Starting /dee2/code/volunteer_pipeline.sh SRR7170189 current disk space = 3051667685376 free memory = 990825444 SRR7170189 SRAfilesize 8117994d9e7b3b92e2a3df6dc019bc2a SRR7170189.sra SRR7170189.sra file validated SRR7170189 is paired end SRR7170189 is conventional basespace SRR7170189 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3465 34.0 33.0 34.0 33.0 34.0 2 33.41375 34.0 33.0 34.0 33.0 34.0 3 33.46125 34.0 34.0 34.0 33.0 34.0 4 33.418 34.0 34.0 34.0 33.0 34.0 5 33.425 34.0 34.0 34.0 33.0 34.0 6 37.02725 38.0 37.0 38.0 36.0 38.0 7 37.3055 38.0 38.0 38.0 36.0 38.0 8 37.43525 38.0 38.0 38.0 37.0 38.0 9 37.414 38.0 38.0 38.0 37.0 38.0 10-14 37.43835 38.0 38.0 38.0 37.0 38.0 15-19 37.424 38.0 38.0 38.0 37.0 38.0 20-24 37.36645 38.0 38.0 38.0 37.0 38.0 25-29 37.2844 38.0 38.0 38.0 37.0 38.0 30-34 37.28175 38.0 38.0 38.0 37.0 38.0 35-39 37.22025 38.0 38.0 38.0 36.6 38.0 40-44 36.91605 38.0 38.0 38.0 35.4 38.0 45-49 36.75795 38.0 38.0 38.0 35.0 38.0 50-54 36.64765 38.0 38.0 38.0 34.4 38.0 55-59 36.5207 38.0 38.0 38.0 34.0 38.0 60-64 36.491 38.0 38.0 38.0 34.0 38.0 65-69 36.43755 38.0 37.8 38.0 33.8 38.0 70-74 36.32835 38.0 37.4 38.0 33.6 38.0 75-79 36.21695 38.0 37.0 38.0 33.0 38.0 80-84 36.08725 38.0 37.0 38.0 32.6 38.0 85-89 36.0149 38.0 37.0 38.0 31.8 38.0 90-94 35.724849999999996 38.0 36.6 38.0 30.6 38.0 95-99 35.57925 38.0 36.4 38.0 29.4 38.0 100-104 35.38635000000001 38.0 36.0 38.0 29.0 38.0 105-109 35.20845 38.0 36.0 38.0 28.6 38.0 110-114 34.98635 38.0 35.4 38.0 28.0 38.0 115-119 34.554649999999995 38.0 35.0 38.0 26.0 38.0 120-124 34.35945 38.0 34.8 38.0 24.4 38.0 125-129 33.95395 38.0 34.0 38.0 22.6 38.0 130-134 33.26145 38.0 33.8 38.0 16.2 38.0 135-139 32.88065 37.8 33.4 38.0 15.0 38.0 140-144 32.33345 38.0 33.0 38.0 14.2 38.0 145-149 31.459899999999998 36.8 32.6 38.0 11.2 38.0 150-151 26.377125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 3.0 15 4.0 16 2.0 17 3.0 18 8.0 19 3.0 20 5.0 21 7.0 22 13.0 23 17.0 24 25.0 25 18.0 26 34.0 27 41.0 28 48.0 29 45.0 30 68.0 31 102.0 32 91.0 33 153.0 34 265.0 35 403.0 36 932.0 37 1707.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.905358037055585 14.321482223335003 13.244867300951427 35.528292438657985 2 21.25 20.875 35.949999999999996 21.925 3 19.225 28.625 25.525 26.625 4 21.7 35.425000000000004 22.025 20.849999999999998 5 19.925 37.95 24.125 18.0 6 17.299999999999997 35.4 26.375 20.925 7 12.575 22.775000000000002 44.824999999999996 19.825 8 18.625 22.55 29.575000000000003 29.25 9 18.45 23.150000000000002 31.374999999999996 27.025 10-14 19.74 29.775000000000002 26.775 23.71 15-19 19.634999999999998 28.775000000000002 27.994999999999997 23.595 20-24 20.305 28.57 27.439999999999998 23.685000000000002 25-29 19.99 28.799999999999997 27.315 23.895 30-34 20.11 29.21 27.24 23.44 35-39 19.86 29.205 27.145000000000003 23.79 40-44 20.185 28.43 28.02 23.365 45-49 20.31 28.494999999999997 27.095000000000002 24.099999999999998 50-54 20.195 28.389999999999997 27.665 23.75 55-59 20.39 28.99 26.97 23.65 60-64 20.585 28.439999999999998 27.355 23.62 65-69 20.185 28.395 27.744999999999997 23.674999999999997 70-74 20.445 28.175 27.755000000000003 23.625 75-79 19.895 28.32 27.66 24.125 80-84 20.880000000000003 28.365000000000002 27.08 23.674999999999997 85-89 20.525 28.939999999999998 26.465 24.07 90-94 20.35154489458661 29.17021383143873 27.667885222094245 22.810356051880415 95-99 21.06474532172521 28.04463124186931 27.234063844691285 23.6565595917142 100-104 20.61 29.509999999999998 