Starting /dee2/code/volunteer_pipeline.sh SRR7170193 current disk space = 3051290771456 free memory = 1582013212 SRR7170193 SRAfilesize dbb171007609f588e1ebf667b51f90a4 SRR7170193.sra SRR7170193.sra file validated SRR7170193 is paired end SRR7170193 is conventional basespace SRR7170193 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170193_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.199 34.0 33.0 34.0 33.0 34.0 2 33.39125 34.0 33.0 34.0 33.0 34.0 3 33.403 34.0 33.0 34.0 33.0 34.0 4 33.37525 34.0 34.0 34.0 33.0 34.0 5 33.38 34.0 33.0 34.0 33.0 34.0 6 36.74775 38.0 37.0 38.0 34.0 38.0 7 37.0215 38.0 38.0 38.0 36.0 38.0 8 37.28425 38.0 38.0 38.0 37.0 38.0 9 37.3015 38.0 38.0 38.0 37.0 38.0 10-14 37.269149999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.21235 38.0 38.0 38.0 36.0 38.0 20-24 37.1599 38.0 38.0 38.0 36.0 38.0 25-29 37.126000000000005 38.0 38.0 38.0 36.0 38.0 30-34 37.04115 38.0 38.0 38.0 36.0 38.0 35-39 36.85555000000001 38.0 38.0 38.0 35.2 38.0 40-44 36.443400000000004 38.0 37.6 38.0 34.0 38.0 45-49 36.19505 38.0 37.0 38.0 33.0 38.0 50-54 36.124300000000005 38.0 37.0 38.0 33.0 38.0 55-59 36.08985 38.0 37.0 38.0 32.6 38.0 60-64 35.89135 38.0 36.8 38.0 31.0 38.0 65-69 35.817750000000004 38.0 36.6 38.0 31.0 38.0 70-74 35.6945 38.0 36.4 38.0 29.8 38.0 75-79 35.5274 38.0 36.0 38.0 29.0 38.0 80-84 35.4173 38.0 36.0 38.0 29.0 38.0 85-89 35.27485 38.0 36.0 38.0 29.0 38.0 90-94 34.9876 38.0 35.0 38.0 28.4 38.0 95-99 34.602250000000005 38.0 35.0 38.0 26.2 38.0 100-104 34.4796 38.0 34.6 38.0 25.4 38.0 105-109 34.1933 38.0 34.4 38.0 24.0 38.0 110-114 33.75715 38.0 34.0 38.0 21.0 38.0 115-119 33.256150000000005 37.8 33.4 38.0 15.0 38.0 120-124 32.975550000000005 37.0 33.0 38.0 15.0 38.0 125-129 32.396950000000004 37.0 31.0 38.0 15.0 38.0 130-134 31.709999999999997 36.0 30.0 38.0 14.8 38.0 135-139 31.03945 36.0 28.2 38.0 14.0 38.0 140-144 30.2194 35.4 27.0 38.0 13.2 38.0 145-149 28.61115 34.6 23.2 38.0 2.0 38.0 150-151 24.261375 33.0 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 1.0 12 1.0 13 0.0 14 1.0 15 5.0 16 3.0 17 5.0 18 12.0 19 10.0 20 12.0 21 14.0 22 18.0 23 21.0 24 16.0 25 30.0 26 44.0 27 64.0 28 55.0 29 84.0 30 89.0 31 134.0 32 188.0 33 254.0 34 343.0 35 602.0 36 1058.0 37 931.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.994974874371856 14.49748743718593 11.884422110552764 34.62311557788944 2 20.8 20.275000000000002 35.4 23.525 3 19.15 27.125 26.150000000000002 27.575 4 23.325000000000003 33.875 23.275000000000002 19.525000000000002 5 21.11055527763882 37.943971985992995 23.336668334167083 17.608804402201102 6 17.775 35.675000000000004 24.85 21.7 7 13.825000000000001 22.15 45.074999999999996 18.95 8 18.675 21.2 29.775000000000002 30.349999999999998 9 18.675 23.425 31.05 26.85 10-14 20.755000000000003 29.74 26.115 23.39 15-19 20.47 28.71 27.095000000000002 23.724999999999998 20-24 20.29 28.515 27.295 23.9 25-29 20.385 28.22 27.905 23.49 30-34 20.244999999999997 28.54 27.744999999999997 23.47 35-39 20.505000000000003 28.42 27.525 23.549999999999997 40-44 20.505000000000003 28.52 27.1 23.875 45-49 20.580000000000002 28.515 26.655 24.25 50-54 20.285 28.035 27.284999999999997 24.395 55-59 20.11 28.665000000000003 27.650000000000002 23.575 60-64 20.14 28.76 27.425 23.674999999999997 65-69 20.82 29.07 26.790000000000003 23.32 70-74 20.3 29.015 27.175 23.51 75-79 