Starting /dee2/code/volunteer_pipeline.sh SRR7170196 current disk space = 3051153772544 free memory = 1566684788 SRR7170196 SRAfilesize 039215466ca7a68fc4dbac84a2ba3f67 SRR7170196.sra SRR7170196.sra file validated SRR7170196 is paired end SRR7170196 is conventional basespace SRR7170196 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170196_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.855 34.0 33.0 34.0 33.0 34.0 2 33.35425 34.0 33.0 34.0 33.0 34.0 3 33.43225 34.0 34.0 34.0 33.0 34.0 4 33.413 34.0 33.0 34.0 33.0 34.0 5 33.39 34.0 34.0 34.0 33.0 34.0 6 36.987 38.0 37.0 38.0 36.0 38.0 7 37.27275 38.0 38.0 38.0 36.0 38.0 8 37.327 38.0 38.0 38.0 37.0 38.0 9 37.4445 38.0 38.0 38.0 37.0 38.0 10-14 37.39305 38.0 38.0 38.0 37.0 38.0 15-19 37.35875 38.0 38.0 38.0 37.0 38.0 20-24 37.27975 38.0 38.0 38.0 37.0 38.0 25-29 37.245 38.0 38.0 38.0 36.6 38.0 30-34 37.17075 38.0 38.0 38.0 36.6 38.0 35-39 37.061350000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.7084 38.0 38.0 38.0 34.8 38.0 45-49 36.59245 38.0 38.0 38.0 34.0 38.0 50-54 36.41585 38.0 37.4 38.0 33.8 38.0 55-59 36.3405 38.0 37.2 38.0 33.6 38.0 60-64 36.2294 38.0 37.0 38.0 33.2 38.0 65-69 36.08075 38.0 37.0 38.0 32.6 38.0 70-74 36.0141 38.0 37.0 38.0 32.8 38.0 75-79 35.89135 38.0 37.0 38.0 31.8 38.0 80-84 35.78365 38.0 37.0 38.0 31.0 38.0 85-89 35.60545 38.0 36.4 38.0 29.4 38.0 90-94 35.3709 38.0 36.0 38.0 29.0 38.0 95-99 35.177800000000005 38.0 36.0 38.0 28.8 38.0 100-104 34.8834 38.0 35.8 38.0 27.4 38.0 105-109 34.57355 38.0 35.0 38.0 26.2 38.0 110-114 34.33105 38.0 34.6 38.0 24.8 38.0 115-119 33.9818 38.0 34.0 38.0 22.6 38.0 120-124 33.68185 38.0 34.0 38.0 21.0 38.0 125-129 33.0226 38.0 33.4 38.0 15.0 38.0 130-134 32.607499999999995 37.2 32.6 38.0 15.0 38.0 135-139 32.12025 36.6 31.6 38.0 14.4 38.0 140-144 31.308250000000005 36.0 31.0 38.0 13.8 38.0 145-149 29.775299999999998 35.0 27.8 38.0 6.4 38.0 150-151 24.80475 33.0 13.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 3.0 13 3.0 14 3.0 15 4.0 16 9.0 17 5.0 18 19.0 19 6.0 20 8.0 21 12.0 22 12.0 23 15.0 24 23.0 25 26.0 26 35.0 27 44.0 28 40.0 29 50.0 30 83.0 31 110.0 32 122.0 33 197.0 34 298.0 35 511.0 36 1062.0 37 1296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.34300993124523 15.176979882862234 10.109498344792463 35.370511841100075 2 20.690517888416313 22.141606204653492 37.25293970477858 19.914936202151615 3 19.25 27.800000000000004 26.424999999999997 26.525 4 22.575 35.75 22.325 19.35 5 21.54308617234469 36.77354709418837 23.897795591182362 17.78557114228457 6 17.575 37.125 25.324999999999996 19.975 7 13.725000000000001 22.650000000000002 43.475 20.150000000000002 8 17.325 24.05 30.875000000000004 27.750000000000004 9 18.025 23.65 31.874999999999996 26.450000000000003 10-14 20.11 29.38 26.905 23.605 15-19 20.1 28.665000000000003 27.68 23.555 20-24 19.865 29.125 27.455000000000002 23.555 25-29 20.11 29.525000000000002 27.165 23.200000000000003 30-34 20.205000000000002 29.12 27.51 23.165 35-39 20.29 29.044999999999998 27.36 23.305 40-44 19.425 29.549999999999997 27.13 23.895 45-49 19.765 29.244999999999997 27.145000000000003 23.845 50-54 20.055 28.88 27.169999999999998 23.895 55-59 20.345 28.76 