Starting /dee2/code/volunteer_pipeline.sh SRR7170188 current disk space = 3051710492672 free memory = 1505757148 SRR7170188 SRAfilesize 71cd90ea2dc012348edd7dfbf80d271b SRR7170188.sra SRR7170188.sra file validated SRR7170188 is paired end SRR7170188 is conventional basespace SRR7170188 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170188_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.349 34.0 33.0 34.0 33.0 34.0 2 33.46175 34.0 34.0 34.0 33.0 34.0 3 33.498 34.0 34.0 34.0 33.0 34.0 4 33.48175 34.0 34.0 34.0 33.0 34.0 5 33.43425 34.0 34.0 34.0 33.0 34.0 6 37.0515 38.0 37.0 38.0 36.0 38.0 7 37.379 38.0 38.0 38.0 37.0 38.0 8 37.37975 38.0 38.0 38.0 37.0 38.0 9 37.415 38.0 38.0 38.0 37.0 38.0 10-14 37.41930000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.47005 38.0 38.0 38.0 37.0 38.0 20-24 37.4374 38.0 38.0 38.0 37.0 38.0 25-29 37.38485 38.0 38.0 38.0 37.0 38.0 30-34 37.26035 38.0 38.0 38.0 37.0 38.0 35-39 37.1976 38.0 38.0 38.0 36.4 38.0 40-44 36.90605 38.0 38.0 38.0 35.4 38.0 45-49 36.7735 38.0 38.0 38.0 34.8 38.0 50-54 36.65644999999999 38.0 38.0 38.0 34.4 38.0 55-59 36.60335 38.0 38.0 38.0 34.0 38.0 60-64 36.4576 38.0 38.0 38.0 34.0 38.0 65-69 36.4171 38.0 37.4 38.0 33.8 38.0 70-74 36.40395 38.0 37.8 38.0 33.8 38.0 75-79 36.242850000000004 38.0 37.0 38.0 33.4 38.0 80-84 36.07395 38.0 37.0 38.0 32.6 38.0 85-89 35.94134999999999 38.0 37.0 38.0 31.8 38.0 90-94 35.79315 38.0 37.0 38.0 31.2 38.0 95-99 35.56445 38.0 36.0 38.0 30.2 38.0 100-104 35.36035 38.0 36.0 38.0 29.0 38.0 105-109 35.1975 38.0 36.0 38.0 29.0 38.0 110-114 34.927800000000005 38.0 35.4 38.0 27.6 38.0 115-119 34.41674999999999 38.0 34.4 38.0 24.8 38.0 120-124 34.005849999999995 38.0 34.0 38.0 23.0 38.0 125-129 33.6582 38.0 34.0 38.0 19.0 38.0 130-134 33.249900000000004 38.0 33.6 38.0 16.2 38.0 135-139 32.5543 37.2 32.4 38.0 14.8 38.0 140-144 32.007349999999995 36.2 31.6 38.0 14.0 38.0 145-149 30.90675 36.0 31.0 38.0 8.8 38.0 150-151 26.496 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 3.0 14 2.0 15 3.0 16 5.0 17 2.0 18 4.0 19 7.0 20 3.0 21 9.0 22 11.0 23 13.0 24 20.0 25 28.0 26 35.0 27 40.0 28 45.0 29 54.0 30 66.0 31 81.0 32 128.0 33 166.0 34 267.0 35 442.0 36 954.0 37 1610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324554803110104 14.37170805116629 12.56583897667419 34.73789816904941 2 21.675 20.375 35.725 22.225 3 19.325 27.450000000000003 26.125 27.1 4 23.549999999999997 33.025 22.400000000000002 21.025 5 21.15 35.825 23.150000000000002 19.875 6 17.025000000000002 37.025000000000006 25.7 20.25 7 14.05 22.55 44.425 18.975 8 18.8 22.275 29.675 29.25 9 17.5 23.3 32.05 27.150000000000002 10-14 20.04 29.62 26.91 23.43 15-19 20.105 28.194999999999997 28.03 23.669999999999998 20-24 20.14 28.73 27.46 23.669999999999998 25-29 20.0 28.74 27.665 23.595 30-34 20.25 28.68 26.995 24.075 35-39 20.200000000000003 28.999999999999996 26.965 23.835 40-44 20.23 28.685 27.134999999999998 23.95 45-49 20.19 29.04 26.605 24.165 50-54 20.04 29.104999999999997 26.93 23.925 55-59 20.125 28.555000000000003 27.165 24.154999999999998 60-64 20.52 28.705000000000002 26.790000000000003 23.985 65-69 20.294999999999998 28.939999999999998 27.089999999999996 23.674999999999997 70-74 20.575 29.115000000000002 26.810000000000002 23.5 