26.58 23.3 105-109 20.9 28.095 27.12 23.885 110-114 20.599999999999998 28.54 27.105 23.755000000000003 115-119 20.84 28.625 27.169999999999998 23.365 120-124 21.154999999999998 28.43 26.775 23.64 125-129 21.029999999999998 28.360000000000003 27.02 23.59 130-134 20.854170834166833 28.445689137827568 27.260452090418084 23.439687937587518 135-139 20.913365346138455 28.276310524209684 27.475990396158462 23.3343337334934 140-144 20.615 28.79 26.645000000000003 23.95 145-149 21.285 28.845 26.340000000000003 23.53 150-151 21.3875 27.9375 26.6125 24.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 3.0 25 3.5 26 4.5 27 6.5 28 7.5 29 16.0 30 23.5 31 31.0 32 37.0 33 48.0 34 56.0 35 72.5 36 89.0 37 106.0 38 129.5 39 142.0 40 167.0 41 218.0 42 245.0 43 256.5 44 273.5 45 286.5 46 286.0 47 264.5 48 227.5 49 198.5 50 175.5 51 140.5 52 113.0 53 82.5 54 67.5 55 51.5 56 39.0 57 32.0 58 20.5 59 16.5 60 17.0 61 11.0 62 6.0 63 5.0 64 4.0 65 4.0 66 2.5 67 1.5 68 0.5 69 0.0 70 1.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.155 95-99 0.06999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.04 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.7999999999999998 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9625000000000004 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 4.862500000000001 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.35 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGAT 10 0.006830828 145.0 1 GGTTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7170189 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170189_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66475 33.0 33.0 34.0 32.0 34.0 2 32.79275 33.0 33.0 34.0 32.0 34.0 3 32.537 34.0 33.0 34.0 32.0 34.0 4 32.23025 34.0 33.0 34.0 32.0 34.0 5 32.3375 33.0 33.0 34.0 32.0 34.0 6 36.50475 38.0 38.0 38.0 35.0 38.0 7 36.5945 38.0 38.0 38.0 36.0 38.0 8 36.589 38.0 38.0 38.0 35.0 38.0 9 36.5595 38.0 38.0 38.0 36.0 38.0 10-14 36.367450000000005 38.0 38.0 38.0 35.2 38.0 15-19 36.16605 38.0 38.0 38.0 35.0 38.0 20-24 36.21125 38.0 38.0 38.0 34.6 38.0 25-29 36.341699999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.40315 38.0 38.0 38.0 35.2 38.0 35-39 36.253699999999995 38.0 38.0 38.0 34.8 38.0 40-44 35.9091 38.0 38.0 38.0 34.4 38.0 45-49 35.85744999999999 38.0 38.0 38.0 33.4 38.0 50-54 36.246449999999996 38.0 38.0 38.0 34.4 38.0 55-59 36.2247 38.0 38.0 38.0 34.6 38.0 60-64 36.1096 38.0 38.0 38.0 34.0 38.0 65-69 36.18455 38.0 38.0 38.0 34.2 38.0 70-74 36.1107 38.0 38.0 38.0 34.0 38.0 75-79 35.98825 38.0 38.0 38.0 34.0 38.0 80-84 35.873549999999994 38.0 38.0 38.0 33.4 38.0 85-89 35.1478 38.0 37.8 38.0 29.6 38.0 90-94 34.762600000000006 38.0 37.0 38.0 27.6 38.0 95-99 35.359249999999996 38.0 37.0 38.0 29.2 38.0 100-104 35.300149999999995 38.0 37.0 38.0 29.4 38.0 105-109 35.24255000000001 38.0 37.0 38.0 29.0 38.0 110-114 35.11794999999999 38.0 37.0 38.0 28.8 38.0 115-119 34.865500000000004 38.0 36.2 38.0 27.8 38.0 120-124 34.55145 38.0 36.0 38.0 25.2 38.0 125-129 33.90475 38.0 35.0 38.0 20.2 38.0 130-134 32.4473 38.0 33.8 38.0 11.4 38.0 135-139 31.1085 38.0 33.0 38.0 2.0 38.0 140-144 30.054949999999998 38.0 29.8 38.0 2.0 38.0 145-149 29.5476 37.0 28.8 38.0 2.0 38.0 150-151 26.203 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 13.0 4 0.0 5 1.0 6 3.