20.865000000000002 27.97 27.534999999999997 23.630000000000003 80-84 20.674999999999997 28.13 27.21 23.985 85-89 20.43 27.884999999999998 28.025 23.66 90-94 20.885 28.199999999999996 27.22 23.695 95-99 20.599999999999998 28.499999999999996 27.169999999999998 23.73 100-104 20.89 28.345 27.365000000000002 23.400000000000002 105-109 21.04 28.075 27.62 23.265 110-114 20.724999999999998 28.96 26.605 23.71 115-119 20.955 28.804999999999996 26.605 23.635 120-124 20.895 28.23 27.095000000000002 23.78 125-129 21.15 27.944999999999997 27.165 23.74 130-134 21.4 27.810000000000002 27.3 23.49 135-139 21.2 28.62 26.455000000000002 23.724999999999998 140-144 21.04 28.38 26.305 24.275 145-149 21.335 28.705000000000002 25.629999999999995 24.33 150-151 21.458046767537827 28.473177441540575 26.597474052769787 23.471301738151805 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.0 25 2.5 26 4.0 27 8.0 28 11.5 29 10.0 30 16.0 31 23.5 32 30.0 33 38.5 34 42.5 35 57.5 36 83.5 37 105.5 38 136.5 39 163.5 40 169.5 41 203.5 42 246.5 43 264.0 44 267.0 45 272.0 46 282.0 47 260.0 48 227.5 49 213.0 50 180.0 51 145.5 52 119.5 53 99.0 54 81.0 55 56.0 56 42.0 57 29.0 58 19.5 59 16.0 60 14.5 61 12.0 62 8.5 63 7.0 64 7.0 65 4.5 66 1.5 67 2.5 68 3.0 69 1.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.2625 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.9375 0.0 0.0 0.0 0.0 138-139 5.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGTTG 10 0.006830828 145.0 2 TCTTTGT 10 0.006830828 145.0 5 >>END_MODULE SRR7170193 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170193_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.775 33.0 33.0 34.0 32.0 34.0 2 32.94425 33.0 33.0 34.0 32.0 34.0 3 32.84525 34.0 33.0 34.0 32.0 34.0 4 32.62975 34.0 33.0 34.0 32.0 34.0 5 32.842 34.0 33.0 34.0 32.0 34.0 6 37.018 38.0 38.0 38.0 36.0 38.0 7 37.0275 38.0 38.0 38.0 36.0 38.0 8 37.0445 38.0 38.0 38.0 36.0 38.0 9 37.076 38.0 38.0 38.0 36.0 38.0 10-14 36.99335 38.0 38.0 38.0 36.0 38.0 15-19 36.84695 38.0 38.0 38.0 36.0 38.0 20-24 36.9014 38.0 38.0 38.0 36.0 38.0 25-29 36.95785 38.0 38.0 38.0 36.0 38.0 30-34 37.031850000000006 38.0 38.0 38.0 36.6 38.0 35-39 36.7745 38.0 38.0 38.0 36.0 38.0 40-44 36.6284 38.0 38.0 38.0 36.0 38.0 45-49 36.53150000000001 38.0 38.0 38.0 35.2 38.0 50-54 36.6936 38.0 38.0 38.0 35.2 38.0 55-59 36.66675000000001 38.0 38.0 38.0 35.0 38.0 60-64 36.60615 38.0 38.0 38.0 35.0 38.0 65-69 36.5657 38.0 38.0 38.0 34.8 38.0 70-74 36.541000000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.4071 38.0 38.0 38.0 34.0 38.0 80-84 36.3409 38.0 38.0 38.0 34.0 38.0 85-89 35.96045 38.0 38.0 38.0 33.4 38.0 90-94 35.57854999999999 38.0 38.0 38.0 31.0 38.0 95-99 35.811949999999996 38.0 37.6 38.0 31.2 38.0 100-104 35.87025 38.0 37.6 38.0 32.8 38.0 105-109 35.718599999999995 38.0 37.2 38.0 31.8 38.0 110-114 35.443850000000005 38.0 37.0 38.0 30.6 38.0 115-119 35.1207 38.0 36.2 38.0 28.4 38.0 120-124 35.0594 38.0 36.0 38.0 28.2 38.0 125-129 34.398799999999994 38.0 35.4 38.0 25.0 38.0 130-134 33.19885 38.0 34.4 38.0 15.8 38.0 135-139 31.93275 38.0 33.6 38.0 11.0 38.0 140-144 30.92625 38.0 32.0 38.0 2.0 38.0 145-149 30.3354 38.0 31.0 38.0 2.0 38.0 150-151 26.750875 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 5.0 4 1.0 5 3.0 6 2.0 7 3.0 8 2.0 9 3.0 10 0.0 11 2.0 12 3.0 13 3.0 14 3.0 15 4.0 16 6.0 17 6.0 18 8.0 19 7.0 20 4.0 21 17.0 22 17.0 23 