Starting /dee2/code/volunteer_pipeline.sh SRR7170192 current disk space = 3051235856384 free memory = 1578826500 SRR7170192 SRAfilesize e8c0497581f6d1e2e60c21e25ec62a00 SRR7170192.sra SRR7170192.sra file validated SRR7170192 is paired end SRR7170192 is conventional basespace SRR7170192 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170192_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.289 34.0 33.0 34.0 33.0 34.0 2 33.45775 34.0 33.0 34.0 33.0 34.0 3 33.447 34.0 34.0 34.0 33.0 34.0 4 33.41925 34.0 34.0 34.0 33.0 34.0 5 33.4225 34.0 34.0 34.0 33.0 34.0 6 36.966 38.0 37.0 38.0 35.0 38.0 7 37.16925 38.0 38.0 38.0 36.0 38.0 8 37.2665 38.0 38.0 38.0 37.0 38.0 9 37.3375 38.0 38.0 38.0 37.0 38.0 10-14 37.33645 38.0 38.0 38.0 37.0 38.0 15-19 37.27085 38.0 38.0 38.0 36.6 38.0 20-24 37.2623 38.0 38.0 38.0 36.2 38.0 25-29 37.20115 38.0 38.0 38.0 36.2 38.0 30-34 37.13265 38.0 38.0 38.0 36.0 38.0 35-39 36.93645 38.0 38.0 38.0 35.6 38.0 40-44 36.474000000000004 38.0 37.8 38.0 34.0 38.0 45-49 36.274350000000005 38.0 37.2 38.0 33.4 38.0 50-54 36.15835 38.0 37.0 38.0 33.0 38.0 55-59 36.03935 38.0 37.0 38.0 32.6 38.0 60-64 35.963350000000005 38.0 37.0 38.0 32.0 38.0 65-69 35.888549999999995 38.0 37.0 38.0 31.4 38.0 70-74 35.82175 38.0 36.6 38.0 31.0 38.0 75-79 35.59415 38.0 36.0 38.0 29.8 38.0 80-84 35.402750000000005 38.0 36.0 38.0 29.0 38.0 85-89 35.168 38.0 36.0 38.0 28.8 38.0 90-94 34.936400000000006 38.0 35.6 38.0 27.8 38.0 95-99 34.5567 38.0 35.0 38.0 26.2 38.0 100-104 34.48125 38.0 34.8 38.0 25.6 38.0 105-109 34.1339 38.0 34.0 38.0 23.8 38.0 110-114 33.7401 38.0 34.0 38.0 21.4 38.0 115-119 33.405699999999996 37.8 33.8 38.0 16.6 38.0 120-124 33.045 37.2 33.0 38.0 15.0 38.0 125-129 32.525549999999996 37.0 32.0 38.0 15.0 38.0 130-134 31.7589 36.0 31.0 38.0 14.8 38.0 135-139 31.2434 36.0 30.0 38.0 14.0 38.0 140-144 30.212 35.4 27.2 38.0 13.2 38.0 145-149 28.881600000000002 34.8 24.4 38.0 2.0 38.0 150-151 24.227 32.0 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 3.0 13 1.0 14 2.0 15 6.0 16 6.0 17 11.0 18 13.0 19 12.0 20 14.0 21 14.0 22 14.0 23 19.0 24 26.0 25 27.0 26 57.0 27 52.0 28 39.0 29 58.0 30 84.0 31 117.0 32 162.0 33 270.0 34 344.0 35 578.0 36 1080.0 37 988.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.572864321608044 14.949748743718594 12.135678391959798 33.34170854271357 2 21.675 21.05 34.775 22.5 3 19.650000000000002 28.375 25.8 26.174999999999997 4 22.225 35.3 22.375 20.1 5 20.96048024012006 36.79339669834917 23.111555777888945 19.13456728364182 6 17.625 36.425000000000004 25.224999999999998 20.724999999999998 7 14.45 20.7 44.074999999999996 20.775 8 18.975 23.175 28.799999999999997 29.049999999999997 9 18.35 24.0 31.974999999999998 25.674999999999997 10-14 19.985 29.525000000000002 26.93 23.56 15-19 19.919999999999998 28.93 27.655 23.494999999999997 20-24 20.465 28.95 26.640000000000004 23.945 25-29 20.325 29.054999999999996 27.395000000000003 23.225 30-34 19.805 28.610000000000003 27.49 24.095 35-39 19.89 28.95 27.41 23.75 40-44 20.150000000000002 29.2 27.33 23.32 45-49 20.89 28.34 26.83 23.94 50-54 20.445 28.860000000000003 26.955000000000002 23.74 55-59 20.18 29.110000000000003 27.04 23.669999999999998 60-64 20.18 28.945 27.615000000000002 23.26 65-69 20.57 28.605000000000004 