Starting /dee2/code/volunteer_pipeline.sh SRR7170195 current disk space = 3051431743488 free memory = 995637452 SRR7170195 SRAfilesize 612813c30908d0bc910bd7171544f7a1 SRR7170195.sra SRR7170195.sra file validated SRR7170195 is paired end SRR7170195 is conventional basespace SRR7170195 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170195_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0055 34.0 33.0 34.0 33.0 34.0 2 33.36925 34.0 33.0 34.0 33.0 34.0 3 33.4255 34.0 33.0 34.0 33.0 34.0 4 33.42425 34.0 33.0 34.0 33.0 34.0 5 33.326 34.0 33.0 34.0 33.0 34.0 6 37.10275 38.0 37.0 38.0 36.0 38.0 7 35.624 38.0 37.0 38.0 29.0 38.0 8 37.0425 38.0 38.0 38.0 36.0 38.0 9 37.433 38.0 38.0 38.0 37.0 38.0 10-14 37.03679999999999 38.0 37.8 38.0 35.4 38.0 15-19 37.404399999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.540350000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.494899999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.5103 38.0 38.0 38.0 38.0 38.0 35-39 37.4226 38.0 38.0 38.0 37.6 38.0 40-44 37.31425 38.0 38.0 38.0 37.0 38.0 45-49 36.3249 38.0 37.4 38.0 32.4 38.0 50-54 36.8812 38.0 37.8 38.0 35.2 38.0 55-59 37.020450000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.052499999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.02375 38.0 38.0 38.0 36.0 38.0 70-74 36.1094 38.0 37.4 38.0 31.8 38.0 75-79 36.77525 38.0 38.0 38.0 35.2 38.0 80-84 36.8001 38.0 38.0 38.0 35.2 38.0 85-89 36.575 38.0 38.0 38.0 34.6 38.0 90-94 36.50835 38.0 38.0 38.0 34.4 38.0 95-99 36.497 38.0 38.0 38.0 34.4 38.0 100-104 36.3825 38.0 38.0 38.0 34.2 38.0 105-109 36.0941 38.0 37.6 38.0 33.4 38.0 110-114 36.017399999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.828450000000004 38.0 36.8 38.0 32.2 38.0 120-124 35.78175 38.0 37.0 38.0 32.2 38.0 125-129 35.527950000000004 38.0 36.2 38.0 31.0 38.0 130-134 35.30485 38.0 36.0 38.0 30.6 38.0 135-139 35.123000000000005 38.0 36.0 38.0 29.6 38.0 140-144 34.6182 38.0 35.0 38.0 27.2 38.0 145-149 34.2754 38.0 35.0 38.0 26.6 38.0 150-151 30.426375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 1.0 12 2.0 13 2.0 14 0.0 15 2.0 16 2.0 17 4.0 18 5.0 19 9.0 20 5.0 21 4.0 22 7.0 23 9.0 24 5.0 25 11.0 26 18.0 27 20.0 28 23.0 29 33.0 30 45.0 31 56.0 32 56.0 33 96.0 34 162.0 35 272.0 36 696.0 37 2452.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.132591093117405 14.397773279352228 12.474696356275304 34.99493927125506 2 21.45 19.1 33.75 25.7 3 20.724999999999998 25.7 24.45 29.125 4 23.075000000000003 31.55 22.5 22.875 5 20.355533299949926 36.50475713570355 24.086129193790686 19.053580370555835 6 17.875 37.75 24.725 19.650000000000002 7 13.950000000000001 24.525 42.55 18.975 8 18.475 24.625 29.099999999999998 27.800000000000004 9 17.175 25.025 31.974999999999998 25.825 10-14 19.735 30.925000000000004 26.365 22.975 15-19 19.615 29.29 27.255000000000003 23.84 20-24 19.705000000000002 29.68 27.384999999999998 23.23 25-29 19.68 29.759999999999998 27.0 23.56 30-34 19.85 29.404999999999998 26.900000000000002 23.845 35-39 19.615 30.055 26.87 23.46 40-44 19.91 29.115000000000002 27.22 23.755000000000003 45-49 20.39 29.53 26.605 23.474999999999998 50-54 19.96 28.99 27.41 23.64 55-59 19.935 28.625 27.51 23.93 60-64 20.22 29.095 27.075 23.61 65-69 20.11 