28.0 24 22.0 25 26.0 26 25.0 27 37.0 28 36.0 29 69.0 30 76.0 31 96.0 32 127.0 33 160.0 34 165.0 35 239.0 36 587.0 37 2207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.05012531328321 18.32080200501253 15.6140350877193 26.015037593984964 2 25.087543771885944 26.113056528264135 32.266133066533264 16.53326663331666 3 21.650777722027094 27.170095333667838 30.58203712995484 20.597089814350227 4 24.571572580645164 34.57661290322581 20.816532258064516 20.035282258064516 5 23.575194576952047 36.95706753703239 21.767511925684158 17.70022596033141 6 20.724999999999998 36.925000000000004 22.825 19.525000000000002 7 18.525 18.525 41.15 21.8 8 21.55 23.05 26.450000000000003 28.95 9 21.875 24.5 27.650000000000002 25.974999999999998 10-14 22.60277402233238 28.61148665565069 26.79885834459967 21.986880977417258 15-19 23.382485705687632 28.026883338348878 26.993680409268734 21.596950546694753 20-24 22.69996996696366 28.150966062668935 27.865652217439184 21.28341175292822 25-29 23.43 28.115000000000002 27.450000000000003 21.005 30-34 22.975 27.810000000000002 28.144999999999996 21.07 35-39 22.28574294167795 28.13299232736573 27.696705280577703 21.884559450378617 40-44 23.35347432024169 27.361530715005035 27.89023162134945 21.394763343403827 45-49 23.266928262400643 27.638595432136032 27.839822919810846 21.25465338565248 50-54 23.022662464355395 27.570163589974484 28.26554605032768 21.141627895342438 55-59 23.235 27.884999999999998 27.905 20.974999999999998 60-64 22.134426885377074 28.685737147429485 28.160632126425284 21.019203840768153 65-69 23.949369621773066 27.341404842905742 27.98679207524515 20.722433460076044 70-74 22.835 28.050000000000004 27.875 21.240000000000002 75-79 23.82 27.37 28.04 20.77 80-84 22.755 27.985 27.875 21.385 85-89 23.365525610557718 27.638165545836074 28.05278859280983 20.94352025079638 90-94 23.28697594152878 27.652015023855448 27.971779514770073 21.089229519845702 95-99 23.937181154346305 27.0481144343303 28.328498549564866 20.686205861758527 100-104 23.73 27.544999999999998 27.665 21.060000000000002 105-109 23.735 27.77 27.810000000000002 20.685000000000002 110-114 24.03 27.58 27.77 20.62 115-119 24.060000000000002 27.935 27.325 20.68 120-124 23.805 27.565 27.77 20.86 125-129 24.14521319388576 27.493966210780368 27.307924376508446 21.052896218825424 130-134 25.308577948345608 27.071880510320508 27.051135774297276 20.568405767036616 135-139 24.213719333723592 27.161939226225318 27.42802405406844 21.196317385982653 140-144 23.962834917891097 28.02506482281763 27.3876404494382 20.624459809853068 145-149 24.83183568677792 27.876765083440308 26.48523748395379 20.806161745827982 150-151 26.229508196721312 26.986128625472887 27.112232030264817 19.672131147540984 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.5 26 1.5 27 2.5 28 6.0 29 11.0 30 13.5 31 15.0 32 20.0 33 27.5 34 41.5 35 53.5 36 73.0 37 111.0 38 138.0 39 166.0 40 201.5 41 239.0 42 250.0 43 264.0 44 283.5 45 273.5 46 279.0 47 280.0 48 247.0 49 198.5 50 169.0 51 146.0 52 117.0 53 101.0 54 78.0 55 47.5 56 33.0 57 28.0 58 23.0 59 13.0 60 6.5 61 7.5 62 9.0 63 7.5 64 3.5 65 1.0 66 1.0 67 3.0 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.05 3 0.35000000000000003 4 0.8 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.145 15-19 0.31 20-24 0.11 25-29 0.0 30-34 0.0 35-39 0.295 40-44 0.7000000000000001 45-49 0.61 50-54 0.055 55-59 