637817737 21.471142580612295 40-44 23.589743589743588 27.61025641025641 27.374358974358977 21.425641025641028 45-49 23.452685421994886 27.647058823529413 27.601023017902815 21.29923273657289 50-54 23.863521312139312 28.07532651614863 27.07806013971854 20.983092031993518 55-59 23.648443046962168 27.249213916218686 27.969368090069985 21.132974946749165 60-64 23.96156388225126 27.037470130662467 27.657735522904066 21.343230464182216 65-69 23.58904524133757 27.149846169365006 27.70968880819085 21.55141978110657 70-74 23.76386727573917 27.127152251393 27.604035941970785 21.504944530897045 75-79 23.374667402982077 27.215221647673076 28.27953210502535 21.130578844319494 80-84 23.600444624090542 27.501010509296687 27.864793856103475 21.033751010509295 85-89 24.181724315952504 26.97470314919979 27.96076406814662 20.882808466701082 90-94 23.756334677836385 27.676078188023578 28.032888613093395 20.534698521046643 95-99 24.26496634785689 26.78508172663327 27.787055310966046 21.1628966145438 100-104 23.78021090872395 27.216307583631867 27.352540491447602 21.65094101619658 105-109 24.426362074193875 26.923076923076923 28.029920145557462 20.620640857171736 110-114 24.205687730464213 27.680961761883115 27.610243976360056 20.50310653129262 115-119 24.784819046660292 27.271354507474705 27.31162228821664 20.632204157648363 120-124 24.64771074670277 27.66661651873025 26.648613409558198 21.037059325008777 125-129 24.605807011277236 27.6879114150125 26.810226055008417 20.896055518701843 130-134 24.969632954845526 27.478214945867443 26.902561394243463 20.64959070504357 135-139 25.499240286520514 27.83807249837204 26.410896461905796 20.251790753201647 140-144 25.047968861356285 27.71777863055754 26.54459733567239 20.689655172413794 145-149 25.404048328887498 27.653119933050892 27.161462419582616 19.781369318479 150-151 26.73406705912465 26.567699001791656 27.066803173790632 19.631430765293064 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 5.0 2 4.0 3 1.0 4 2.0 5 4.0 6 3.5 7 3.0 8 3.5 9 3.0 10 3.0 11 4.5 12 3.5 13 1.5 14 0.5 15 0.0 16 1.5 17 3.5 18 3.0 19 1.0 20 1.5 21 3.0 22 4.0 23 3.0 24 1.0 25 1.5 26 7.0 27 8.0 28 4.5 29 5.5 30 9.0 31 12.0 32 20.5 33 30.0 34 41.0 35 56.0 36 71.0 37 100.5 38 133.5 39 157.0 40 190.0 41 204.5 42 218.0 43 247.0 44 256.0 45 256.5 46 262.5 47 256.5 48 247.0 49 217.0 50 173.0 51 148.0 52 124.5 53 103.0 54 76.5 55 59.5 56 45.0 57 34.5 58 29.0 59 20.5 60 20.0 61 21.5 62 19.5 63 14.0 64 7.0 65 3.5 66 2.5 67 2.0 68 2.0 69 3.0 70 3.5 71 3.5 72 2.5 73 1.5 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.35000000000000003 3 1.3 4 1.775 5 1.675 6 1.3 7 1.05 8 0.8 9 0.525 10-14 1.72 15-19 2.12 20-24 1.71 25-29 1.435 30-34 1.425 35-39 1.8450000000000002 40-44 2.5 45-49 2.25 50-54 1.23 55-59 1.41 60-64 1.6549999999999998 65-69 0.865 70-74 0.395 75-79 0.40499999999999997 80-84 1.04 85-89 3.15 90-94 3.3099999999999996 95-99 1.195 100-104 0.905 105-109 1.0699999999999998 110-114 1.015 115-119 0.6649999999999999 120-124 0.295 125-129 2.015 130-134 5.325 135-139 7.86 140-144 8.795 145-149 4.405 150-151 2.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8852292880669 97.575 2 0.9120851279452749 1.7999999999999998 3 0.177349885989359 0.525 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.824999999999999 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.612500000000001 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935526 spots for SRR7170187.sra Written 935526 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra Read 935523 spots for SRR7170187.sra Written 935523 spots for SRR7170187.sra SRR ids: ['SRR7170187.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o0iwzkst SRR7170187.sra spots: 18710463 blocks: [[1, 935523], [935524, 1871046], [1871047, 2806569], [2806570, 3742092], [3742093, 4677615], [4677616, 5613138], [5613139, 6548661], [6548662, 7484184], [7484185, 8419707], [8419708, 9355230], [9355231, 10290753], [10290754, 11226276], [11226277, 12161799], [12161800, 13097322], [13097323, 14032845], [14032846, 14968368], [14968369, 15903891], [15903892, 16839414], [16839415, 17774937], [17774938, 18710463]] SRR7170187 file size 6318661 SRR7170187 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170187 SRR7170187_1.fastq SRR7170187_2.fastq Input file: SRR7170187_1.fastq Paired file: SRR7170187_2.fastq trimmed: SRR7170187-trimmed-pair1.fastq, SRR7170187-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:50:27 2025 >> started Wed Feb 12 17:50:48 2025 >> done (21.847s) 18710463 read pairs processed; of these: 27013 ( 0.14%) short read pairs filtered out after trimming by size control 30008 ( 0.16%) empty read pairs filtered out after trimming by size control 18653442 (99.70%) read pairs available; of these: 10529302 (56.45%) trimmed read pairs available after processing 8124140 (43.