27.355 23.47 70-74 20.82 28.54 27.52 23.119999999999997 75-79 19.945 28.134999999999998 27.700000000000003 24.22 80-84 20.349999999999998 28.804999999999996 27.155 23.69 85-89 20.724999999999998 28.665000000000003 27.025 23.585 90-94 20.855 28.26 27.555000000000003 23.330000000000002 95-99 20.06 28.970000000000002 27.365000000000002 23.605 100-104 20.974999999999998 28.77 26.674999999999997 23.580000000000002 105-109 20.89 28.720000000000002 26.775 23.615 110-114 20.72 28.925 26.905 23.45 115-119 20.815 28.93 27.029999999999998 23.225 120-124 20.580000000000002 28.54 26.71 24.169999999999998 125-129 20.8 28.27 27.075 23.855 130-134 20.84 28.110000000000003 27.389999999999997 23.66 135-139 20.54 28.22 27.134999999999998 24.104999999999997 140-144 20.695 28.655 26.740000000000002 23.91 145-149 20.68 28.96 26.805 23.555 150-151 21.267816954238562 28.569642410602654 26.281570392598148 23.88097024256064 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 3.0 23 3.5 24 2.5 25 5.0 26 7.0 27 7.0 28 8.0 29 11.0 30 14.5 31 23.5 32 41.5 33 49.0 34 60.0 35 73.0 36 91.0 37 110.5 38 130.5 39 169.5 40 191.5 41 206.5 42 223.0 43 240.0 44 268.0 45 274.5 46 270.0 47 260.0 48 220.5 49 193.0 50 179.5 51 148.0 52 104.5 53 83.0 54 85.5 55 67.5 56 39.5 57 27.5 58 21.5 59 19.5 60 17.5 61 12.0 62 7.0 63 5.0 64 5.0 65 3.5 66 3.5 67 2.0 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9249999999999999 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.4000000000000004 0.0 0.0 0.0 0.0 126-127 3.7125000000000004 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAT 10 0.006830828 145.0 4 ACACATC 10 0.006830828 145.0 5 CTGCACA 10 0.006830828 145.0 1 >>END_MODULE SRR7170192 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170192_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83675 33.0 33.0 34.0 32.0 34.0 2 32.98775 34.0 33.0 34.0 32.0 34.0 3 32.941 34.0 33.0 34.0 32.0 34.0 4 32.7355 34.0 33.0 34.0 32.0 34.0 5 32.8585 34.0 33.0 34.0 32.0 34.0 6 37.07825 38.0 38.0 38.0 36.0 38.0 7 37.1 38.0 38.0 38.0 37.0 38.0 8 37.14 38.0 38.0 38.0 37.0 38.0 9 37.14625 38.0 38.0 38.0 37.0 38.0 10-14 37.04015 38.0 38.0 38.0 37.0 38.0 15-19 36.982000000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.0034 38.0 38.0 38.0 37.0 38.0 25-29 37.038 38.0 38.0 38.0 36.8 38.0 30-34 37.0951 38.0 38.0 38.0 37.0 38.0 35-39 36.93385 38.0 38.0 38.0 36.2 38.0 40-44 36.8214 38.0 38.0 38.0 36.2 38.0 45-49 36.77655 38.0 38.0 38.0 36.0 38.0 50-54 36.84680000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.840250000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.790099999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.7428 38.0 38.0 38.0 35.6 38.0 70-74 36.71345 38.0 38.0 38.0 35.8 38.0 75-79 36.5523 38.0 38.0 38.0 34.8 38.0 80-84 36.48755 38.0 38.0 38.0 34.4 38.0 85-89 36.20575 38.0 38.0 38.0 34.0 38.0 90-94 35.91155 38.0 38.0 38.0 33.0 38.0 95-99 36.13615 38.0 38.0 38.0 33.6 38.0 100-104 36.07895 38.0 38.0 38.0 33.6 38.0 105-109 35.9 38.0 37.6 38.0 32.8 38.0 110-114 35.70175 38.0 37.0 38.0 31.6 38.0 115-119 35.42965 38.0 36.8 38.0 30.6 38.0 120-124 35.2921 38.0 36.4 38.0 30.2 38.0 125-129 34.8486 38.0 36.0 38.0 28.0 38.0 130-134 33.620799999999996 38.0 35.2 38.0 19.0 38.0 135-139 32.62105 38.0 34.6 38.0 13.6 38.0 