0.0 60-64 0.02 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.115 90-94 1.49 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.5599999999999999 130-134 3.5900000000000003 135-139 6.045 140-144 7.4399999999999995 145-149 2.625 150-151 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.725 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.3875 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCATG 10 0.0071093175 143.075 8 >>END_MODULE Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962206 spots for SRR7170193.sra Written 962206 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra Read 962205 spots for SRR7170193.sra Written 962205 spots for SRR7170193.sra SRR ids: ['SRR7170193.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyzpk4z6 SRR7170193.sra spots: 19244101 blocks: [[1, 962205], [962206, 1924410], [1924411, 2886615], [2886616, 3848820], [3848821, 4811025], [4811026, 5773230], [5773231, 6735435], [6735436, 7697640], [7697641, 8659845], [8659846, 9622050], [9622051, 10584255], [10584256, 11546460], [11546461, 12508665], [12508666, 13470870], [13470871, 14433075], [14433076, 15395280], [15395281, 16357485], [16357486, 17319690], [17319691, 18281895], [18281896, 19244101]] SRR7170193 file size 6499494 SRR7170193 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170193 SRR7170193_1.fastq SRR7170193_2.fastq Input file: SRR7170193_1.fastq Paired file: SRR7170193_2.fastq trimmed: SRR7170193-trimmed-pair1.fastq, SRR7170193-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:34:19 2025 >> started Wed Feb 12 18:34:41 2025 >> done (22.125s) 19244101 read pairs processed; of these: 29137 ( 0.15%) short read pairs filtered out after trimming by size control 26759 ( 0.14%) empty read pairs filtered out after trimming by size control 19188205 (99.71%) read pairs available; of these: 11357415 (59.19%) trimmed read pairs available after processing 7830790 (40.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 4 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 19 0.00% 25 8 0.00% 26 4 0.00% 27 9 0.00% 28 10 0.00% 29 8 0.00% 30 15 0.00% 31 13 0.00% 32 9 0.00% 33 14 0.00% 34 7 0.00% 35 15 0.00% 36 17 0.00% 37 15 0.00% 38 27 0.00% 39 27 0.00% 40 22 0.00% 41 31 0.00% 42 39 0.00% 43 38 0.00% 44 42 0.00% 45 51 0.00% 46 55 0.00% 47 60 0.00% 48 69 0.00% 49 85 0.00% 50 108 0.00% 51 107 0.00% 52 123 0.00% 53 136 0.00% 54 148 0.00% 55 158 0.00% 56 180 0.00% 57 199 0.00% 58 238 0.00% 59 207 0.00% 60 282 0.00% 61 359 0.00% 62 357 0.00% 63 382 0.00% 64 455 0.00% 65 512 0.00% 66 561 0.00% 67 721 0.00% 68 842 0.00% 69 1001 0.01% 70 1108 0.01% 71 1120 0.01% 72 1207 0.01% 73 1336 0.01% 74 1455 0.01% 75 1630 0.01% 76 1735 0.01% 77 2060 0.01% 78 2236 0.01% 79 2566 0.01% 80 2762 0.01% 81 3367 0.02% 82 3649 0.02% 83 4017 0.02% 84 5214 0.03% 85 6232 0.03% 86 6545 0.03% 87 6879 0.04% 88 7518 0.04% 89 7830 0.04% 90 8513 0.04% 91 9006 0.05% 92 9961 0.05% 93 10812 0.06% 94 11112 0.06% 95 11981 0.06% 96 12899 0.07% 97 13317 0.07% 98 14247 0.07% 99 15012 0.08% 100 16107 0.08% 101 17047 0.09% 102 17868 0.09% 103 19069 0.10% 104 20204 0.11% 105 21629 0.11% 106 22776 0.12% 107 23797 0.12% 108 24938 0.13% 109 25705 0.13% 110 26828 0.14% 111 28353 0.15% 112 30187 0.16% 113 31989 0.17% 114 33384 0.17% 115 35186 0.18% 116 36255 0.19% 117 37981 0.20% 118 39567 0.21% 119 40907 0.21% 120 42468 0.22% 121 44964 0.23% 