Starting /dee2/code/volunteer_pipeline.sh SRR7170194 current disk space = 3051441909760 free memory = 1506673400 SRR7170194 SRAfilesize a2cb40d9e879b4ad95db278745cc7bec SRR7170194.sra SRR7170194.sra file validated SRR7170194 is paired end SRR7170194 is conventional basespace SRR7170194 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170194_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2485 34.0 33.0 34.0 33.0 34.0 2 33.3995 34.0 33.0 34.0 33.0 34.0 3 33.406 34.0 33.0 34.0 33.0 34.0 4 33.464 34.0 34.0 34.0 33.0 34.0 5 33.3975 34.0 33.0 34.0 33.0 34.0 6 36.85325 38.0 37.0 38.0 35.0 38.0 7 37.19325 38.0 38.0 38.0 36.0 38.0 8 37.4 38.0 38.0 38.0 37.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.3547 38.0 38.0 38.0 37.0 38.0 15-19 37.3237 38.0 38.0 38.0 37.0 38.0 20-24 37.2181 38.0 38.0 38.0 36.6 38.0 25-29 37.195299999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.1363 38.0 38.0 38.0 36.0 38.0 35-39 37.05765 38.0 38.0 38.0 35.8 38.0 40-44 36.6996 38.0 38.0 38.0 34.4 38.0 45-49 36.4674 38.0 37.6 38.0 34.0 38.0 50-54 36.368700000000004 38.0 37.2 38.0 33.6 38.0 55-59 36.283100000000005 38.0 37.0 38.0 33.0 38.0 60-64 36.16515 38.0 37.0 38.0 33.0 38.0 65-69 36.201800000000006 38.0 37.0 38.0 33.0 38.0 70-74 35.9596 38.0 37.0 38.0 32.2 38.0 75-79 35.91055 38.0 37.0 38.0 31.6 38.0 80-84 35.71625 38.0 36.4 38.0 30.2 38.0 85-89 35.58195 38.0 36.0 38.0 29.4 38.0 90-94 35.31695 38.0 36.0 38.0 28.8 38.0 95-99 35.04625 38.0 35.8 38.0 28.4 38.0 100-104 34.9287 38.0 35.6 38.0 27.8 38.0 105-109 34.77055 38.0 35.0 38.0 27.2 38.0 110-114 34.26475000000001 38.0 34.2 38.0 24.8 38.0 115-119 33.8454 38.0 34.0 38.0 22.6 38.0 120-124 33.580400000000004 38.0 34.0 38.0 18.6 38.0 125-129 33.22599999999999 37.2 33.6 38.0 15.0 38.0 130-134 32.4429 37.0 31.4 38.0 15.0 38.0 135-139 31.994799999999998 36.2 31.2 38.0 14.2 38.0 140-144 31.290399999999998 36.0 31.0 38.0 14.0 38.0 145-149 30.21755 35.8 29.2 38.0 6.4 38.0 150-151 25.059375 32.5 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 5.0 17 3.0 18 2.0 19 11.0 20 10.0 21 16.0 22 12.0 23 22.0 24 21.0 25 33.0 26 25.0 27 50.0 28 45.0 29 53.0 30 75.0 31 109.0 32 154.0 33 206.0 34 324.0 35 538.0 36 1063.0 37 1212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.55020080321285 15.110441767068272 11.320281124497992 36.019076305220885 2 20.474999999999998 20.775 36.675000000000004 22.075 3 19.825 26.875 26.400000000000002 26.900000000000002 4 23.400000000000002 34.0 21.6 21.0 5 20.525 38.025 23.599999999999998 17.849999999999998 6 17.474999999999998 36.0 26.1 20.424999999999997 7 13.600000000000001 22.75 43.824999999999996 19.825 8 18.725 22.900000000000002 30.099999999999998 28.275 9 18.475 23.400000000000002 32.725 25.4 10-14 20.064999999999998 29.81 26.145000000000003 23.98 15-19 19.915 28.675 27.860000000000003 23.549999999999997 20-24 19.985 28.88 27.705000000000002 23.43 25-29 20.599999999999998 28.68 27.584999999999997 23.135 30-34 19.715 29.49 27.365000000000002 23.43 35-39 20.424999999999997 28.365000000000002 27.894999999999996 23.315 40-44 20.585 29.275000000000002 27.24 22.900000000000002 45-49 20.064999999999998 28.645 27.915 23.375 50-54 20.794999999999998 27.76 27.575 23.87 55-59 20.369999999999997 28.685 27.46 23.485 60-64 20.47 28.24 27.51 23.78 65-69 20.495 28.439999999999998 27.694999999999997 23.369999999999997 70-74 20.325 29.13 27.115000000000002 23.43 75-79 20.62 28.849999999999998 26.815 23.715 80-84 21.135 28.595 26.650000000000002 23.62 85-89 20.830000000000002 28.044999999999998 