Starting /dee2/code/volunteer_pipeline.sh SRR7170191 current disk space = 3051209359360 free memory = 1580245136 SRR7170191 SRAfilesize a267a4402efa79b75709a2ab25e2bc8a SRR7170191.sra SRR7170191.sra file validated SRR7170191 is paired end SRR7170191 is conventional basespace SRR7170191 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170191_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94075 34.0 33.0 34.0 33.0 34.0 2 33.3885 34.0 33.0 34.0 33.0 34.0 3 33.409 34.0 34.0 34.0 33.0 34.0 4 33.43775 34.0 34.0 34.0 33.0 34.0 5 33.385 34.0 34.0 34.0 33.0 34.0 6 36.95275 38.0 37.0 38.0 35.0 38.0 7 37.3025 38.0 38.0 38.0 36.0 38.0 8 37.39475 38.0 38.0 38.0 37.0 38.0 9 37.44775 38.0 38.0 38.0 37.0 38.0 10-14 37.341499999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.29905 38.0 38.0 38.0 37.0 38.0 20-24 37.29575 38.0 38.0 38.0 36.8 38.0 25-29 37.161699999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.13075 38.0 38.0 38.0 36.0 38.0 35-39 36.98185 38.0 38.0 38.0 35.8 38.0 40-44 36.52415 38.0 38.0 38.0 34.0 38.0 45-49 36.421949999999995 38.0 37.4 38.0 33.8 38.0 50-54 36.29735000000001 38.0 37.0 38.0 33.6 38.0 55-59 36.1049 38.0 37.0 38.0 32.8 38.0 60-64 36.040350000000004 38.0 37.0 38.0 33.0 38.0 65-69 35.981449999999995 38.0 37.0 38.0 32.2 38.0 70-74 35.86105 38.0 37.0 38.0 31.0 38.0 75-79 35.79165 38.0 37.0 38.0 30.8 38.0 80-84 35.6738 38.0 36.4 38.0 30.2 38.0 85-89 35.489450000000005 38.0 36.0 38.0 29.0 38.0 90-94 35.2384 38.0 36.0 38.0 29.0 38.0 95-99 35.00625 38.0 35.8 38.0 28.2 38.0 100-104 34.7983 38.0 35.4 38.0 27.2 38.0 105-109 34.483 38.0 35.0 38.0 25.6 38.0 110-114 34.1553 38.0 34.2 38.0 24.0 38.0 115-119 33.6697 38.0 34.0 38.0 19.4 38.0 120-124 33.37005 38.0 33.6 38.0 18.6 38.0 125-129 32.7848 37.4 33.0 38.0 15.0 38.0 130-134 32.26955 36.6 31.4 38.0 14.8 38.0 135-139 31.735599999999998 36.0 31.0 38.0 14.2 38.0 140-144 30.946749999999998 36.0 29.6 38.0 13.6 38.0 145-149 29.2832 35.0 25.8 38.0 4.2 38.0 150-151 23.989375000000003 30.5 8.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 3.0 11 2.0 12 3.0 13 1.0 14 1.0 15 2.0 16 9.0 17 5.0 18 8.0 19 9.0 20 17.0 21 10.0 22 18.0 23 19.0 24 32.0 25 28.0 26 29.0 27 41.0 28 52.0 29 67.0 30 83.0 31 93.0 32 136.0 33 209.0 34 333.0 35 587.0 36 1105.0 37 1096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.527798933739525 14.927646610814927 12.236608276212237 33.307946179233305 2 21.630407601900476 20.930232558139537 34.53363340835209 22.9057264316079 3 19.475 27.975 27.400000000000002 25.15 4 22.650000000000002 36.375 20.625 20.349999999999998 5 21.228070175438596 35.31328320802005 24.786967418546364 18.671679197994987 6 17.974999999999998 35.275 26.075 20.674999999999997 7 13.875000000000002 22.400000000000002 42.55 21.175 8 18.5 22.5 29.049999999999997 29.95 9 16.875 24.75 31.25 27.125 10-14 19.915 29.54 26.479999999999997 24.065 15-19 19.765 28.89 27.665 23.68 20-24 20.385 29.315 26.895000000000003 23.405 25-29 20.055 29.110000000000003 26.889999999999997 23.945 30-34 20.064999999999998 29.14 27.1 23.695 35-39 20.355 29.26 26.295 24.09 40-44 19.88 29.56 26.955000000000002 23.605 45-49 20.86 28.494999999999997 26.905 23.74 50-54 20.365 28.865000000000002 26.695 24.075 55-59 20.915 28.610000000000003 27.04 23.435 60-64 20.36 28.945 26.87 23.825 65-69 20.244999999999997 28.24 27.755000000000003 23.76 70-74 20.74 28.785 26.529999999999998 23.945 75-79 20.775 28.74 26.755000000000003 23.73 