140-144 31.7312 38.0 33.4 38.0 4.2 38.0 145-149 31.170499999999997 38.0 33.0 38.0 2.0 38.0 150-151 27.496000000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 1.0 6 1.0 7 1.0 8 2.0 9 1.0 10 0.0 11 2.0 12 2.0 13 5.0 14 1.0 15 2.0 16 4.0 17 9.0 18 8.0 19 5.0 20 11.0 21 12.0 22 13.0 23 15.0 24 13.0 25 18.0 26 22.0 27 33.0 28 36.0 29 47.0 30 67.0 31 69.0 32 123.0 33 138.0 34 193.0 35 240.0 36 556.0 37 2336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.4457801152016 17.15502128725269 15.051339844728274 27.347858752817427 2 24.562281140570285 25.087543771885944 33.81690845422711 16.53326663331666 3 21.99899547965846 27.17227523857358 30.411853340030138 20.416875941737818 4 22.174679083815757 35.74125346086081 22.09916939340549 19.984898061917946 5 23.72583479789104 35.90258599045945 23.374340949033392 16.99723826261612 6 19.900000000000002 35.125 25.25 19.725 7 18.3 18.0 41.6 22.1 8 20.9 22.025 27.200000000000003 29.875 9 21.675 25.074999999999996 28.549999999999997 24.7 10-14 22.863868576580188 28.132825803866574 26.810577982570372 22.19272763698287 15-19 23.350050150451356 27.286860581745238 28.054162487462385 21.30892678034102 20-24 23.120056072894762 27.625913687794135 27.76609592470211 21.487934314608992 25-29 23.105 27.425 28.244999999999997 21.224999999999998 30-34 22.735 27.815 27.87 21.58 35-39 23.306912812280526 27.11949433129327 28.569278619444166 21.00431423698204 40-44 23.266106724337373 27.55620379218428 27.868027963586982 21.309661519891364 45-49 22.993873656723913 27.99538013457869 27.52837199959827 21.482374209099124 50-54 23.12271749462204 27.47010855970784 27.970383711041073 21.436790234629047 55-59 23.849999999999998 27.425 28.035 20.69 60-64 22.98189456837051 27.9183755126538 28.128438531559468 20.971291387416223 65-69 23.123498799039233 27.95736589271417 27.446957566052845 21.472177742193754 70-74 23.985 27.67 27.82 20.525 75-79 23.505000000000003 27.395000000000003 28.165000000000003 20.935000000000002 80-84 23.48 28.205000000000002 27.529999999999998 20.785 85-89 23.711392149947095 27.092255756537515 28.356930518466267 20.839421575049126 90-94 22.95106801999697 27.970509518759783 27.87961419986871 21.198808261374538 95-99 23.594437775110045 27.040816326530614 28.026210484193676 21.338535414165666 100-104 24.095 27.415 27.77 20.72 105-109 24.165 27.405 28.33 20.1 110-114 23.695 28.155 27.615000000000002 20.535 115-119 23.93 27.92 27.955000000000002 20.195 120-124 24.19 27.72 28.000000000000004 20.09 125-129 24.53180699904604 28.05643420193804 27.017121052367326 20.39463774664859 130-134 24.286154478225143 27.839975349219394 27.459942481511913 20.413927691043547 135-139 24.762354918334122 27.692873273462524 27.362008297883516 20.182763510319838 140-144 24.252898011272997 28.022971392108904 27.645432308837602 20.078698287780494 145-149 25.02931728955285 27.716310610309485 27.252332636516595 20.002039463621067 150-151 25.732243871778753 27.781269641734756 26.813324952859833 19.673161533626647 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 2.5 27 3.0 28 6.0 29 9.5 30 12.5 31 19.5 32 22.5 33 25.0 34 42.5 35 62.5 36 85.5 37 100.0 38 115.0 39 148.0 40 194.0 41 241.0 42 258.5 43 252.5 44 261.0 45 279.5 46 283.0 47 266.0 48 232.5 49 210.5 50 184.5 51 148.5 52 125.0 53 100.5 54 71.5 55 51.5 56 40.0 57 35.5 58 29.5 59 17.5 60 11.0 61 11.5 62 10.5 63 6.5 64 3.0 65 1.0 66 1.0 67 1.5 68 1.5 69 2.