27.450000000000003 23.445 60-64 19.81 29.005 27.310000000000002 23.875 65-69 19.965 29.304999999999996 27.095000000000002 23.635 70-74 20.169999999999998 29.21 26.974999999999998 23.645 75-79 20.405 28.83 27.474999999999998 23.29 80-84 20.185 29.005 27.04 23.77 85-89 19.775000000000002 29.12 27.435 23.669999999999998 90-94 20.325 29.604999999999997 26.71 23.36 95-99 20.330000000000002 28.439999999999998 27.755000000000003 23.474999999999998 100-104 20.51 28.58 27.375 23.535 105-109 20.505000000000003 28.815 27.455000000000002 23.225 110-114 20.615 28.84 27.025 23.52 115-119 20.22 28.99 26.584999999999997 24.205 120-124 21.68 28.63 26.640000000000004 23.05 125-129 20.34 28.83 27.305 23.525 130-134 20.69 29.07 26.69 23.549999999999997 135-139 20.880000000000003 28.76 26.729999999999997 23.630000000000003 140-144 20.979999999999997 29.025000000000002 26.075 23.919999999999998 145-149 20.53 29.085 26.515 23.87 150-151 20.795682730923694 28.915662650602407 26.618975903614455 23.669678714859437 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 2.0 21 2.0 22 1.0 23 1.0 24 2.5 25 3.5 26 4.0 27 10.5 28 15.0 29 17.5 30 21.0 31 29.5 32 42.0 33 52.0 34 62.0 35 73.0 36 86.5 37 111.5 38 142.0 39 161.5 40 185.0 41 223.0 42 261.5 43 269.5 44 263.0 45 263.0 46 262.0 47 228.0 48 220.0 49 200.5 50 159.0 51 150.0 52 118.5 53 93.0 54 60.5 55 42.0 56 39.5 57 31.5 58 24.5 59 15.0 60 12.0 61 8.5 62 5.0 63 3.5 64 3.0 65 4.0 66 2.5 67 0.5 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.075 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.1624999999999996 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.324999999999999 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.050000000000001 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170196 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170196_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.859 33.0 33.0 34.0 32.0 34.0 2 33.05225 34.0 33.0 34.0 32.0 34.0 3 32.77125 34.0 33.0 34.0 32.0 34.0 4 32.60125 34.0 33.0 34.0 32.0 34.0 5 32.684 34.0 33.0 34.0 32.0 34.0 6 36.84925 38.0 38.0 38.0 37.0 38.0 7 36.80675 38.0 38.0 38.0 36.0 38.0 8 36.77875 38.0 38.0 38.0 36.0 38.0 9 36.94025 38.0 38.0 38.0 37.0 38.0 10-14 36.68725 38.0 38.0 38.0 36.4 38.0 15-19 36.588499999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.70275 38.0 38.0 38.0 36.0 38.0 25-29 36.77289999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.7178 38.0 38.0 38.0 36.0 38.0 35-39 36.584950000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.38355 38.0 38.0 38.0 35.8 38.0 45-49 36.325300000000006 38.0 38.0 38.0 35.2 38.0 50-54 36.54155 38.0 38.0 38.0 35.6 38.0 55-59 36.52505 38.0 38.0 38.0 35.4 38.0 60-64 36.3581 38.0 38.0 38.0 34.6 38.0 65-69 36.48434999999999 38.0 38.0 38.0 35.0 38.0 70-74 36.377300000000005 38.0 38.0 38.0 34.4 38.0 75-79 36.35125 38.0 38.0 38.0 34.4 38.0 80-84 36.21515 38.0 38.0 38.0 34.0 38.0 85-89 35.700250000000004 38.0 38.0 38.0 32.8 38.0 90-94 35.495250000000006 38.0 38.0 38.0 31.6 38.0 95-99 35.7413 38.0 37.8 38.0 32.2 38.0 100-104 35.83495 38.0 38.0 38.0 33.0 38.0 105-109 35.651199999999996 38.0 37.8 38.0 32.0 38.0 110-114 35.41145 38.0 37.0 38.0 30.2 38.0 115-119 35.21745 38.0 37.0 38.0 29.6 38.0 120-124 35.04815000000001 38.0 36.6 38.0 28.2 38.0 125-129 34.3678 38.0 35.4 38.0 24.4 38.0 130-134 33.0702 38.0 34.8 38.0 14.4 38.0 135-139 32.20975 38.0 34.0 38.0 8.8 38.0 140-144 31.3653 38.0 33.2 38.0 2.0 38.0 145-149 30.755949999999995 38.0 31.8 38.0 2.0 38.0 150-151 26.904 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 3.0 4 3.0 5 2.