Starting /dee2/code/volunteer_pipeline.sh SRR7170190 current disk space = 3051603705856 free memory = 1444648164 SRR7170190 SRAfilesize 150bdf708d7a948ca79b14cc8e8445fd SRR7170190.sra SRR7170190.sra file validated SRR7170190 is paired end SRR7170190 is conventional basespace SRR7170190 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170190_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89075 34.0 33.0 34.0 33.0 34.0 2 33.48875 34.0 34.0 34.0 33.0 34.0 3 33.55575 34.0 34.0 34.0 33.0 34.0 4 33.6155 34.0 34.0 34.0 33.0 34.0 5 33.6195 34.0 34.0 34.0 33.0 34.0 6 37.375 38.0 38.0 38.0 37.0 38.0 7 37.4985 38.0 38.0 38.0 37.0 38.0 8 37.597 38.0 38.0 38.0 38.0 38.0 9 37.65575 38.0 38.0 38.0 38.0 38.0 10-14 37.34555 38.0 38.0 38.0 37.2 38.0 15-19 37.61675 38.0 38.0 38.0 38.0 38.0 20-24 37.663850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.65115 38.0 38.0 38.0 38.0 38.0 30-34 37.61995 38.0 38.0 38.0 38.0 38.0 35-39 37.464600000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.417 38.0 38.0 38.0 38.0 38.0 45-49 37.36395 38.0 38.0 38.0 37.4 38.0 50-54 37.365899999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.350199999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.31655 38.0 38.0 38.0 37.0 38.0 65-69 37.2703 38.0 38.0 38.0 37.0 38.0 70-74 37.2479 38.0 38.0 38.0 37.0 38.0 75-79 36.9135 38.0 38.0 38.0 36.0 38.0 80-84 37.100449999999995 38.0 38.0 38.0 36.6 38.0 85-89 37.001200000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.9785 38.0 38.0 38.0 36.0 38.0 95-99 36.9153 38.0 38.0 38.0 36.0 38.0 100-104 36.792 38.0 38.0 38.0 35.4 38.0 105-109 36.71825 38.0 38.0 38.0 35.0 38.0 110-114 36.732749999999996 38.0 38.0 38.0 35.4 38.0 115-119 36.61944999999999 38.0 38.0 38.0 35.0 38.0 120-124 36.45885 38.0 38.0 38.0 34.2 38.0 125-129 36.33325 38.0 38.0 38.0 34.0 38.0 130-134 36.140550000000005 38.0 38.0 38.0 33.8 38.0 135-139 35.96355 38.0 38.0 38.0 33.2 38.0 140-144 35.8104 38.0 37.4 38.0 33.0 38.0 145-149 35.54965 38.0 36.2 38.0 32.6 38.0 150-151 32.675625 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 4.0 15 4.0 16 4.0 17 3.0 18 4.0 19 4.0 20 1.0 21 2.0 22 5.0 23 4.0 24 8.0 25 4.0 26 6.0 27 10.0 28 16.0 29 19.0 30 19.0 31 42.0 32 39.0 33 62.0 34 95.0 35 175.0 36 391.0 37 3073.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.24052885837783 13.882532418001524 14.009661835748794 33.86727688787185 2 21.825 21.4 34.075 22.7 3 19.675 28.075 24.474999999999998 27.775 4 20.925 37.125 22.225 19.725 5 20.45 37.275000000000006 23.375 18.9 6 17.150000000000002 37.15 25.45 20.25 7 14.424999999999999 22.625 44.324999999999996 18.625 8 18.35 22.900000000000002 29.599999999999998 29.15 9 18.05 24.125 31.1 26.724999999999998 10-14 20.115 30.43 26.400000000000002 23.055 15-19 19.675 29.73 26.825 23.77 20-24 19.61 28.955 27.46 23.974999999999998 25-29 19.535 30.23 26.655 23.580000000000002 30-34 19.825 29.404999999999998 27.245 23.525 35-39 20.22 29.57 26.71 23.5 40-44 19.875 29.39 27.235 23.5 45-49 19.975 29.080000000000002 27.41 23.535 50-54 19.62 29.205 27.33 23.845 55-59 19.665 29.275000000000002 27.439999999999998 23.62 60-64 19.634999999999998 29.285 27.295 23.785 65-69 19.935 29.04 26.985 24.04 70-74 20.175 29.375 26.919999999999998 23.53 75-79 20.39 28.810000000000002 27.115000000000002 23.685000000000002 80-84 20.51 29.065 26.405 24.02 85-89 19.975 29.315 26.674999999999997 24.035 90-94 20.150000000000002 28.63 27.105 24.115000000000002 95-99 20.25 28.525 27.22 24.005000000000003 100-104 20.80416083216643 29.140828165633124 26.815363072614524 23.239647929585917 105-109 20.294999999999998 28.544999999999998 27.48 23.68 110-114 20.255000000000003 28.76 27.07 23.915 115-119 20.474999999999998 28.775000000000002 26.955000000000002 23.794999999999998 120-124 20.965 28.860000000000003 26.595000000000002 23.580000000000002 125-129 21.145 28.470000000000002 26.939999999999998 23.445 130-134 