27.175 23.95 90-94 20.081207078049022 28.512707403879894 27.099102711915386 24.3069828061557 95-99 20.371855267114363 28.124686779593066 27.337877117369953 24.165580835922622 100-104 21.07 27.96 27.855 23.115 105-109 20.655 28.53 27.435 23.380000000000003 110-114 20.599999999999998 28.845 26.790000000000003 23.765 115-119 20.979999999999997 29.645 26.22 23.155 120-124 21.525 28.15 26.72 23.605 125-129 21.099999999999998 28.02 27.355 23.525 130-134 21.289160244219797 28.74587128415574 26.779101191071963 23.185867280552497 135-139 21.12563216664163 28.536377747734214 26.403284762906214 23.934705322717942 140-144 21.21 28.660000000000004 26.445 23.685000000000002 145-149 21.285 28.535 26.384999999999998 23.794999999999998 150-151 21.875 29.062500000000004 26.150000000000002 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 2.5 26 6.5 27 10.0 28 13.0 29 14.0 30 13.5 31 25.0 32 40.5 33 42.0 34 52.5 35 75.0 36 101.5 37 117.0 38 126.5 39 158.5 40 177.5 41 192.0 42 233.5 43 262.5 44 269.5 45 283.0 46 282.0 47 257.5 48 230.0 49 190.0 50 160.0 51 133.0 52 107.0 53 93.5 54 80.5 55 66.5 56 44.0 57 32.0 58 26.5 59 22.0 60 16.5 61 8.0 62 4.5 63 4.5 64 4.0 65 3.5 66 2.5 67 1.0 68 1.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.255 95-99 0.22999999999999998 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.09 135-139 0.145 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.9500000000000002 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4625000000000004 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.8499999999999996 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.1875 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.1 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170194 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170194_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4505 33.0 33.0 34.0 32.0 34.0 2 32.59775 33.0 33.0 34.0 32.0 34.0 3 32.3595 33.0 33.0 34.0 32.0 34.0 4 32.22175 34.0 33.0 34.0 32.0 34.0 5 32.23225 34.0 33.0 34.0 32.0 34.0 6 36.45975 38.0 38.0 38.0 35.0 38.0 7 36.61175 38.0 38.0 38.0 36.0 38.0 8 36.55025 38.0 38.0 38.0 36.0 38.0 9 36.48825 38.0 38.0 38.0 36.0 38.0 10-14 36.3526 38.0 38.0 38.0 35.6 38.0 15-19 36.1764 38.0 38.0 38.0 35.2 38.0 20-24 36.236599999999996 38.0 38.0 38.0 35.2 38.0 25-29 36.28165 38.0 38.0 38.0 35.2 38.0 30-34 36.322950000000006 38.0 38.0 38.0 35.6 38.0 35-39 36.18225 38.0 38.0 38.0 35.0 38.0 40-44 35.913399999999996 38.0 38.0 38.0 34.4 38.0 45-49 35.928700000000006 38.0 38.0 38.0 34.0 38.0 50-54 36.168400000000005 38.0 38.0 38.0 34.2 38.0 55-59 36.0443 38.0 38.0 38.0 33.8 38.0 60-64 35.94515 38.0 38.0 38.0 33.8 38.0 65-69 35.94635 38.0 38.0 38.0 33.8 38.0 70-74 35.8679 38.0 38.0 38.0 33.2 38.0 75-79 35.755 38.0 38.0 38.0 32.8 38.0 80-84 35.68275 38.0 38.0 38.0 32.6 38.0 85-89 35.070550000000004 38.0 37.6 38.0 29.2 38.0 90-94 34.76925 38.0 37.0 38.0 27.6 38.0 95-99 35.186 38.0 37.0 38.0 28.8 38.0 100-104 35.20295 38.0 37.0 38.0 29.4 38.0 105-109 35.0604 38.0 37.0 38.0 28.6 38.0 110-114 34.855 38.0 36.8 38.0 27.8 38.0 115-119 34.6105 38.0 36.2 38.0 26.6 38.0 120-124 34.295 38.0 35.8 38.0 23.8 38.0 125-129 33.64619999999999 38.0 34.8 38.0 18.2 38.0 130-134 32.25075 38.0 33.8 38.0 11.2 38.0 135-139 30.987149999999996 38.0 33.0 38.0 2.0 38.0 140-144 30.039499999999997 38.0 29.2 38.0 2.0 38.0 145-149 29.32315 36.6 28.0 38.0 2.0 38.0 150-151 25.409125000000003 34.5 12.