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 3.0 13 1.0 14 4.0 15 9.0 16 8.0 17 10.0 18 12.0 19 12.0 20 11.0 21 10.0 22 9.0 23 17.0 24 32.0 25 35.0 26 36.0 27 33.0 28 62.0 29 70.0 30 71.0 31 108.0 32 140.0 33 146.0 34 161.0 35 260.0 36 507.0 37 2166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45768652979469 16.775162744116173 16.42463695543315 28.342513770655987 2 23.870481927710845 25.52710843373494 33.0070281124498 17.59538152610442 3 21.90114068441065 28.08618504435995 28.795944233206587 21.216730038022813 4 23.431922488526265 34.625191228964816 21.7491075981642 20.19377868434472 5 23.64744729489459 37.41427482854966 21.513843027686054 17.424434848869698 6 18.059777102330294 38.01925025329281 24.29078014184397 19.63019250253293 7 17.837291561394643 17.45831227892875 43.20363820111167 21.500757958564932 8 21.552810688177466 21.981346105369294 26.77085959163096 29.694983614822284 9 21.171737490570784 23.10787025396027 28.06135277847624 27.65903947699271 10-14 22.897267592733932 28.69790871622653 26.42344680201496 21.981376889024578 15-19 22.96557720832694 27.267147460487955 27.78374507697816 21.983530254206947 20-24 22.558305326407986 28.093492208982585 27.68611874936348 21.662083715245952 25-29 22.362548184215868 28.10407790626902 28.205518360722255 21.327855548792858 30-34 23.317771237186644 28.194458540546023 27.494164213944995 20.993606008322338 35-39 22.904885628406948 27.495032859544548 27.984105150542565 21.615976361505933 40-44 22.796461997325927 28.20631492337756 27.650930782680245 21.34629229661627 45-49 22.76689570300482 28.017639216490615 28.068916008614504 21.146549071890064 50-54 22.785963846270697 27.94065522304927 28.03179907843435 21.241581852245684 55-59 23.09720602403529 28.264286800872167 27.990467014857256 20.648040160235283 60-64 23.537788627809988 27.35733902960024 28.03885667785576 21.066015664734007 65-69 23.714458560193588 27.505545472877596 27.929017947166766 20.85097801976205 70-74 23.63946431258464 27.812609720619953 27.632040928926116 20.915885037869288 75-79 23.068044961862704 27.76997189883581 28.030911280610198 21.13107185869129 80-84 23.170546942073635 27.569314681076712 27.927882430180297 21.33225594666936 85-89 23.56809943034697 27.954427757638527 27.49870533402382 20.97876747799068 90-94 23.504340142419046 27.309111700192318 28.26550236498779 20.921045792400854 95-99 23.510051141829965 27.930528128006483 27.53557142133779 21.023849308825763 100-104 24.32391523713421 27.628657921291627 27.53279515640767 20.5146316851665 105-109 23.85932999848416 27.71967055732404 28.012733060482038 20.408266383709766 110-114 23.881200121224367 27.644206485503588 27.730073744822707 20.744519648449337 115-119 24.555930156493737 27.424143310018618 27.283248628792833 20.73667790469481 120-124 24.655543864923093 27.902199508993437 27.175710205922137 20.26654642016133 125-129 24.479885498134234 27.73092061544753 27.465112712774115 20.324081173644124 130-134 24.748737038021805 27.737303908534965 27.248072321191174 20.26588673225206 135-139 23.810567857925893 28.113352335014252 27.81736461302346 20.258715194036395 140-144 24.514008800757534 28.797415473736983 26.418982899793907 20.26959282571158 145-149 24.5676741130092 28.488830486202367 27.30617608409987 19.63731931668857 150-151 25.105782792665725 28.067700987306065 26.77266316194384 20.05385305808437 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.0 3 3.5 4 2.5 5 2.5 6 4.5 7 5.5 8 4.0 9 3.5 10 3.0 11 3.5 12 3.5 13 2.0 14 1.5 15 0.5 16 1.5 17 4.0 18 4.5 19 4.0 20 3.0 21 1.0 22 2.0 23 2.0 24 1.0 25 3.5 26 7.0 27 10.0 28 9.5 29 9.5 30 13.5 31 18.0 32 25.0 33 36.0 34 46.5 35 52.0 36 64.0 37 88.5 38 139.0 39 178.0 40 198.0 41 220.5 42 228.5 43 249.0 44 264.0 45 278.0 46 286.5 47 274.0 48 237.5 49 202.0 50 184.5 51 145.5 52 105.5 53 79.5 54 63.0 55 51.0 56 39.0 57 30.0 58 24.5 59 19.5 60 11.5 61 8.5 62 7.0 63 4.5 64 3.5 65 4.0 66 6.0 67 3.0 68 0.0 69 1.