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 6.0 13 6.0 14 3.0 15 3.0 16 8.0 17 11.0 18 3.0 19 13.0 20 5.0 21 11.0 22 11.0 23 17.0 24 18.0 25 24.0 26 31.0 27 35.0 28 53.0 29 48.0 30 60.0 31 88.0 32 132.0 33 142.0 34 149.0 35 222.0 36 498.0 37 2358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.36204306459689 19.078617926890335 12.543815723585377 27.01552328492739 2 22.736368184092047 26.138069034517258 34.29214607303652 16.833416708354175 3 20.71662881655312 27.32778198334595 30.885692657077975 21.069896543022963 4 23.22695035460993 34.853090172239106 22.416413373860184 19.50354609929078 5 24.589750063115375 35.97576369603635 21.257258268114114 18.17722797273416 6 18.67743563856638 38.49066128218072 23.47299343765775 19.358909641595154 7 18.98893360160966 17.429577464788732 41.62474849094567 21.956740442655935 8 21.715006305170238 22.395964691046657 27.137452711223204 28.7515762925599 9 20.583061070620758 25.408394068861522 28.600150791656194 25.408394068861522 10-14 23.130285077725453 28.56853511570206 26.279811636032203 22.02136817054028 15-19 22.74316995286127 27.451974251102442 28.095696690151556 21.709159105884737 20-24 22.50467478647597 28.028503562945367 28.028503562945367 21.438318087633295 25-29 23.48553573228505 27.75929845781675 27.577865134563044 21.177300675335147 30-34 23.111447302067575 27.423096318709028 28.15935451336359 21.30610186585981 35-39 23.05549929106745 28.21045169131051 28.083856593072714 20.65019242454932 40-44 22.893036976756015 28.111489751284267 28.131834596409135 20.863638675550582 45-49 22.876148885390748 27.954095363834863 28.58883867364038 20.580917077134007 50-54 23.026846992329432 27.886556318126765 28.295316915623737 20.791279773920067 55-59 23.20617620345141 27.666767585023717 28.17135937026945 20.955696841255424 60-64 22.817029442957427 28.155143679612145 28.468259178829353 20.559567698601082 65-69 23.0142361285779 27.556718144775893 28.76402233512752 20.665023391518687 70-74 23.58481114116822 27.48722572888488 28.504157900010018 20.42380522993688 75-79 22.919167667066827 26.880752300920367 29.261704681872747 20.938375350140056 80-84 23.710770775797137 27.863419533015314 27.537032387647503 20.888777303540046 85-89 23.295077786279013 27.462382045396584 28.24789594491201 20.994644223412394 90-94 23.473721918018526 27.721201576173176 28.069187861419582 20.735888644388723 95-99 23.206666332011444 27.478540233923997 28.432307615079566 20.882485818984993 100-104 24.019239440853752 27.511398366651633 28.142692519665314 20.3266696728293 105-109 23.39098954143202 26.98612228479485 28.333668543845537 21.289219629927594 110-114 23.58148893360161 28.043259557344065 27.862173038229376 20.51307847082495 115-119 24.122565463375555 27.116607420017026 28.08791869023181 20.672908426375606 120-124 23.766636645651957 27.829480636445513 