80-84 20.895 28.194999999999997 26.915 23.995 85-89 20.25 28.439999999999998 27.845 23.465 90-94 20.22 28.835 27.139999999999997 23.805 95-99 20.51 28.515 27.589999999999996 23.385 100-104 21.404999999999998 28.544999999999998 26.76 23.29 105-109 20.97 28.305000000000003 26.724999999999998 24.0 110-114 21.560000000000002 28.189999999999998 26.275 23.974999999999998 115-119 21.7 28.07 26.545 23.685000000000002 120-124 20.645 28.754999999999995 27.034999999999997 23.565 125-129 21.05 28.449999999999996 26.534999999999997 23.965 130-134 21.315 28.17 27.165 23.35 135-139 21.015 29.189999999999998 26.05 23.745 140-144 21.015 28.375 26.135 24.474999999999998 145-149 21.085 28.515 26.619999999999997 23.78 150-151 21.445601706613125 28.108922073033003 26.22662818421383 24.21884803614004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 3.0 25 3.5 26 6.5 27 8.0 28 6.5 29 12.5 30 17.5 31 24.0 32 37.5 33 49.0 34 53.5 35 62.5 36 88.0 37 109.0 38 121.5 39 166.5 40 193.0 41 214.0 42 257.0 43 258.0 44 233.0 45 238.0 46 250.5 47 240.0 48 233.0 49 213.0 50 194.0 51 167.5 52 123.5 53 91.5 54 73.0 55 54.5 56 41.0 57 37.0 58 27.5 59 19.5 60 16.0 61 12.5 62 8.5 63 6.5 64 6.0 65 4.5 66 4.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.025 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.2125000000000004 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAATC 10 0.006832588 144.9875 2 >>END_MODULE SRR7170191 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170191_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85325 33.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 32.7905 34.0 33.0 34.0 32.0 34.0 4 32.6425 34.0 33.0 34.0 32.0 34.0 5 32.6895 34.0 33.0 34.0 32.0 34.0 6 36.8635 38.0 38.0 38.0 37.0 38.0 7 36.9585 38.0 38.0 38.0 37.0 38.0 8 36.8695 38.0 38.0 38.0 37.0 38.0 9 36.969 38.0 38.0 38.0 37.0 38.0 10-14 36.7347 38.0 38.0 38.0 36.6 38.0 15-19 36.673 38.0 38.0 38.0 36.4 38.0 20-24 36.7352 38.0 38.0 38.0 36.6 38.0 25-29 36.81305 38.0 38.0 38.0 36.6 38.0 30-34 36.7705 38.0 38.0 38.0 36.2 38.0 35-39 36.606350000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.432100000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.39149999999999 38.0 38.0 38.0 35.4 38.0 50-54 36.55735 38.0 38.0 38.0 35.8 38.0 55-59 36.545649999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.471799999999995 38.0 38.0 38.0 35.4 38.0 65-69 36.53190000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.4443 38.0 38.0 38.0 35.2 38.0 75-79 36.3806 38.0 38.0 38.0 34.8 38.0 80-84 36.26885 38.0 38.0 38.0 34.0 38.0 85-89 35.85940000000001 38.0 38.0 38.0 33.6 38.0 90-94 35.64149999999999 38.0 38.0 38.0 33.0 38.0 95-99 35.8749 38.0 38.0 38.0 33.0 38.0 100-104 35.8741 38.0 38.0 38.0 33.0 38.0 105-109 35.7606 38.0 37.8 38.0 32.6 38.0 110-114 35.48535 38.0 37.2 38.0 30.8 38.0 115-119 35.3672 38.0 37.0 38.0 31.0 38.0 120-124 35.1442 38.0 36.4 38.0 28.6 38.0 125-129 34.46124999999999 38.0 35.8 38.0 25.2 38.0 130-134 33.339 38.0 35.0 38.0 14.6 38.0 135-139 32.4172 38.0 34.2 38.0 11.0 38.0 140-144 31.641849999999998 38.0 33.6 38.0 2.0 38.0 145-149 30.97795 38.0 32.2 38.0 2.0 38.0 150-151 26.75275 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 3.0 4 3.0 5 1.0 6 2.0 7 2.0 8 3.0 9 1.0 10 1.0 11 0.0 12 2.0 13 7.0 14 2.0 15 4.0 16 5.0 17 7.0 18 3.0 19 13.0 20 9.0 21 10.0 22 16.0 23 20.0 24 12.0 25 13.0 26 34.0 27 42.0 28 55.0 29 56.0 30 57.0 31 71.0 32 106.0 33 130.0 34 131.0 