75-79 20.1 28.565 27.560000000000002 23.775 80-84 20.424999999999997 28.365000000000002 27.400000000000002 23.810000000000002 85-89 20.46 28.09 27.560000000000002 23.89 90-94 20.385 28.12 27.894999999999996 23.599999999999998 95-99 20.4 28.585 27.375 23.64 100-104 20.525 28.1 27.02 24.355 105-109 20.424999999999997 28.634999999999998 27.02 23.919999999999998 110-114 21.135 28.395 27.32 23.150000000000002 115-119 20.830000000000002 28.544999999999998 26.945000000000004 23.68 120-124 20.745 28.255000000000003 26.995 24.005000000000003 125-129 20.595 28.09 27.255000000000003 24.060000000000002 130-134 20.755000000000003 29.085 26.445 23.715 135-139 20.605 28.660000000000004 27.465 23.27 140-144 20.645 28.255000000000003 26.99 24.11 145-149 20.375 28.64 27.77 23.215 150-151 21.467866966741685 27.206801700425103 27.319329832458116 24.006001500375092 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 2.5 24 2.5 25 2.0 26 3.0 27 7.0 28 10.5 29 13.0 30 19.0 31 23.0 32 32.5 33 41.0 34 47.0 35 63.0 36 77.0 37 93.5 38 120.5 39 151.0 40 185.5 41 231.0 42 267.5 43 255.5 44 255.0 45 276.0 46 268.5 47 262.0 48 241.5 49 219.0 50 187.0 51 146.0 52 120.0 53 98.5 54 83.0 55 59.0 56 36.0 57 23.5 58 16.0 59 14.0 60 13.0 61 7.5 62 3.5 63 2.5 64 2.5 65 3.0 66 2.5 67 2.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.6624999999999996 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.45 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 4.9875 0.0 0.0 0.0 0.0 136-137 5.4375 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTTT 10 0.006830828 145.0 145 >>END_MODULE SRR7170188 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170188_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83075 33.0 33.0 34.0 32.0 34.0 2 32.8655 33.0 33.0 34.0 32.0 34.0 3 32.72625 34.0 33.0 34.0 32.0 34.0 4 32.2775 34.0 33.0 34.0 32.0 34.0 5 32.3285 34.0 33.0 34.0 32.0 34.0 6 36.767 38.0 38.0 38.0 35.0 38.0 7 36.85025 38.0 38.0 38.0 36.0 38.0 8 36.912 38.0 38.0 38.0 36.0 38.0 9 36.9665 38.0 38.0 38.0 36.0 38.0 10-14 36.891450000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.70585 38.0 38.0 38.0 36.0 38.0 20-24 36.708299999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.7923 38.0 38.0 38.0 36.0 38.0 30-34 36.84135 38.0 38.0 38.0 36.0 38.0 35-39 36.687 38.0 38.0 38.0 36.0 38.0 40-44 36.54705 38.0 38.0 38.0 35.6 38.0 45-49 36.49300000000001 38.0 38.0 38.0 34.8 38.0 50-54 36.646 38.0 38.0 38.0 35.6 38.0 55-59 36.5541 38.0 38.0 38.0 35.0 38.0 60-64 36.48665 38.0 38.0 38.0 34.6 38.0 65-69 36.435649999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.455850000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.288399999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.19175 38.0 38.0 38.0 33.8 38.0 85-89 35.807599999999994 38.0 37.8 38.0 32.8 38.0 90-94 35.4679 38.0 38.0 38.0 30.4 38.0 95-99 35.75295 38.0 37.2 38.0 31.4 38.0 100-104 35.65785 38.0 37.4 38.0 31.4 38.0 105-109 35.44985 38.0 37.0 38.0 30.8 38.0 110-114 35.3317 38.0 37.0 38.0 29.8 38.0 115-119 35.05625 38.0 36.4 38.0 28.0 38.0 120-124 34.782250000000005 38.0 36.0 38.0 27.2 38.0 125-129 34.23025 38.0 35.2 38.0 23.4 38.0 130-134 33.01815 38.0 34.8 38.0 15.4 38.0 135-139 31.4514 38.0 33.2 38.0 4.2 38.0 140-144 30.88765 38.0 32.6 38.0 2.0 38.0 145-149 30.039299999999997 38.0 31.0 38.0 2.0 38.0 150-151 26.17875 34.5 15.