21.349999999999998 28.455000000000002 26.495 23.7 135-139 20.95 28.425 26.71 23.915 140-144 21.445 27.99 26.83 23.735 145-149 20.979999999999997 28.52 26.125 24.375 150-151 20.849999999999998 28.4 26.5625 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 4.5 26 6.5 27 8.0 28 8.0 29 18.5 30 28.5 31 29.5 32 37.0 33 60.0 34 76.5 35 81.5 36 103.5 37 127.5 38 138.5 39 156.5 40 176.5 41 199.5 42 233.5 43 240.5 44 245.0 45 259.5 46 262.0 47 241.5 48 219.0 49 198.0 50 172.5 51 146.0 52 111.5 53 94.5 54 81.5 55 60.5 56 42.0 57 32.5 58 25.5 59 17.0 60 11.5 61 8.5 62 7.5 63 4.5 64 2.5 65 2.5 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.9749999999999996 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138-139 7.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATGA 10 0.0068449317 144.90001 4 >>END_MODULE SRR7170190 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170190_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00825 34.0 33.0 34.0 32.0 34.0 2 33.099 34.0 33.0 34.0 33.0 34.0 3 33.161 34.0 33.0 34.0 33.0 34.0 4 33.15575 34.0 33.0 34.0 33.0 34.0 5 33.16975 34.0 33.0 34.0 33.0 34.0 6 37.2815 38.0 38.0 38.0 38.0 38.0 7 37.33825 38.0 38.0 38.0 38.0 38.0 8 37.2795 38.0 38.0 38.0 38.0 38.0 9 37.332 38.0 38.0 38.0 38.0 38.0 10-14 37.28495 38.0 38.0 38.0 38.0 38.0 15-19 37.3165 38.0 38.0 38.0 38.0 38.0 20-24 37.285700000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.2575 38.0 38.0 38.0 38.0 38.0 30-34 37.2262 38.0 38.0 38.0 38.0 38.0 35-39 37.121300000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.15445 38.0 38.0 38.0 37.6 38.0 45-49 37.1695 38.0 38.0 38.0 37.6 38.0 50-54 37.1733 38.0 38.0 38.0 37.4 38.0 55-59 37.106750000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.1483 38.0 38.0 38.0 37.4 38.0 65-69 37.081149999999994 38.0 38.0 38.0 37.0 38.0 70-74 36.96515 38.0 38.0 38.0 37.0 38.0 75-79 36.9781 38.0 38.0 38.0 37.0 38.0 80-84 37.0031 38.0 38.0 38.0 37.0 38.0 85-89 36.9172 38.0 38.0 38.0 36.8 38.0 90-94 36.89665 38.0 38.0 38.0 36.8 38.0 95-99 36.832449999999994 38.0 38.0 38.0 36.4 38.0 100-104 36.82615 38.0 38.0 38.0 36.2 38.0 105-109 36.6288 38.0 38.0 38.0 35.8 38.0 110-114 36.55315 38.0 38.0 38.0 35.4 38.0 115-119 36.405800000000006 38.0 38.0 38.0 35.0 38.0 120-124 36.31075 38.0 38.0 38.0 34.6 38.0 125-129 36.14545 38.0 38.0 38.0 34.0 38.0 130-134 36.004200000000004 38.0 38.0 38.0 34.0 38.0 135-139 35.81885 38.0 38.0 38.0 33.2 38.0 140-144 35.48885 38.0 37.2 38.0 32.2 38.0 145-149 34.873650000000005 38.0 36.0 38.0 30.2 38.0 150-151 31.555875 36.5 31.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 2.0 5 1.0 6 1.0 7 2.0 8 2.0 9 3.0 10 2.0 11 1.0 12 2.0 13 2.0 14 4.0 15 4.0 16 2.0 17 7.0 18 1.0 19 4.0 20 9.0 21 3.0 22 4.0 23 7.0 24 7.0 25 9.0 26 12.0 27 18.0 28 16.0 29 20.0 30 22.0 31 36.0 32 38.0 33 53.0 34 76.0 35 146.0 36 328.0 37 3142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.17271589486859 16.270337922403 18.973717146433042 26.583229036295368 2 24.455569461827285 24.85607008760951 31.739674593241553 18.94868585732165 3 21.11055527763882 28.51425712856428 29.239619809904955 21.135567783891947 4 24.375 34.575 21.6 19.45 5 24.593037816178313 35.562233909341344 22.489356373653894 17.355371900826448 6 20.3 34.1 23.575 22.025 7 18.65 18.9 40.5 21.95 8 22.875 21.975 27.200000000000003 27.950000000000003 9 22.75 24.175 28.775000000000002 24.3 10-14 22.73 27.925 26.435 22.91 15-19 22.48224822482248 27.38773877387739 28.52785278527853 21.602160216021602 20-24 23.381169058452922 27.661383069153455 27.406370318515926 21.551077553877693 25-29 23.05 27.735 27.625 21.59 30-34 22.965 27.250000000000004 28.110000000000003 21.675 35-39 23.48 27.750000000000004 27.994999999999997 20.775 40-44 23.96 28.21 27.195000000000004 20.635 45-49 23.115 27.310000000000002 28.155 21.42 50-54 23.3 27.3 28.12 21.279999999999998 55-59 23.78 27.43 28.265 20.525 60-64 23.64 27.58 28.48 