28.884999999999998 26.605 24.4 70-74 19.814999999999998 28.939999999999998 26.75 24.495 75-79 20.560000000000002 28.655 26.729999999999997 24.055 80-84 20.285 28.939999999999998 26.724999999999998 24.05 85-89 20.765 28.4 26.86 23.974999999999998 90-94 20.7 28.53 26.845000000000002 23.925 95-99 20.275000000000002 28.33 27.055 24.34 100-104 21.255 28.544999999999998 26.435 23.765 105-109 20.544999999999998 29.189999999999998 26.419999999999998 23.845 110-114 20.535 28.915000000000003 26.840000000000003 23.71 115-119 20.325 28.395 26.87 24.41 120-124 21.305 28.685 26.375 23.635 125-129 21.21 28.84 25.905 24.044999999999998 130-134 21.154999999999998 28.485 26.479999999999997 23.880000000000003 135-139 20.65 29.23 26.11 24.01 140-144 20.981049052452622 28.48642432121606 26.351317565878297 24.181209060453025 145-149 21.095 27.975 26.555 24.375 150-151 20.878158618964225 28.596447335501622 26.294721040780583 24.230673004753562 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 2.5 21 2.5 22 2.0 23 2.0 24 2.0 25 3.0 26 3.5 27 8.0 28 13.0 29 16.0 30 22.5 31 36.5 32 46.5 33 51.0 34 65.0 35 89.0 36 100.0 37 120.0 38 141.0 39 149.0 40 169.5 41 199.5 42 223.5 43 236.5 44 246.5 45 245.5 46 246.0 47 247.5 48 223.5 49 180.5 50 154.0 51 124.0 52 118.5 53 118.0 54 89.0 55 70.5 56 55.5 57 44.0 58 33.0 59 22.0 60 16.0 61 13.5 62 12.0 63 10.0 64 6.5 65 2.5 66 2.0 67 2.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16519099418163 98.0 2 0.6577283076144701 1.3 3 0.12648621300278268 0.375 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025297242600556536 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAACATATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.9625000000000001 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.475 0.0 0.0 0.0 0.0 118-119 3.9000000000000004 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.425000000000001 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGGA 10 0.006577216 146.82278 1 >>END_MODULE SRR7170195 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170195_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.951 33.0 33.0 34.0 32.0 34.0 2 33.09125 34.0 33.0 34.0 33.0 34.0 3 32.9885 34.0 33.0 34.0 33.0 34.0 4 32.922 34.0 33.0 34.0 32.0 34.0 5 32.959 34.0 33.0 34.0 32.0 34.0 6 37.0795 38.0 38.0 38.0 37.0 38.0 7 37.097 38.0 38.0 38.0 37.0 38.0 8 36.93275 38.0 38.0 38.0 37.0 38.0 9 37.02075 38.0 38.0 38.0 37.0 38.0 10-14 36.953199999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.0219 38.0 38.0 38.0 37.0 38.0 20-24 36.88289999999999 38.0 38.0 38.0 36.4 38.0 25-29 36.87564999999999 38.0 38.0 38.0 36.6 38.0 30-34 36.86205 38.0 38.0 38.0 36.8 38.0 35-39 36.7738 38.0 38.0 38.0 36.2 38.0 40-44 36.781600000000005 38.0 38.0 38.0 36.2 38.0 45-49 36.8143 38.0 38.0 38.0 36.4 38.0 50-54 36.81505 38.0 38.0 38.0 36.4 38.0 55-59 36.785849999999996 38.0 38.0 38.0 36.4 38.0 60-64 36.849650000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.78825 38.0 38.0 38.0 36.6 38.0 70-74 36.587199999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.28415 38.0 38.0 38.0 34.6 38.0 80-84 36.404349999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.50020000000001 38.0 38.0 38.0 35.2 38.0 90-94 36.42999999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.426199999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.33125 