122 47916 0.25% 123 50819 0.26% 124 53579 0.28% 125 56284 0.29% 126 59559 0.31% 127 61931 0.32% 128 64818 0.34% 129 68220 0.36% 130 72431 0.38% 131 76866 0.40% 132 81904 0.43% 133 88501 0.46% 134 94544 0.49% 135 101691 0.53% 136 109618 0.57% 137 118585 0.62% 138 129937 0.68% 139 141823 0.74% 140 157120 0.82% 141 174222 0.91% 142 198574 1.03% 143 226173 1.18% 144 257131 1.34% 145 310059 1.62% 146 387795 2.02% 147 523426 2.73% 148 776255 4.05% 149 1383403 7.21% 150 4651877 24.24% 151 7830790 40.81% 19188205 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=41 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=6 fanout-score=53.36 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=13.8 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=7.90 fanout-score-rank=11 prefix-density=0.40 prefix-fanout=5.6 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAAAAATCAAAGCTTGGTTTCACTGTATATCCATCCCCGCAAGTTTCCACATCAGTTGTAGAGCCCTACAACAGTGTCCTTTCAACTCACTCTCTCCTTGAGCATACTGATGTTGCTGTGCTCCTTGACAATGAGGCCATCTATGACATTTGCAGGCGCTCTCTTGACATTGAGCGTCCCACTTACACCAATCTTAACCGCCTTGTTTCTCAGGTGATCTCATCTTTGACTGCCTCATTAAGGTTTGATGGAGCTCTTAATGTGGATGTTACTGAGTTCCAAACCAACTTGGTTCCATACCCCAGGATCCATTTCATGCTTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=115.46 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=13.6 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7170193 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:35:24 Started mapping on | Feb 12 18:35:25 Finished on | Feb 12 18:37:11 Mapping speed, Million of reads per hour | 651.67 Number of input reads | 19188205 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18132628 Uniquely mapped reads % | 94.50% Average mapped length | 292.34 Number of splices: Total | 16717394 Number of splices: Annotated (sjdb) | 16442542 Number of splices: GT/AG | 16492561 Number of splices: GC/AG | 180109 Number of splices: AT/AC | 14101 Number of splices: Non-canonical | 30623 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338358 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 132782 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742449 742449 742449 N_multimapping 338358 338358 338358 N_noFeature 432495 17920723 509982 N_ambiguous 207046 871 72186 UnstrandedReadsAssigned:17493087 PositiveStrandReadsAssigned:211034 NegativeStrandReadsAssigned:17550460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170193 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170193-trimmed-pair1.fastq SRR7170193-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,188,205 reads, 17,532,416 reads pseudoaligned [quant] estimated average fragment length: 257.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7170193.ke.tsv 34699 SRR7170193.se.tsv 87100 total ==> SRR7170193.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.45 328 10.9885 Potri.005G024800.1.v4.1 1035 778.445 37 2.80484 Potri.004G059700.1.v4.1 961 704.549 4 0.335029 Potri.007G009000.2.v4.1 1416 1159.45 0 0 Potri.003G141000.2.v4.1 2943 2686.45 283.058 6.21773 Potri.016G087400.1.v4.1 270 80.1562 1355 997.554 Potri.015G069301.1.v4.1 564 317.924 0 0 Potri.010G195200.1.v4.1 1773 1516.45 31 1.20634 Potri.012G127500.1.v4.1 977 720.511 4420 362.006 ==> SRR7170193.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1546 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170193 completed mapping pipeline successfully