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 0 0.00% 21 13 0.00% 22 6 0.00% 23 4 0.00% 24 9 0.00% 25 15 0.00% 26 8 0.00% 27 5 0.00% 28 8 0.00% 29 5 0.00% 30 13 0.00% 31 9 0.00% 32 12 0.00% 33 10 0.00% 34 15 0.00% 35 19 0.00% 36 22 0.00% 37 24 0.00% 38 27 0.00% 39 42 0.00% 40 38 0.00% 41 34 0.00% 42 48 0.00% 43 42 0.00% 44 67 0.00% 45 58 0.00% 46 76 0.00% 47 91 0.00% 48 84 0.00% 49 122 0.00% 50 120 0.00% 51 147 0.00% 52 148 0.00% 53 186 0.00% 54 219 0.00% 55 213 0.00% 56 254 0.00% 57 264 0.00% 58 295 0.00% 59 390 0.00% 60 455 0.00% 61 529 0.00% 62 555 0.00% 63 659 0.00% 64 719 0.00% 65 802 0.00% 66 904 0.00% 67 1004 0.01% 68 1149 0.01% 69 1410 0.01% 70 1601 0.01% 71 1661 0.01% 72 1960 0.01% 73 2205 0.01% 74 2456 0.01% 75 2718 0.01% 76 2877 0.02% 77 3254 0.02% 78 3590 0.02% 79 4073 0.02% 80 4564 0.02% 81 5299 0.03% 82 6091 0.03% 83 6864 0.04% 84 8454 0.05% 85 9642 0.05% 86 10016 0.05% 87 10158 0.05% 88 10938 0.06% 89 11525 0.06% 90 12457 0.07% 91 13854 0.07% 92 15089 0.08% 93 16466 0.09% 94 17850 0.10% 95 18724 0.10% 96 19458 0.10% 97 20341 0.11% 98 21036 0.11% 99 22321 0.12% 100 23389 0.13% 101 24630 0.13% 102 26710 0.14% 103 28834 0.15% 104 30364 0.16% 105 32065 0.17% 106 33010 0.18% 107 33418 0.18% 108 35012 0.19% 109 35407 0.19% 110 36933 0.20% 111 38945 0.21% 112 41172 0.22% 113 43459 0.23% 114 45342 0.24% 115 47656 0.26% 116 48364 0.26% 117 49944 0.27% 118 50779 0.27% 119 51860 0.28% 120 53872 0.29% 121 56290 0.30% 122 58974 0.32% 123 62276 0.33% 124 65528 0.35% 125 67926 0.36% 126 70528 0.38% 127 72828 0.39% 128 75027 0.40% 129 76559 0.41% 130 79766 0.43% 131 82574 0.44% 132 87602 0.47% 133 93219 0.50% 134 98572 0.53% 135 104745 0.56% 136 110560 0.59% 137 117539 0.63% 138 126087 0.68% 139 134192 0.72% 140 142086 0.76% 141 155273 0.83% 142 168241 0.90% 143 185883 1.00% 144 212333 1.14% 145 248503 1.33% 146 303789 1.63% 147 398504 2.14% 148 579285 3.11% 149 1074296 5.76% 150 4310254 23.11% 151 8124140 43.55% 18653442 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=44 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=253.80 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=22 prefix-density=0.38 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=64.39 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=15.1 sequence=TGTTGGTGGTGG SRR7170187 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:51:31 Started mapping on | Feb 12 17:51:31 Finished on | Feb 12 17:53:27 Mapping speed, Million of reads per hour | 578.90 Number of input reads | 18653442 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16867819 Uniquely mapped reads % | 90.43% Average mapped length | 290.58 Number of splices: Total | 16124870 Number of splices: Annotated (sjdb) | 15866647 Number of splices: GT/AG | 15887862 Number of splices: GC/AG | 191947 Number of splices: AT/AC | 12903 Number of splices: Non-canonical | 32158 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361682 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 875733 % of reads mapped to too many loci | 4.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1441670 1441670 1441670 N_multimapping 361682 361682 361682 N_noFeature 387277 16702451 463138 N_ambiguous 153236 1288 62684 UnstrandedReadsAssigned:16327306 PositiveStrandReadsAssigned:164080 NegativeStrandReadsAssigned:16341997 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170187 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170187-trimmed-pair1.fastq SRR7170187-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,653,442 reads, 16,839,312 reads pseudoaligned [quant] estimated average fragment length: 228.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7170187.ke.tsv 34699 SRR7170187.se.tsv 87100 total ==> SRR7170187.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.02 343 11.2356 Potri.005G024800.1.v4.1 1035 807.019 54 3.92345 Potri.004G059700.1.v4.1 961 733.072 2 0.159971 Potri.007G009000.2.v4.1 1416 1188.02 0 0 Potri.003G141000.2.v4.1 2943 2715.02 344.129 7.43202 Potri.016G087400.1.v4.1 270 87.9738 2016 1343.68 Potri.015G069301.1.v4.1 564 341.348 0 0 Potri.010G195200.1.v4.1 1773 1545.02 22 0.834924 Potri.012G127500.1.v4.1 977 749.046 5803 454.258 ==> SRR7170187.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 859 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170187 completed mapping pipeline successfully