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 62.0 3 9.0 4 2.0 5 1.0 6 1.0 7 3.0 8 0.0 9 2.0 10 4.0 11 4.0 12 4.0 13 1.0 14 1.0 15 6.0 16 6.0 17 12.0 18 12.0 19 10.0 20 12.0 21 25.0 22 11.0 23 26.0 24 26.0 25 22.0 26 32.0 27 31.0 28 51.0 29 53.0 30 78.0 31 89.0 32 150.0 33 168.0 34 149.0 35 257.0 36 584.0 37 2096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5058912008022 16.921534219102533 16.06919027325144 28.50338430684382 2 23.910304862685816 24.21264802217183 35.071806500377924 16.805240614764426 3 18.75 27.87093495934959 31.834349593495936 21.544715447154474 4 23.733129615482557 34.73389355742297 21.517697988286226 20.01527883880825 5 22.894937674891885 36.0722462477741 22.869498855253116 18.163317222080895 6 18.04358844399392 37.43030917384693 24.759249873289406 19.766852508869743 7 17.848101265822784 17.89873417721519 43.949367088607595 20.303797468354432 8 22.045051885598582 21.716021260440392 28.62566438876234 27.613262465198684 9 22.71237711116713 23.342576254096294 28.510209226115453 25.434837408621124 10-14 23.01308487347895 28.318313731480067 26.719617127437502 21.948984267603482 15-19 22.928049839146198 27.3400398304652 27.687279783485675 22.044630546902926 20-24 23.20174992369519 27.69864686132872 27.55621121172042 21.543392003255672 25-29 22.714808043875685 28.143408490757665 27.635588056063376 21.50619540930327 30-34 22.9305181951987 28.163223874536875 27.736892858955486 21.16936507130894 35-39 22.890032088830033 28.253450822594612 27.4588702694443 21.397646819131054 40-44 22.580975809758097 27.982779827798275 28.444034440344403 20.99220992209922 45-49 22.643149284253578 27.326175869120657 28.26687116564417 21.763803680981596 50-54 23.1732670757061 27.483393337051876 27.96511333096699 21.37822625627504 55-59 23.23068337476536 27.015372127238596 28.339505859672265 21.41443863832378 60-64 23.389106443574224 27.95605960433301 27.991659461933583 20.663174490159182 65-69 23.858868725673556 27.7814284992165 27.73088004852651 20.62882272658343 70-74 23.625572154318196 27.931190583974647 27.92113072783059 20.522106533876567 75-79 23.03356650395048 27.356449096673547 28.55920688440441 21.050777514971568 80-84 23.40823970037453 27.188986739548536 28.19111246077538 21.211661099301548 85-89 23.61526560082517 27.472924187725635 27.617328519855594 21.294481691593607 90-94 23.83363471971067 27.744768793593387 27.703435804701627 20.718160681994316 95-99 23.829571392340856 27.6946487446107 27.75044382449911 20.725336038549326 100-104 23.853908110024822 27.166810191986222 28.063421305911557 20.915860392077402 105-109 23.505854919653267 27.104983018198407 28.428042784001622 20.961119278146704 110-114 24.097912021082504 28.157307926211228 27.48327589702007 20.261504155686193 115-119 24.148716137819704 27.91706603440448 27.230994299551025 20.70322352822479 120-124 24.227192762000502 27.353606433777333 27.429002261874842 20.990198542347326 125-129 24.384764627795363 27.9179005412029 27.28990094965792 20.407433881343817 130-134 24.932650150546724 27.71644392794887 27.309703660662404 20.041202260842006 135-139 24.96199782844734 28.19761129207383 27.003257328990227 19.837133550488602 140-144 25.122340133062078 27.72309891680871 27.596634959036674 19.55792599109254 145-149 24.956871765382406 27.51842751842752 26.76041612211825 20.764284594071828 150-151 25.40312260046071 28.346557460967492 26.55490145891989 19.69541847965191 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 4.0 2 4.5 3 7.0 4 5.5 5 4.5 6 5.0 7 3.5 8 2.0 9 3.0 10 5.0 11 3.5 12 1.0 13 1.0 14 1.5 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.0 24 6.0 25 4.0 26 3.5 27 6.0 28 6.5 29 6.5 30 12.0 31 21.0 32 28.5 33 35.5 34 38.5 35 50.5 36 78.5 37 99.5 38 119.0 39 162.5 40 205.0 41 216.0 42 233.0 43 265.5 44 270.5 45 267.5 46 262.5 47 263.0 48 251.5 49 200.0 50 161.0 51 140.0 52 118.5 53 97.0 54 75.5 55 59.5 56 45.5 57 32.5 58 22.0 59 18.0 60 15.0 61 10.0 62 7.5 63 4.5 64 2.0 65 3.0 66 3.