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.4 3 1.375 4 1.95 5 1.575 6 1.3 7 1.05 8 0.8250000000000001 9 0.575 10-14 1.735 15-19 2.245 20-24 1.81 25-29 1.4200000000000002 30-34 1.47 35-39 1.855 40-44 2.77 45-49 2.4899999999999998 50-54 1.2550000000000001 55-59 1.395 60-64 1.69 65-69 0.8200000000000001 70-74 0.315 75-79 0.36 80-84 0.9950000000000001 85-89 3.45 90-94 3.805 95-99 1.2550000000000001 100-104 0.8999999999999999 105-109 1.045 110-114 1.01 115-119 0.635 120-124 0.20500000000000002 125-129 2.185 130-134 5.975 135-139 8.780000000000001 140-144 10.235 145-149 4.875 150-151 2.5125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.4000000000000004 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.2375 0.0 0.0 0.0 0.0 126-127 4.512499999999999 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 4.949999999999999 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.5125 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTCC 10 0.0069259275 144.25974 3 TCTCTTG 10 0.0069259275 144.25974 7 TTTTTTT 35 0.0041627833 20.137781 100-104 >>END_MODULE Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013887 spots for SRR7170189.sra Written 1013887 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra Read 1013873 spots for SRR7170189.sra Written 1013873 spots for SRR7170189.sra SRR ids: ['SRR7170189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7mnbv1xa SRR7170189.sra spots: 20277474 blocks: [[1, 1013873], [1013874, 2027746], [2027747, 3041619], [3041620, 4055492], [4055493, 5069365], [5069366, 6083238], [6083239, 7097111], [7097112, 8110984], [8110985, 9124857], [9124858, 10138730], [10138731, 11152603], [11152604, 12166476], [12166477, 13180349], [13180350, 14194222], [14194223, 15208095], [15208096, 16221968], [16221969, 17235841], [17235842, 18249714], [18249715, 19263587], [19263588, 20277474]] SRR7170189 file size 6849670 SRR7170189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170189 SRR7170189_1.fastq SRR7170189_2.fastq Input file: SRR7170189_1.fastq Paired file: SRR7170189_2.fastq trimmed: SRR7170189-trimmed-pair1.fastq, SRR7170189-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:46:43 2025 >> started Wed Feb 12 17:47:10 2025 >> done (26.953s) 20277474 read pairs processed; of these: 29016 ( 0.14%) short read pairs filtered out after trimming by size control 30292 ( 0.15%) empty read pairs filtered out after trimming by size control 20218166 (99.71%) read pairs available; of these: 11163591 (55.22%) trimmed read pairs available after processing 9054575 (44.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 7 0.00% 28 7 0.00% 29 5 0.00% 30 15 0.00% 31 11 0.00% 32 14 0.00% 33 11 0.00% 34 17 0.00% 35 20 0.00% 36 22 0.00% 37 28 0.00% 38 28 0.00% 39 43 0.00% 40 44 0.00% 41 52 0.00% 42 52 0.00% 43 78 0.00% 44 84 0.00% 45 85 0.00% 46 102 0.00% 47 113 0.00% 48 130 0.00% 49 157 0.00% 50 191 0.00% 51 203 0.00% 52 242 0.00% 53 269 0.00% 54 271 0.00% 55 321 0.00% 56 304 0.00% 57 355 0.00% 58 495 0.00% 59 555 0.00% 60 642 0.00% 61 651 0.00% 62 756 0.00% 63 832 0.00% 64 987 0.00% 65 1043 0.01% 66 1192 0.01% 67 1335 0.01% 68 1561 0.01% 69 2144 0.01% 70 2745 0.01% 71 2557 0.01% 72 2580 0.01% 73 2938 0.01% 74 3234 0.02% 75 3374 0.02% 76 3666 0.02% 77 3967 0.02% 78 4445 0.02% 79 4839 0.02% 80 