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 1.0 6 1.0 7 4.0 8 2.0 9 2.0 10 5.0 11 2.0 12 6.0 13 5.0 14 8.0 15 3.0 16 5.0 17 12.0 18 5.0 19 7.0 20 10.0 21 9.0 22 18.0 23 23.0 24 29.0 25 28.0 26 27.0 27 42.0 28 45.0 29 49.0 30 77.0 31 89.0 32 151.0 33 158.0 34 160.0 35 254.0 36 533.0 37 2214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.312312312312315 18.193193193193196 16.116116116116117 28.37837837837838 2 25.60700876095119 24.53066332916145 32.365456821026285 17.496871088861077 3 19.722921914357684 27.506297229219147 31.33501259445844 21.435768261964736 4 24.230083990837365 35.174344616950876 21.634003563247646 18.961567828964114 5 23.25050709939148 36.1815415821501 22.337728194726168 18.23022312373225 6 19.525000000000002 37.025000000000006 24.275 19.175 7 18.5 17.525 42.075 21.9 8 19.875 23.3 27.675 29.15 9 21.0 25.3 28.275 25.424999999999997 10-14 22.9602562819101 28.326158774652114 26.63930323355691 22.074281709880868 15-19 22.677252399376915 28.380483392794332 28.04884176674539 20.893422441083363 20-24 22.78715623904223 28.838350949256125 27.445774683163854 20.928718128537795 25-29 22.955000000000002 27.915 27.83 21.3 30-34 23.375 27.99 27.52 21.115000000000002 35-39 22.837092731829575 27.533834586466167 27.939849624060148 21.68922305764411 40-44 22.959388821873745 27.683956574185764 28.181544028950544 21.175110574989947 45-49 22.96415302741239 27.87930515111959 27.95963450145597 21.19690732001205 50-54 23.184273709483794 27.981192476990795 27.951180472188874 20.883353341336537 55-59 23.130034522439587 27.557912643218092 28.508530544854153 20.803522289488168 60-64 22.673138510808645 28.502802241793436 27.892313851080864 20.93174539631705 65-69 23.69803391865526 27.550152583921157 28.375606583620993 20.37620691380259 70-74 23.745 27.834999999999997 27.83 20.59 75-79 23.35 27.345000000000002 28.13 21.175 80-84 23.325000000000003 27.74 27.725 21.21 85-89 23.294853052376872 28.361143318042043 27.529364319201495 20.814639310379594 90-94 23.429498554986562 27.88622420524261 28.007909547229122 20.676367692541703 95-99 23.94 27.665 28.115000000000002 20.28 100-104 24.025 27.735 27.834999999999997 20.405 105-109 23.835 27.694999999999997 27.58 20.89 110-114 23.799999999999997 27.125 28.37 20.705000000000002 115-119 24.15 27.97 27.505000000000003 20.375 120-124 24.345 27.944999999999997 27.345000000000002 20.365 125-129 23.93617021276596 27.569249297470893 27.960658370132478 20.53392211963067 130-134 25.202072538860104 27.37305699481865 27.575129533678755 19.849740932642487 135-139 24.367816091954023 27.34562951082598 27.805399625768512 20.481154771451486 140-144 24.662948724890356 28.079484541664414 27.54345118847799 19.714115544967242 145-149 24.99103988531053 28.006758486508627 27.18754800061441 19.814653627566432 150-151 24.594900138173596 28.5265670141942 26.46652430599171 20.412008541640496 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 3.0 26 2.5 27 3.5 28 8.0 29 12.5 30 10.5 31 16.5 32 23.5 33 38.0 34 46.0 35 50.0 36 76.0 37 110.0 38 140.0 39 168.0 40 197.5 41 220.5 42 244.0 43 267.5 44 294.5 45 285.5 46 273.0 47 272.0 48 247.5 49 218.5 50 177.0 51 142.0 52 118.0 53 94.5 54 66.5 55 43.5 56 30.5 57 27.0 58 21.5 59 10.0 60 10.0 61 10.0 62 5.5 63 2.5 64 2.0 65 1.5 66 2.