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.05 3 0.44999999999999996 4 0.675 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.16999999999999998 15-19 0.3 20-24 0.13 25-29 0.0 30-34 0.0 35-39 0.33 40-44 0.585 45-49 0.43 50-54 0.055 55-59 0.0 60-64 0.03 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.765 90-94 0.985 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.415 130-134 2.64 135-139 4.795 140-144 5.970000000000001 145-149 1.9349999999999998 150-151 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5249999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.1624999999999996 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAAT 10 0.007015441 143.7125 5 >>END_MODULE Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886388 spots for SRR7170192.sra Written 886388 spots for SRR7170192.sra Read 886400 spots for SRR7170192.sra Written 886400 spots for SRR7170192.sra SRR ids: ['SRR7170192.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7mk8d9tl SRR7170192.sra spots: 17727772 blocks: [[1, 886388], [886389, 1772776], [1772777, 2659164], [2659165, 3545552], [3545553, 4431940], [4431941, 5318328], [5318329, 6204716], [6204717, 7091104], [7091105, 7977492], [7977493, 8863880], [8863881, 9750268], [9750269, 10636656], [10636657, 11523044], [11523045, 12409432], [12409433, 13295820], [13295821, 14182208], [14182209, 15068596], [15068597, 15954984], [15954985, 16841372], [16841373, 17727772]] SRR7170192 file size 5985659 SRR7170192 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170192 SRR7170192_1.fastq SRR7170192_2.fastq Input file: SRR7170192_1.fastq Paired file: SRR7170192_2.fastq trimmed: SRR7170192-trimmed-pair1.fastq, SRR7170192-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:39:29 2025 >> started Wed Feb 12 18:39:51 2025 >> done (22.210s) 17727772 read pairs processed; of these: 29476 ( 0.17%) short read pairs filtered out after trimming by size control 28612 ( 0.16%) empty read pairs filtered out after trimming by size control 17669684 (99.67%) read pairs available; of these: 10432558 (59.04%) trimmed read pairs available after processing 7237126 (40.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 9 0.00% 24 7 0.00% 25 5 0.00% 26 7 0.00% 27 4 0.00% 28 8 0.00% 29 8 0.00% 30 18 0.00% 31 6 0.00% 32 10 0.00% 33 9 0.00% 34 16 0.00% 35 16 0.00% 36 20 0.00% 37 25 0.00% 38 12 0.00% 39 22 0.00% 40 39 0.00% 41 30 0.00% 42 22 0.00% 43 44 0.00% 44 51 0.00% 45 59 0.00% 46 61 0.00% 47 52 0.00% 48 59 0.00% 49 74 0.00% 50 81 0.00% 51 123 0.00% 52 120 0.00% 53 135 0.00% 54 156 0.00% 55 165 0.00% 56 140 0.00% 57 189 0.00% 58 243 0.00% 59 269 0.00% 60 314 0.00% 61 337 0.00% 62 413 0.00% 63 443 0.00% 64 474 0.00% 65 567 0.00% 66 640 0.00% 67 669 0.00% 68 799 0.00% 69 1062 0.01% 70 1395 0.01% 71 1317 0.01% 72 1422 0.01% 73 1582 0.01% 74 1653 0.01% 75 1789 0.01% 76 1942 0.01% 77 2231 0.01% 78 2565 0.01% 79 2774 0.02% 80 3145 0.02% 81 3721 0.02% 82 4302 0.02% 83 4873 0.03% 84 6173 0.03% 85 7004 0.04% 86 7447 0.04% 87 7498 0.04% 88 8177 0.05% 89 8517 0.05% 90 9378 0.05% 91 9850 0.06% 92 11044 0.06% 93 11796 0.07% 94 12784 0.07% 95 13549 0.08% 96 14113 