35 227.0 36 544.0 37 2377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.54595542198848 16.929626846982217 15.552216378662658 26.972201352366643 2 24.93123280820205 24.58114528632158 31.957989497374346 18.529632408102024 3 21.01814516129032 28.07459677419355 30.619959677419356 20.287298387096776 4 25.03793626707132 34.3955488113303 21.573090541224076 18.993424380374304 5 24.28139183055976 35.60262228946041 22.16338880484115 17.95259707513868 6 19.389813414019162 36.38426626323752 24.079677256681794 20.146243066061523 7 18.129243148101583 18.254966054815185 41.840583354287155 21.775207442796077 8 20.93726379440665 24.03628117913832 26.127488032249936 28.89896699420509 9 22.953289804118533 25.13812154696133 26.87091913611251 25.037669512807636 10-14 23.534766118836913 27.656131479140328 26.139064475347663 22.670037926675093 15-19 23.544893207814557 26.96629213483146 28.084826399433144 21.40398825792084 20-24 23.287394618607703 27.08869705689333 28.073098086728255 21.55081023777071 25-29 22.95255364158356 28.019542661428424 27.314395084114036 21.71350861287398 30-34 23.508665860540106 27.519145505844417 27.871825876662637 21.100362756952844 35-39 22.60772810034392 27.311349382965812 28.135747521747927 21.94517499494234 40-44 23.967529173008625 27.620497209538303 27.168949771689498 21.243023845763574 45-49 22.89998986726112 28.103151281791465 27.7991691154119 21.197689735535516 50-54 23.497377974989917 27.75816861637757 27.495966115369104 21.248487293263413 55-59 23.74735356386733 27.679201532412538 27.709446516785967 20.863998386934167 60-64 22.659402744148508 28.09725585149314 27.507062146892657 21.7362792574657 65-69 23.259437993263962 27.39657165837229 28.200874679535517 21.14311566882823 70-74 23.229036295369212 27.269086357947437 28.000000000000004 21.501877346683354 75-79 24.015 27.55 27.839999999999996 20.595 80-84 23.61884690651814 27.40227808720959 27.919112850619697 21.059762155652567 85-89 23.794506612410988 27.66022380467955 27.81790437436419 20.72736520854527 90-94 23.88798204448072 27.627014894919405 27.713731891450728 20.771271169149152 95-99 24.051776038531006 27.418221954645794 27.433273128637364 21.096728878185832 100-104 24.041061592388584 27.300951427140713 27.97696544817226 20.681021532298445 105-109 23.71620942618832 27.826349110642145 27.539945734097078 20.917495729072456 110-114 24.159421018243957 27.863497009599435 27.235261597225712 20.741820374930896 115-119 23.976578921028928 26.9692723451106 28.010209188269442 21.04393954559103 120-124 23.51705511653496 27.143142942882864 28.39351805541662 20.94628388516555 125-129 24.426130043482658 27.66204874102538 27.378905854990393 20.532915360501566 130-134 25.397730217132196 27.24775871897186 27.11820490231642 20.23630616157952 135-139 24.373709019649382 27.41380223505111 27.7845453101001 20.427943435199406 140-144 24.55990154636417 26.99448873669003 27.224570603028518 21.22103911391728 145-149 25.505947783099025 27.334054276739277 27.06112570163242 20.098872238529275 150-151 25.403892634524873 27.630072509858795 26.701437476148072 20.26459737946826 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 2.0 6 1.0 7 3.0 8 4.0 9 2.5 10 2.5 11 3.5 12 3.5 13 2.5 14 2.5 15 1.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.0 25 4.0 26 4.5 27 3.5 28 6.0 29 8.5 30 10.5 31 15.0 32 15.0 33 22.0 34 42.0 35 57.0 36 68.0 37 81.5 38 101.5 39 141.0 40 185.5 41 205.0 42 231.0 43 271.5 44 287.5 45 282.5 46 280.0 47 278.0 48 252.0 49 213.0 50 190.0 51 159.0 52 125.5 53 103.5 54 87.5 55 66.0 56 42.5 57 34.5 58 25.0 59 18.5 60 12.0 61 7.0 62 5.5 63 5.0 64 4.0 65 1.5 66 2.5 67 2.