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.125 3 0.75 4 1.775 5 1.4000000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.11 15-19 0.49500000000000005 20-24 0.185 25-29 0.0 30-34 0.0 35-39 0.25 40-44 0.52 45-49 0.41000000000000003 50-54 0.04 55-59 0.065 60-64 0.08 65-69 0.055 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.815 90-94 1.385 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.36 130-134 3.5000000000000004 135-139 6.4750000000000005 140-144 7.655000000000001 145-149 2.3449999999999998 150-151 0.4875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 3.9250000000000003 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.574999999999999 0.0 0.0 0.0 0.0 134-135 4.824999999999999 0.0 0.0 0.0 0.0 136-137 5.2625 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983895 spots for SRR7170188.sra Written 983895 spots for SRR7170188.sra Read 983904 spots for SRR7170188.sra Written 983904 spots for SRR7170188.sra SRR ids: ['SRR7170188.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6q4swivq SRR7170188.sra spots: 19677909 blocks: [[1, 983895], [983896, 1967790], [1967791, 2951685], [2951686, 3935580], [3935581, 4919475], [4919476, 5903370], [5903371, 6887265], [6887266, 7871160], [7871161, 8855055], [8855056, 9838950], [9838951, 10822845], [10822846, 11806740], [11806741, 12790635], [12790636, 13774530], [13774531, 14758425], [14758426, 15742320], [15742321, 16726215], [16726216, 17710110], [17710111, 18694005], [18694006, 19677909]] SRR7170188 file size 6646497 SRR7170188 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170188 SRR7170188_1.fastq SRR7170188_2.fastq Input file: SRR7170188_1.fastq Paired file: SRR7170188_2.fastq trimmed: SRR7170188-trimmed-pair1.fastq, SRR7170188-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:44:58 2025 >> started Wed Feb 12 17:45:23 2025 >> done (24.722s) 19677909 read pairs processed; of these: 33218 ( 0.17%) short read pairs filtered out after trimming by size control 34374 ( 0.17%) empty read pairs filtered out after trimming by size control 19610317 (99.66%) read pairs available; of these: 10710489 (54.62%) trimmed read pairs available after processing 8899828 (45.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 8 0.00% 24 1 0.00% 25 3 0.00% 26 11 0.00% 27 8 0.00% 28 6 0.00% 29 6 0.00% 30 12 0.00% 31 6 0.00% 32 11 0.00% 33 7 0.00% 34 11 0.00% 35 21 0.00% 36 15 0.00% 37 28 0.00% 38 18 0.00% 39 25 0.00% 40 20 0.00% 41 37 0.00% 42 39 0.00% 43 53 0.00% 44 48 0.00% 45 51 0.00% 46 65 0.00% 47 80 0.00% 48 86 0.00% 49 99 0.00% 50 122 0.00% 51 121 0.00% 52 140 0.00% 53 174 0.00% 54 184 0.00% 55 199 0.00% 56 238 0.00% 57 244 0.00% 58 287 0.00% 59 345 0.00% 60 350 0.00% 61 434 0.00% 62 498 0.00% 63 559 0.00% 64 638 0.00% 65 694 0.00% 66 838 0.00% 67 1000 0.01% 68 1140 0.01% 69 1360 0.01% 70 1629 0.01% 71 1704 0.01% 72 1800 0.01% 73 1941 0.01% 74 2142 0.01% 75 2433 0.01% 76 2613 0.01% 77 2859 0.01% 78 3328 0.02% 79 3762 0.02% 80 4082 0.02% 81 4760 0.02% 82 5356 0.03% 83 6159 0.03% 84 7464 0.04% 85 8390 0.04% 86 8966 0.05% 87 9412 0.05% 88 9890 0.05% 89 10531 0.05% 90 11283 0.06% 91 12182 0.06% 92 12929 0.07% 93 13991 0.07% 94 14865 0.08% 95 15652 0.08% 96 16253 0.08% 