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.775 3 1.6 4 1.825 5 1.725 6 1.35 7 1.25 8 1.225 9 0.8250000000000001 10-14 1.7950000000000002 15-19 2.085 20-24 1.71 25-29 1.54 30-34 1.485 35-39 1.8350000000000002 40-44 2.44 45-49 2.1999999999999997 50-54 1.395 55-59 1.4449999999999998 60-64 1.685 65-69 1.085 70-74 0.5950000000000001 75-79 0.645 80-84 1.21 85-89 3.05 90-94 3.225 95-99 1.425 100-104 1.295 105-109 1.365 110-114 1.34 115-119 0.885 120-124 0.525 125-129 2.07 130-134 5.345 135-139 7.9 140-144 9.065 145-149 4.3549999999999995 150-151 2.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42021678850517 98.6 2 0.4789513486261659 0.95 3 0.025207965717166627 0.075 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4124999999999996 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.012499999999999 0.0 0.0 0.0 0.0 126-127 5.3 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 7.9125000000000005 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAAT 10 0.0072505553 142.11392 1 GAAGGAA 10 0.0072505553 142.11392 4 >>END_MODULE Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962844 spots for SRR7170194.sra Written 962844 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra Read 962843 spots for SRR7170194.sra Written 962843 spots for SRR7170194.sra SRR ids: ['SRR7170194.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kx2orccm SRR7170194.sra spots: 19256861 blocks: [[1, 962843], [962844, 1925686], [1925687, 2888529], [2888530, 3851372], [3851373, 4814215], [4814216, 5777058], [5777059, 6739901], [6739902, 7702744], [7702745, 8665587], [8665588, 9628430], [9628431, 10591273], [10591274, 11554116], [11554117, 12516959], [12516960, 13479802], [13479803, 14442645], [14442646, 15405488], [15405489, 16368331], [16368332, 17331174], [17331175, 18294017], [18294018, 19256861]] SRR7170194 file size 6503817 SRR7170194 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170194 SRR7170194_1.fastq SRR7170194_2.fastq Input file: SRR7170194_1.fastq Paired file: SRR7170194_2.fastq trimmed: SRR7170194-trimmed-pair1.fastq, SRR7170194-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:02:44 2025 >> started Wed Feb 12 18:03:08 2025 >> done (24.780s) 19256861 read pairs processed; of these: 29510 ( 0.15%) short read pairs filtered out after trimming by size control 35495 ( 0.18%) empty read pairs filtered out after trimming by size control 19191856 (99.66%) read pairs available; of these: 11259877 (58.67%) trimmed read pairs available after processing 7931979 (41.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 8 0.00% 27 12 0.00% 28 12 0.00% 29 9 0.00% 30 10 0.00% 31 13 0.00% 32 19 0.00% 33 13 0.00% 34 17 0.00% 35 23 0.00% 36 20 0.00% 37 26 0.00% 38 30 0.00% 39 26 0.00% 40 32 0.00% 41 48 0.00% 42 42 0.00% 43 48 0.00% 44 54 0.00% 45 73 0.00% 46 83 0.00% 47 98 0.00% 48 115 0.00% 49 124 0.00% 50 151 0.00% 51 167 0.00% 52 211 0.00% 53 255 0.00% 54 246 0.00% 55 273 0.00% 56 316 0.00% 57 358 0.00% 58 412 0.00% 59 475 0.00% 60 534 0.00% 61 601 0.00% 62 729 0.00% 63 807 0.00% 64 950 0.00% 65 985 0.01% 66 1169 0.01% 67 1340 0.01% 68 1616 0.01% 69 1900 0.01% 70 2368 0.01% 71 2634 0.01% 72 2860 0.01% 73 3027 0.02% 74 3465 0.02% 75 