38.0 38.0 38.0 34.4 38.0 105-109 36.17815 38.0 38.0 38.0 34.0 38.0 110-114 35.96015 38.0 38.0 38.0 34.0 38.0 115-119 35.916399999999996 38.0 38.0 38.0 33.8 38.0 120-124 35.74965 38.0 38.0 38.0 33.2 38.0 125-129 35.5797 38.0 37.4 38.0 32.0 38.0 130-134 35.13 38.0 36.4 38.0 29.2 38.0 135-139 34.881 38.0 36.0 38.0 28.8 38.0 140-144 34.65365 38.0 36.0 38.0 27.8 38.0 145-149 33.91635 38.0 34.8 38.0 21.8 38.0 150-151 29.892250000000004 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 9.0 4 5.0 5 4.0 6 0.0 7 0.0 8 2.0 9 0.0 10 4.0 11 5.0 12 1.0 13 3.0 14 2.0 15 3.0 16 10.0 17 7.0 18 6.0 19 3.0 20 7.0 21 8.0 22 2.0 23 12.0 24 11.0 25 14.0 26 21.0 27 20.0 28 22.0 29 27.0 30 39.0 31 54.0 32 62.0 33 72.0 34 106.0 35 223.0 36 474.0 37 2750.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025 16.925 18.15 25.900000000000002 2 27.250000000000004 24.675 30.55 17.525 3 22.75 28.975 29.025000000000002 19.25 4 26.974999999999998 32.9 21.05 19.075 5 24.6 35.55 21.075 18.775 6 21.025 36.925000000000004 23.200000000000003 18.85 7 20.849999999999998 19.975 38.45 20.724999999999998 8 22.6 24.375 26.125 26.900000000000002 9 23.05 25.05 27.950000000000003 23.95 10-14 23.525 28.715000000000003 25.695 22.065 15-19 24.635 27.785 26.47 21.11 20-24 23.56 28.18 27.1 21.16 25-29 24.285 28.08 26.995 20.64 30-34 23.86 28.09 27.284999999999997 20.765 35-39 24.224999999999998 27.229999999999997 27.235 21.310000000000002 40-44 24.184836967393476 27.720544108821766 26.875375075015 21.219243848769754 45-49 23.767376737673768 26.832683268326836 27.647764776477647 21.752175217521753 50-54 23.455000000000002 27.375 27.67 21.5 55-59 24.665 27.310000000000002 27.169999999999998 20.855 60-64 23.71 27.884999999999998 27.500000000000004 20.905 65-69 23.62 27.785 27.855 20.74 70-74 23.68 27.665 27.29 21.365000000000002 75-79 24.601230061503074 26.871343567178357 27.43637181859093 21.091054552727638 80-84 23.830000000000002 27.13 27.855 21.185000000000002 85-89 24.310000000000002 27.575 28.035 20.080000000000002 90-94 23.93 27.400000000000002 28.225 20.445 95-99 24.25 27.375 27.67 20.705000000000002 100-104 24.18 27.1 27.965 20.755000000000003 105-109 24.445 27.515 27.689999999999998 20.349999999999998 110-114 24.555 26.979999999999997 27.955000000000002 20.51 115-119 24.884999999999998 27.73 27.18 20.205000000000002 120-124 24.735 27.41 27.755000000000003 20.1 125-129 24.795 27.625 27.33 20.25 130-134 25.11 27.875 27.195000000000004 19.82 135-139 25.335 27.38 27.139999999999997 20.145 140-144 24.852485248524854 27.527752775277527 27.22772277227723 20.392039203920394 145-149 25.81 27.205000000000002 26.91 20.075000000000003 150-151 25.77009767092412 27.73603806661658 27.160030052592038 19.333834209867266 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 1.5 27 1.0 28 3.0 29 6.5 30 7.5 31 11.0 32 15.5 33 22.0 34 28.5 35 47.5 36 72.0 37 83.0 38 101.0 39 146.0 40 182.0 41 225.5 42 257.0 43 253.0 44 271.0 45 269.0 46 266.5 47 266.5 48 247.0 49 222.0 50 181.5 51 147.5 52 135.0 53 125.5 54 103.0 55 76.0 56 56.0 57 40.0 58 31.0 59 21.5 60 12.0 61 14.0 62 11.5 63 8.5 64 7.0 65 3.0 66 2.5 67 3.5 68 2.