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.025 3 0.8 4 1.15 5 0.8500000000000001 6 0.8500000000000001 7 0.575 8 0.775 9 0.44999999999999996 10-14 1.125 15-19 1.21 20-24 0.955 25-29 0.73 30-34 0.76 35-39 1.1400000000000001 40-44 1.4500000000000002 45-49 1.31 50-54 0.84 55-59 0.8099999999999999 60-64 0.88 65-69 0.5349999999999999 70-74 0.125 75-79 0.0 80-84 0.35500000000000004 85-89 1.7000000000000002 90-94 1.9800000000000002 95-99 0.33999999999999997 100-104 0.15 105-109 0.49 110-114 0.515 115-119 0.09 120-124 0.03 125-129 1.11 130-134 3.515 135-139 5.595 140-144 6.555 145-149 2.905 150-151 1.7375000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.2625 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.4125 0.0 0.0 0.0 0.0 138-139 5.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATCT 10 0.00709263 143.1875 3 AATGTTC 10 0.00709263 143.1875 5 GGGGGGG 20 0.0060074553 28.926767 35-39 >>END_MODULE Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra Read 749015 spots for SRR7170191.sra Written 749015 spots for SRR7170191.sra Read 749006 spots for SRR7170191.sra Written 749006 spots for SRR7170191.sra SRR ids: ['SRR7170191.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_udc0qarv SRR7170191.sra spots: 14980129 blocks: [[1, 749006], [749007, 1498012], [1498013, 2247018], [2247019, 2996024], [2996025, 3745030], [3745031, 4494036], [4494037, 5243042], [5243043, 5992048], [5992049, 6741054], [6741055, 7490060], [7490061, 8239066], [8239067, 8988072], [8988073, 9737078], [9737079, 10486084], [10486085, 11235090], [11235091, 11984096], [11984097, 12733102], [12733103, 13482108], [13482109, 14231114], [14231115, 14980129]] SRR7170191 file size 5054573 SRR7170191 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170191 SRR7170191_1.fastq SRR7170191_2.fastq Input file: SRR7170191_1.fastq Paired file: SRR7170191_2.fastq trimmed: SRR7170191-trimmed-pair1.fastq, SRR7170191-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:41:17 2025 >> started Wed Feb 12 18:41:32 2025 >> done (15.741s) 14980129 read pairs processed; of these: 25874 ( 0.17%) short read pairs filtered out after trimming by size control 25337 ( 0.17%) empty read pairs filtered out after trimming by size control 14928918 (99.66%) read pairs available; of these: 8572062 (57.42%) trimmed read pairs available after processing 6356856 (42.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 7 0.00% 21 5 0.00% 22 8 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 5 0.00% 29 12 0.00% 30 8 0.00% 31 5 0.00% 32 4 0.00% 33 12 0.00% 34 10 0.00% 35 10 0.00% 36 11 0.00% 37 13 0.00% 38 21 0.00% 39 17 0.00% 40 15 0.00% 41 26 0.00% 42 23 0.00% 43 17 0.00% 44 23 0.00% 45 39 0.00% 46 30 0.00% 47 34 0.00% 48 65 0.00% 49 55 0.00% 50 62 0.00% 51 78 0.00% 52 87 0.00% 53 113 0.00% 54 94 0.00% 55 109 0.00% 56 144 0.00% 57 136 0.00% 58 153 0.00% 59 155 0.00% 60 189 0.00% 61 228 0.00% 62 262 0.00% 63 263 0.00% 64 318 0.00% 65 336 0.00% 66 377 0.00% 67 493 0.00% 68 614 0.00% 69 798 0.01% 70 982 0.01% 71 819 0.01% 72 944 0.01% 73 967 0.01% 74 1038 0.01% 75 1160 0.01% 76 1325 0.01% 77 1514 0.01% 78 1692 0.01% 79 1988 0.01% 80 2058 0.01% 81 2369 0.02% 82 2813 0.02% 83 3333 0.02% 84 4203 0.03% 85 4787 0.03% 86 5144 