0.08% 97 14657 0.08% 98 15303 0.09% 99 16482 0.09% 100 16788 0.10% 101 17974 0.10% 102 19605 0.11% 103 21088 0.12% 104 21925 0.12% 105 23278 0.13% 106 24109 0.14% 107 24418 0.14% 108 25715 0.15% 109 26174 0.15% 110 27593 0.16% 111 28855 0.16% 112 30729 0.17% 113 32834 0.19% 114 34473 0.20% 115 36182 0.20% 116 37432 0.21% 117 38598 0.22% 118 39545 0.22% 119 40437 0.23% 120 42132 0.24% 121 44184 0.25% 122 46420 0.26% 123 49316 0.28% 124 52389 0.30% 125 54560 0.31% 126 57304 0.32% 127 59391 0.34% 128 61292 0.35% 129 64210 0.36% 130 67423 0.38% 131 71811 0.41% 132 75940 0.43% 133 81816 0.46% 134 86898 0.49% 135 93938 0.53% 136 100574 0.57% 137 107639 0.61% 138 116661 0.66% 139 128268 0.73% 140 140674 0.80% 141 155902 0.88% 142 176510 1.00% 143 201475 1.14% 144 228953 1.30% 145 275791 1.56% 146 344651 1.95% 147 465338 2.63% 148 688943 3.90% 149 1237928 7.01% 150 4269932 24.17% 151 7237126 40.96% 17669684 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=252.26 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=30 prefix-density=0.29 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=240.58 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=26.2 sequence=GAAGAAGAAGAAA SRR7170192 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:40:53 Started mapping on | Feb 12 18:40:53 Finished on | Feb 12 18:42:45 Mapping speed, Million of reads per hour | 567.95 Number of input reads | 17669684 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16470472 Uniquely mapped reads % | 93.21% Average mapped length | 291.72 Number of splices: Total | 15516443 Number of splices: Annotated (sjdb) | 15271376 Number of splices: GT/AG | 15284899 Number of splices: GC/AG | 183997 Number of splices: AT/AC | 12738 Number of splices: Non-canonical | 34809 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317013 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 116948 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 905733 905733 905733 N_multimapping 317013 317013 317013 N_noFeature 372010 16307055 446239 N_ambiguous 160165 1762 69583 UnstrandedReadsAssigned:15938297 PositiveStrandReadsAssigned:161655 NegativeStrandReadsAssigned:15954650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170192 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170192-trimmed-pair1.fastq SRR7170192-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,669,684 reads, 15,904,187 reads pseudoaligned [quant] estimated average fragment length: 242.85 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR7170192.ke.tsv 34699 SRR7170192.se.tsv 87100 total ==> SRR7170192.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.15 277 9.76445 Potri.005G024800.1.v4.1 1035 793.15 77 6.07831 Potri.004G059700.1.v4.1 961 719.227 0 0 Potri.007G009000.2.v4.1 1416 1174.15 0 0 Potri.003G141000.2.v4.1 2943 2701.15 254.052 5.88873 Potri.016G087400.1.v4.1 270 82.3001 1350 1027.03 Potri.015G069301.1.v4.1 564 328.555 0 0 Potri.010G195200.1.v4.1 1773 1531.15 54 2.20813 Potri.012G127500.1.v4.1 977 735.193 6727 572.886 ==> SRR7170192.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1588 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 378 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170192 completed mapping pipeline successfully