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29310780106034 98.32499999999999 2 0.5806614491290077 1.15 3 0.07573844988639232 0.22499999999999998 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025246149962130777 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.1375000000000002 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820198 spots for SRR7170195.sra Written 820198 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra Read 820193 spots for SRR7170195.sra Written 820193 spots for SRR7170195.sra SRR ids: ['SRR7170195.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n0zfpxsw SRR7170195.sra spots: 16403865 blocks: [[1, 820193], [820194, 1640386], [1640387, 2460579], [2460580, 3280772], [3280773, 4100965], [4100966, 4921158], [4921159, 5741351], [5741352, 6561544], [6561545, 7381737], [7381738, 8201930], [8201931, 9022123], [9022124, 9842316], [9842317, 10662509], [10662510, 11482702], [11482703, 12302895], [12302896, 13123088], [13123089, 13943281], [13943282, 14763474], [14763475, 15583667], [15583668, 16403865]] SRR7170195 file size 5537031 SRR7170195 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170195 SRR7170195_1.fastq SRR7170195_2.fastq Input file: SRR7170195_1.fastq Paired file: SRR7170195_2.fastq trimmed: SRR7170195-trimmed-pair1.fastq, SRR7170195-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:02:11 2025 >> started Wed Feb 12 18:02:31 2025 >> done (20.285s) 16403865 read pairs processed; of these: 35880 ( 0.22%) short read pairs filtered out after trimming by size control 61749 ( 0.38%) empty read pairs filtered out after trimming by size control 16306236 (99.40%) read pairs available; of these: 7438433 (45.62%) trimmed read pairs available after processing 8867803 (54.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 13 0.00% 23 6 0.00% 24 4 0.00% 25 11 0.00% 26 9 0.00% 27 10 0.00% 28 14 0.00% 29 33 0.00% 30 20 0.00% 31 9 0.00% 32 17 0.00% 33 15 0.00% 34 21 0.00% 35 24 0.00% 36 31 0.00% 37 32 0.00% 38 27 0.00% 39 29 0.00% 40 35 0.00% 41 40 0.00% 42 36 0.00% 43 57 0.00% 44 55 0.00% 45 64 0.00% 46 78 0.00% 47 71 0.00% 48 88 0.00% 49 122 0.00% 50 103 0.00% 51 137 0.00% 52 133 0.00% 53 144 0.00% 54 170 0.00% 55 167 0.00% 56 196 0.00% 57 267 0.00% 58 261 0.00% 59 329 0.00% 60 356 0.00% 61 356 0.00% 62 402 0.00% 63 436 0.00% 64 532 0.00% 65 713 0.00% 66 811 0.00% 67 881 0.01% 68 1167 0.01% 69 2623 0.02% 70 4329 0.03% 71 3168 0.02% 72 2202 0.01% 73 2051 0.01% 74 2067 0.01% 75 2285 0.01% 76 2368 0.01% 77 2670 0.02% 78 2970 0.02% 79 3313 0.02% 80 3740 0.02% 81 4201 0.03% 82 4978 0.03% 83 5561 0.03% 84 7639 0.05% 85 8926 0.05% 86 9435 0.06% 87 10188 0.06% 88 10681 0.07% 89 10777 0.07% 90 11828 0.07% 91 12859 0.08% 92 13436 0.08% 93 14732 0.09% 94 15017 0.09% 95 15763 0.10% 96 16564 0.10% 97 17137 0.11% 98 17474 0.11% 99 18677 0.11% 100 19753 0.12% 101 20944 0.13% 102 21605 0.13% 103 23294 0.14% 104 24361 0.15% 105 25978 0.16% 106 26181 0.16% 107 27186 0.17% 108 27599 0.17% 109 28999 0.18% 110 29878 0.18% 111 31295 0.19% 112 32831 0.20% 113 34965 0.21% 114 36114 0.22% 115 37380 0.23% 116 38234 0.23% 117 38342 0.24% 118 39252 0.24% 119 39758 0.24% 120 41822 0.26% 121 42625 0.26% 122 44796 0.27% 123 46536 0.29% 124 48653 0.30% 125 49683 0.30% 126 51556 0.32% 127 52196 0.32% 128 53480 0.33% 129 54781 0.34% 130 56256 0.34% 131 57854 0.35% 132 60834 0.37% 133 63476 0.39% 134 67134 0.41% 135 70491 0.43% 136 73234 0.45% 137 76846 0.47% 138 80578 0.49% 139 83662 0.51% 140 86328 0.53% 141 92989 0.57% 142 99972 0.61% 143 110107 0.68% 144 125869 0.77% 145 145631 0.89% 146 174114 1.07% 147 225681 1.38% 148 327859 2.01% 149 603942 3.70% 150 3397289 20.83% 151 8867803 54.38% 16306236 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=35.