0.03% 87 5340 0.04% 88 5797 0.04% 89 6014 0.04% 90 6536 0.04% 91 7160 0.05% 92 7578 0.05% 93 8440 0.06% 94 8813 0.06% 95 9394 0.06% 96 10010 0.07% 97 10685 0.07% 98 10937 0.07% 99 11618 0.08% 100 12408 0.08% 101 13306 0.09% 102 14523 0.10% 103 15339 0.10% 104 16477 0.11% 105 17282 0.12% 106 18232 0.12% 107 18841 0.13% 108 19459 0.13% 109 20035 0.13% 110 21017 0.14% 111 22488 0.15% 112 23659 0.16% 113 25077 0.17% 114 26374 0.18% 115 27695 0.19% 116 28625 0.19% 117 29542 0.20% 118 31211 0.21% 119 31774 0.21% 120 33154 0.22% 121 35134 0.24% 122 37477 0.25% 123 39440 0.26% 124 41396 0.28% 125 44007 0.29% 126 46106 0.31% 127 47852 0.32% 128 49753 0.33% 129 52144 0.35% 130 54805 0.37% 131 57870 0.39% 132 61738 0.41% 133 66119 0.44% 134 70538 0.47% 135 75312 0.50% 136 81465 0.55% 137 87727 0.59% 138 96580 0.65% 139 105031 0.70% 140 114074 0.76% 141 124469 0.83% 142 140021 0.94% 143 158338 1.06% 144 184463 1.24% 145 219480 1.47% 146 272743 1.83% 147 365400 2.45% 148 538544 3.61% 149 1014997 6.80% 150 3671548 24.59% 151 6356856 42.58% 14928918 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=226.11 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=26.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=35 prefix-density=0.37 prefix-fanout=3.3 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=99.58 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=19.7 sequence=TGCTGATGAGTGTCG SRR7170191 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:42:41 Started mapping on | Feb 12 18:42:42 Finished on | Feb 12 18:44:05 Mapping speed, Million of reads per hour | 647.52 Number of input reads | 14928918 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14114732 Uniquely mapped reads % | 94.55% Average mapped length | 292.47 Number of splices: Total | 13271761 Number of splices: Annotated (sjdb) | 13062582 Number of splices: GT/AG | 13078275 Number of splices: GC/AG | 156233 Number of splices: AT/AC | 10613 Number of splices: Non-canonical | 26640 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254488 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 29543 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578930 578930 578930 N_multimapping 254488 254488 254488 N_noFeature 281344 13977662 339444 N_ambiguous 133814 601 54443 UnstrandedReadsAssigned:13699574 PositiveStrandReadsAssigned:136469 NegativeStrandReadsAssigned:13720845 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170191 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170191-trimmed-pair1.fastq SRR7170191-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,928,918 reads, 13,640,289 reads pseudoaligned [quant] estimated average fragment length: 241.619 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7170191.ke.tsv 34699 SRR7170191.se.tsv 87100 total ==> SRR7170191.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.38 190 7.09874 Potri.005G024800.1.v4.1 1035 794.381 53 4.43052 Potri.004G059700.1.v4.1 961 720.421 5 0.460884 Potri.007G009000.2.v4.1 1416 1175.38 0 0 Potri.003G141000.2.v4.1 2943 2702.38 252.062 6.19396 Potri.016G087400.1.v4.1 270 81.0009 1771 1451.9 Potri.015G069301.1.v4.1 564 329.044 0 0 Potri.010G195200.1.v4.1 1773 1532.38 30 1.30006 Potri.012G127500.1.v4.1 977 736.387 7622 687.339 ==> SRR7170191.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1068 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170191 completed mapping pipeline successfully