5489 0.03% 81 6392 0.03% 82 7170 0.04% 83 7996 0.04% 84 9806 0.05% 85 10813 0.05% 86 11403 0.06% 87 11376 0.06% 88 11995 0.06% 89 12714 0.06% 90 13800 0.07% 91 15074 0.07% 92 16058 0.08% 93 17532 0.09% 94 18290 0.09% 95 19188 0.09% 96 20239 0.10% 97 20944 0.10% 98 21655 0.11% 99 22366 0.11% 100 23900 0.12% 101 25036 0.12% 102 26572 0.13% 103 28359 0.14% 104 29399 0.15% 105 30930 0.15% 106 31881 0.16% 107 32385 0.16% 108 33326 0.16% 109 33778 0.17% 110 35161 0.17% 111 36434 0.18% 112 38523 0.19% 113 40065 0.20% 114 42368 0.21% 115 44280 0.22% 116 45411 0.22% 117 46083 0.23% 118 47639 0.24% 119 47871 0.24% 120 49796 0.25% 121 51791 0.26% 122 54894 0.27% 123 57329 0.28% 124 60782 0.30% 125 63047 0.31% 126 65402 0.32% 127 68007 0.34% 128 70148 0.35% 129 72744 0.36% 130 75837 0.38% 131 80067 0.40% 132 84140 0.42% 133 89108 0.44% 134 94879 0.47% 135 100838 0.50% 136 108314 0.54% 137 116413 0.58% 138 125346 0.62% 139 134950 0.67% 140 144313 0.71% 141 159072 0.79% 142 175129 0.87% 143 194430 0.96% 144 223106 1.10% 145 265316 1.31% 146 324447 1.60% 147 430549 2.13% 148 634243 3.14% 149 1179011 5.83% 150 4760576 23.55% 151 9054575 44.78% 20218166 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=242.67 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=40 prefix-density=0.30 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=266.76 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.5 sequence=AAGAAGAAGAAA SRR7170189 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:47:58 Started mapping on | Feb 12 17:47:58 Finished on | Feb 12 17:50:02 Mapping speed, Million of reads per hour | 586.98 Number of input reads | 20218166 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19250411 Uniquely mapped reads % | 95.21% Average mapped length | 291.28 Number of splices: Total | 18552562 Number of splices: Annotated (sjdb) | 18237329 Number of splices: GT/AG | 18275935 Number of splices: GC/AG | 218843 Number of splices: AT/AC | 15619 Number of splices: Non-canonical | 42165 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401593 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 110261 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586233 586233 586233 N_multimapping 401593 401593 401593 N_noFeature 479165 19070069 559760 N_ambiguous 183647 1447 82815 UnstrandedReadsAssigned:18587599 PositiveStrandReadsAssigned:178895 NegativeStrandReadsAssigned:18607836 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170189 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170189-trimmed-pair1.fastq SRR7170189-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,218,166 reads, 18,553,032 reads pseudoaligned [quant] estimated average fragment length: 241.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7170189.ke.tsv 34699 SRR7170189.se.tsv 87100 total ==> SRR7170189.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.16 355 11.5709 Potri.005G024800.1.v4.1 1035 794.158 55 4.01164 Potri.004G059700.1.v4.1 961 720.217 4 0.321708 Potri.007G009000.2.v4.1 1416 1175.16 0 0 Potri.003G141000.2.v4.1 2943 2702.16 337.185 7.22807 Potri.016G087400.1.v4.1 270 84.688 1503.82 1028.58 Potri.015G069301.1.v4.1 564 330.173 0 0 Potri.010G195200.1.v4.1 1773 1532.16 46 1.73908 Potri.012G127500.1.v4.1 977 736.206 5857 460.83 ==> SRR7170189.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1339 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 392 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170189 completed mapping pipeline successfully