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=CACTGCTTGTACGTACACGGTTTCAGGTTCTTTTTCACTCCCCTCGCCGGGGTTCTTTTCGCCTTTCCCTCACGGTACTGGTTCACTATCGGTCAGTCAGGAGTATTTAGCCTTGGAGGATGGTCCCCCCATATTCAGACAGGATACCACGTGTCCCGCCCTACTCATCGAGCTCACAGCATGTGCATTTTTGTGTACGGGGCTGTCACCCTGTATCGCGCGCCTTTCCAGACGCTTCCACTAACACACACACTGATTCAGGCTCTGGGCTGCTCCCCGTTCGCTCGCCGCTACTGGGGGAATCTCGGTTGATTTCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.44 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=3.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=64.19 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.4 sequence=GAAAATGGAGGCAATGAAAATGAAGATCTTTGTTGTGTTGATGGTGGTCTTGATGGCCTTCTCAACCATGCAAAAGGCTGCAGCTGCCGATGCACCAGCACCAAGCCCAACATCTGATGCCACTATCTTTGTTCCCACGTTCTTGGCATCTCTTGTTGCTCTTGCTTTCGGGTTGCTCTTTTGAGCCAACT SRR7170195 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:03:22 Started mapping on | Feb 12 18:03:23 Finished on | Feb 12 18:06:35 Mapping speed, Million of reads per hour | 305.74 Number of input reads | 16306236 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14551570 Uniquely mapped reads % | 89.24% Average mapped length | 292.10 Number of splices: Total | 12262913 Number of splices: Annotated (sjdb) | 12036078 Number of splices: GT/AG | 12084502 Number of splices: GC/AG | 139845 Number of splices: AT/AC | 10650 Number of splices: Non-canonical | 27916 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294745 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 33587 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.68% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1490441 1490441 1490441 N_multimapping 294745 294745 294745 N_noFeature 295544 14360405 358696 N_ambiguous 187152 829 58649 UnstrandedReadsAssigned:14068874 PositiveStrandReadsAssigned:190336 NegativeStrandReadsAssigned:14134225 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170195 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170195-trimmed-pair1.fastq SRR7170195-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,306,236 reads, 14,136,599 reads pseudoaligned [quant] estimated average fragment length: 226.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7170195.ke.tsv 34699 SRR7170195.se.tsv 87100 total ==> SRR7170195.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.59 261 8.86631 Potri.005G024800.1.v4.1 1035 809.587 42 3.15914 Potri.004G059700.1.v4.1 961 735.592 3 0.248352 Potri.007G009000.2.v4.1 1416 1190.59 0 0 Potri.003G141000.2.v4.1 2943 2717.59 219 4.90731 Potri.016G087400.1.v4.1 270 85.5495 1809.1 1287.74 Potri.015G069301.1.v4.1 564 341.085 0 0 Potri.010G195200.1.v4.1 1773 1547.59 32 1.25915 Potri.012G127500.1.v4.1 977 751.592 5511 446.51 ==> SRR7170195.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1021 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170195 completed mapping pipeline successfully