20.3 65-69 23.155 27.725 28.1 21.02 70-74 23.645 27.865000000000002 27.73 20.76 75-79 23.875 27.555000000000003 28.384999999999998 20.185 80-84 24.175 27.04 28.04 20.745 85-89 23.47 27.465 28.04 21.025 90-94 23.64 28.01 27.485 20.865000000000002 95-99 23.90119505975299 27.49137456872844 28.001400070003502 20.606030301515077 100-104 23.72 27.625 28.075 20.580000000000002 105-109 23.822146643993197 28.133440032009606 27.883365009502853 20.161048314494348 110-114 24.3670569398579 27.36915841088762 27.92454718302812 20.339237466226358 115-119 24.46702031828646 27.19947953157842 27.82003803423081 20.513462115904314 120-124 24.15362304345652 27.17907686152923 28.249237385607838 20.418062709406414 125-129 24.837483748374837 28.227822782278228 27.217721772177217 19.716971697169715 130-134 24.412323697109134 27.313193958187455 27.898369510853254 20.376112833850154 135-139 24.84 27.655 27.384999999999998 20.119999999999997 140-144 24.310000000000002 27.77 28.084999999999997 19.835 145-149 25.0937828239884 27.21452508377932 27.854749162206772 19.836942930025508 150-151 26.375 27.675 26.9625 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.5 28 5.5 29 7.5 30 9.5 31 13.0 32 14.0 33 22.0 34 34.5 35 51.0 36 71.0 37 105.5 38 138.5 39 162.0 40 187.0 41 201.5 42 228.5 43 271.0 44 301.5 45 294.5 46 274.5 47 268.0 48 258.5 49 221.0 50 185.5 51 146.0 52 119.5 53 108.0 54 83.0 55 53.5 56 38.0 57 36.5 58 28.0 59 17.0 60 10.5 61 10.5 62 5.5 63 3.5 64 2.0 65 2.0 66 1.5 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.05 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.03 110-114 0.06999999999999999 115-119 0.09 120-124 0.015 125-129 0.01 130-134 0.03 135-139 0.0 140-144 0.0 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8324924318869829 1.6500000000000001 3 0.0 0.0 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3375000000000004 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.137499999999999 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.137499999999999 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.4875 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573735 spots for SRR7170190.sra Written 573735 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra Read 573724 spots for SRR7170190.sra Written 573724 spots for SRR7170190.sra SRR ids: ['SRR7170190.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g1p43r3z SRR7170190.sra spots: 11474491 blocks: [[1, 573724], [573725, 1147448], [1147449, 1721172], [1721173, 2294896], [2294897, 2868620], [2868621, 3442344], [3442345, 4016068], [4016069, 4589792], [4589793, 5163516], [5163517, 5737240], [5737241, 6310964], [6310965, 6884688], [6884689, 7458412], [7458413, 8032136], [8032137, 8605860], [8605861, 9179584], [9179585, 9753308], [9753309, 10327032], [10327033, 10900756], [10900757, 11474491]] SRR7170190 file size 3866628 SRR7170190 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170190 SRR7170190_1.fastq SRR7170190_2.fastq Input file: SRR7170190_1.fastq Paired file: SRR7170190_2.fastq trimmed: SRR7170190-trimmed-pair1.fastq, SRR7170190-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:51:15 2025 >> started Wed Feb 12 17:51:33 2025 >> done (17.893s) 11474491 read pairs processed; of these: 14958 ( 0.13%) short read pairs filtered out after trimming by size control 17334 ( 0.15%) empty read pairs filtered out after trimming by size control 11442199 (99.72%) read pairs available; of these: 4629443 (40.46%) trimmed read pairs available after processing 6812756 (59.