97 17127 0.09% 98 17815 0.09% 99 18915 0.10% 100 19715 0.10% 101 20513 0.10% 102 21890 0.11% 103 23163 0.12% 104 24433 0.12% 105 26099 0.13% 106 26358 0.13% 107 27616 0.14% 108 28826 0.15% 109 28923 0.15% 110 30343 0.15% 111 31654 0.16% 112 33498 0.17% 113 34887 0.18% 114 36648 0.19% 115 37912 0.19% 116 39320 0.20% 117 40634 0.21% 118 41494 0.21% 119 43282 0.22% 120 44827 0.23% 121 46990 0.24% 122 49252 0.25% 123 51751 0.26% 124 54374 0.28% 125 56666 0.29% 126 59246 0.30% 127 62055 0.32% 128 64356 0.33% 129 67090 0.34% 130 70124 0.36% 131 73810 0.38% 132 78633 0.40% 133 83918 0.43% 134 89645 0.46% 135 95065 0.48% 136 102326 0.52% 137 108884 0.56% 138 119072 0.61% 139 129185 0.66% 140 141108 0.72% 141 152534 0.78% 142 170934 0.87% 143 189525 0.97% 144 217326 1.11% 145 256827 1.31% 146 314484 1.60% 147 417246 2.13% 148 620601 3.16% 149 1176749 6.00% 150 4668088 23.80% 151 8899828 45.38% 19610317 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.16 sequence-density-rank=5 fanout-score=74.20 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=17.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=42 fanout-score=128.64 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=13.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170188 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:46:13 Started mapping on | Feb 12 17:46:14 Finished on | Feb 12 17:48:32 Mapping speed, Million of reads per hour | 511.57 Number of input reads | 19610317 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18526844 Uniquely mapped reads % | 94.47% Average mapped length | 292.12 Number of splices: Total | 17243028 Number of splices: Annotated (sjdb) | 16956500 Number of splices: GT/AG | 16998714 Number of splices: GC/AG | 194514 Number of splices: AT/AC | 13497 Number of splices: Non-canonical | 36303 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356888 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 37207 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 752711 752711 752711 N_multimapping 356888 356888 356888 N_noFeature 453124 18318726 542378 N_ambiguous 192436 1472 72470 UnstrandedReadsAssigned:17881284 PositiveStrandReadsAssigned:206646 NegativeStrandReadsAssigned:17911996 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170188 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170188-trimmed-pair1.fastq SRR7170188-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,610,317 reads, 17,806,868 reads pseudoaligned [quant] estimated average fragment length: 250.575 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7170188.ke.tsv 34699 SRR7170188.se.tsv 87100 total ==> SRR7170188.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.43 376.497 12.394 Potri.005G024800.1.v4.1 1035 785.425 19 1.40827 Potri.004G059700.1.v4.1 961 711.49 0 0 Potri.007G009000.2.v4.1 1416 1166.43 0 0 Potri.003G141000.2.v4.1 2943 2693.43 444.128 9.59931 Potri.016G087400.1.v4.1 270 82.1486 1573.33 1114.96 Potri.015G069301.1.v4.1 564 322.941 0 0 Potri.010G195200.1.v4.1 1773 1523.43 15 0.573201 Potri.012G127500.1.v4.1 977 727.465 4473 357.951 ==> SRR7170188.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1554 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170188 completed mapping pipeline successfully