3700 0.02% 76 3973 0.02% 77 4541 0.02% 78 4990 0.03% 79 5775 0.03% 80 6229 0.03% 81 7309 0.04% 82 8457 0.04% 83 9223 0.05% 84 10979 0.06% 85 12184 0.06% 86 12751 0.07% 87 13389 0.07% 88 14066 0.07% 89 14735 0.08% 90 15809 0.08% 91 17476 0.09% 92 18678 0.10% 93 20519 0.11% 94 21484 0.11% 95 22653 0.12% 96 23621 0.12% 97 24076 0.13% 98 25076 0.13% 99 26212 0.14% 100 28048 0.15% 101 29094 0.15% 102 31472 0.16% 103 33071 0.17% 104 34232 0.18% 105 36033 0.19% 106 37210 0.19% 107 37589 0.20% 108 39144 0.20% 109 39646 0.21% 110 40938 0.21% 111 42419 0.22% 112 45115 0.24% 113 47126 0.25% 114 49180 0.26% 115 51800 0.27% 116 52938 0.28% 117 53673 0.28% 118 54527 0.28% 119 55980 0.29% 120 57809 0.30% 121 60646 0.32% 122 62885 0.33% 123 66182 0.34% 124 69603 0.36% 125 72296 0.38% 126 74945 0.39% 127 76313 0.40% 128 78337 0.41% 129 81138 0.42% 130 84015 0.44% 131 87485 0.46% 132 93043 0.48% 133 98321 0.51% 134 103600 0.54% 135 110105 0.57% 136 116852 0.61% 137 124243 0.65% 138 132541 0.69% 139 141379 0.74% 140 151913 0.79% 141 164812 0.86% 142 182342 0.95% 143 200577 1.05% 144 230775 1.20% 145 271727 1.42% 146 332694 1.73% 147 440846 2.30% 148 644632 3.36% 149 1182545 6.16% 150 4449305 23.18% 151 7931979 41.33% 19191856 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=44 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=215.05 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.18 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=58.98 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7170194 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:03:58 Started mapping on | Feb 12 18:03:59 Finished on | Feb 12 18:06:08 Mapping speed, Million of reads per hour | 535.59 Number of input reads | 19191856 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18295899 Uniquely mapped reads % | 95.33% Average mapped length | 289.62 Number of splices: Total | 16907878 Number of splices: Annotated (sjdb) | 16632637 Number of splices: GT/AG | 16664415 Number of splices: GC/AG | 194316 Number of splices: AT/AC | 13598 Number of splices: Non-canonical | 35549 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320076 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 29807 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 595323 595323 595323 N_multimapping 320076 320076 320076 N_noFeature 429642 18094314 520162 N_ambiguous 181247 1351 69115 UnstrandedReadsAssigned:17685010 PositiveStrandReadsAssigned:200234 NegativeStrandReadsAssigned:17706622 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170194 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170194-trimmed-pair1.fastq SRR7170194-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,191,856 reads, 17,600,776 reads pseudoaligned [quant] estimated average fragment length: 227.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7170194.ke.tsv 34699 SRR7170194.se.tsv 87100 total ==> SRR7170194.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.5 306 10.2837 Potri.005G024800.1.v4.1 1035 808.498 44 3.27657 Potri.004G059700.1.v4.1 961 734.551 4 0.327856 Potri.007G009000.2.v4.1 1416 1189.5 0 0 Potri.003G141000.2.v4.1 2943 2716.5 330.063 7.31529 Potri.016G087400.1.v4.1 270 90.3634 2043 1361.2 Potri.015G069301.1.v4.1 564 343.089 0 0 Potri.010G195200.1.v4.1 1773 1546.5 32 1.24579 Potri.012G127500.1.v4.1 977 750.531 4454 357.295 ==> SRR7170194.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1186 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170194 completed mapping pipeline successfully