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 8 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 3 0.00% 29 4 0.00% 30 2 0.00% 31 4 0.00% 32 10 0.00% 33 11 0.00% 34 8 0.00% 35 11 0.00% 36 12 0.00% 37 11 0.00% 38 11 0.00% 39 12 0.00% 40 22 0.00% 41 22 0.00% 42 21 0.00% 43 12 0.00% 44 21 0.00% 45 32 0.00% 46 31 0.00% 47 34 0.00% 48 44 0.00% 49 47 0.00% 50 51 0.00% 51 57 0.00% 52 79 0.00% 53 76 0.00% 54 80 0.00% 55 84 0.00% 56 76 0.00% 57 98 0.00% 58 130 0.00% 59 132 0.00% 60 165 0.00% 61 229 0.00% 62 223 0.00% 63 260 0.00% 64 289 0.00% 65 309 0.00% 66 353 0.00% 67 456 0.00% 68 498 0.00% 69 853 0.01% 70 1223 0.01% 71 1246 0.01% 72 1076 0.01% 73 999 0.01% 74 1135 0.01% 75 1073 0.01% 76 1307 0.01% 77 1395 0.01% 78 1594 0.01% 79 1745 0.02% 80 1884 0.02% 81 2215 0.02% 82 2488 0.02% 83 2893 0.03% 84 4012 0.04% 85 4583 0.04% 86 4931 0.04% 87 5380 0.05% 88 5688 0.05% 89 5717 0.05% 90 6455 0.06% 91 6932 0.06% 92 7398 0.06% 93 8078 0.07% 94 8470 0.07% 95 9135 0.08% 96 9713 0.08% 97 10094 0.09% 98 10371 0.09% 99 11001 0.10% 100 11633 0.10% 101 12421 0.11% 102 13341 0.12% 103 14040 0.12% 104 14702 0.13% 105 15687 0.14% 106 16401 0.14% 107 16482 0.14% 108 17023 0.15% 109 17790 0.16% 110 18412 0.16% 111 19190 0.17% 112 20595 0.18% 113 21782 0.19% 114 22418 0.20% 115 23344 0.20% 116 23990 0.21% 117 24058 0.21% 118 24869 0.22% 119 25012 0.22% 120 25854 0.23% 121 27002 0.24% 122 28237 0.25% 123 29295 0.26% 124 30662 0.27% 125 31485 0.28% 126 32339 0.28% 127 33035 0.29% 128 33760 0.30% 129 33953 0.30% 130 35173 0.31% 131 36260 0.32% 132 37662 0.33% 133 39624 0.35% 134 41355 0.36% 135 43178 0.38% 136 44832 0.39% 137 46419 0.41% 138 47958 0.42% 139 49015 0.43% 140 51444 0.45% 141 54753 0.48% 142 58587 0.51% 143 63663 0.56% 144 71920 0.63% 145 81904 0.72% 146 96753 0.85% 147 123613 1.08% 148 175717 1.54% 149 338405 2.96% 150 2267244 19.81% 151 6812756 59.54% 11442199 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=899.15 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=26.8 sequence=AAAAGAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGAT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.03 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=265.22 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7170190 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:52:22 Started mapping on | Feb 12 17:52:22 Finished on | Feb 12 17:54:08 Mapping speed, Million of reads per hour | 388.60 Number of input reads | 11442199 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10584765 Uniquely mapped reads % | 92.51% Average mapped length | 293.39 Number of splices: Total | 9625969 Number of splices: Annotated (sjdb) | 9466242 Number of splices: GT/AG | 9482211 Number of splices: GC/AG | 113219 Number of splices: AT/AC | 7835 Number of splices: Non-canonical | 22704 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201730 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 20439 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670881 670881 670881 N_multimapping 201730 201730 201730 N_noFeature 214932 10473169 251360 N_ambiguous 116606 832 40869 UnstrandedReadsAssigned:10253227 PositiveStrandReadsAssigned:110764 NegativeStrandReadsAssigned:10292536 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170190 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170190-trimmed-pair1.fastq SRR7170190-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,442,199 reads, 10,234,561 reads pseudoaligned [quant] estimated average fragment length: 229.055 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR7170190.ke.tsv 34699 SRR7170190.se.tsv 87100 total ==> SRR7170190.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.95 170 8.32089 Potri.005G024800.1.v4.1 1035 806.945 32 3.4743 Potri.004G059700.1.v4.1 961 733.022 0 0 Potri.007G009000.2.v4.1 1416 1187.95 0 0 Potri.003G141000.2.v4.1 2943 2714.95 216.074 6.97272 Potri.016G087400.1.v4.1 270 85.7054 1020.43 1043.12 Potri.015G069301.1.v4.1 564 340.073 0 0 Potri.010G195200.1.v4.1 1773 1544.95 5 0.283542 Potri.012G127500.1.v4.1 977 748.984 4166 487.312 ==> SRR7170190.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 734 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170190 completed mapping pipeline successfully