28.129690783548483 20.274191934354047 125-129 24.20620853800577 28.03463817288702 27.553552438345065 20.20560085076214 130-134 23.94938290892048 27.56340155184086 27.84460761339374 20.64260792584492 135-139 25.04647086940358 27.914387381167348 27.16023155770354 19.87891019172553 140-144 24.838744356052462 27.977854224897868 27.047946678133734 20.135454740915932 145-149 25.174355530299113 27.855556129565535 27.297618432608356 19.67246990752699 150-151 24.725835246110687 27.88829380260138 27.748023463402195 19.637847487885743 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 3.0 7 3.0 8 2.5 9 4.5 10 5.5 11 4.5 12 2.5 13 1.5 14 1.5 15 1.5 16 1.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 3.0 25 2.5 26 3.0 27 5.5 28 8.0 29 12.5 30 18.5 31 21.5 32 33.5 33 40.5 34 40.0 35 55.5 36 85.5 37 120.0 38 136.0 39 155.5 40 192.0 41 213.0 42 244.0 43 290.0 44 291.5 45 285.0 46 269.5 47 238.5 48 230.0 49 197.0 50 159.0 51 128.5 52 104.5 53 91.0 54 69.0 55 58.5 56 47.0 57 29.5 58 21.5 59 19.0 60 13.0 61 5.5 62 2.5 63 4.5 64 5.0 65 3.0 66 2.0 67 2.5 68 2.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.05 3 0.9249999999999999 4 1.3 5 0.975 6 0.95 7 0.6 8 0.8750000000000001 9 0.525 10-14 1.2550000000000001 15-19 1.355 20-24 1.065 25-29 0.79 30-34 0.8500000000000001 35-39 1.26 40-44 1.695 45-49 1.5350000000000001 50-54 0.9199999999999999 55-59 0.91 60-64 0.9950000000000001 65-69 0.605 70-74 0.19 75-79 0.04 80-84 0.42500000000000004 85-89 1.975 90-94 2.2950000000000004 95-99 0.395 100-104 0.20500000000000002 105-109 0.5599999999999999 110-114 0.6 115-119 0.135 120-124 0.06999999999999999 125-129 1.265 130-134 3.9849999999999994 135-139 5.8549999999999995 140-144 6.98 145-149 3.215 150-151 1.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.5541561712846348 1.0999999999999999 3 0.0 0.0 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.325 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 8.23476E-5 26.249144 135-139 >>END_MODULE Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789875 spots for SRR7170196.sra Written 789875 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra Read 789860 spots for SRR7170196.sra Written 789860 spots for SRR7170196.sra SRR ids: ['SRR7170196.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bhspzu1c SRR7170196.sra spots: 15797215 blocks: [[1, 789860], [789861, 1579720], [1579721, 2369580], [2369581, 3159440], [3159441, 3949300], [3949301, 4739160], [4739161, 5529020], [5529021, 6318880], [6318881, 7108740], [7108741, 7898600], [7898601, 8688460], [8688461, 9478320], [9478321, 10268180], [10268181, 11058040], [11058041, 11847900], [11847901, 12637760], [12637761, 13427620], [13427621, 14217480], [14217481, 15007340], [15007341, 15797215]] SRR7170196 file size 5331457 SRR7170196 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170196 SRR7170196_1.fastq SRR7170196_2.fastq Input file: SRR7170196_1.fastq Paired file: SRR7170196_2.fastq trimmed: SRR7170196-trimmed-pair1.fastq, SRR7170196-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:47:08 2025 >> started Wed Feb 12 18:47:26 2025 >> done (17.536s) 15797215 read pairs processed; of these: 24503 ( 0.16%) short read pairs filtered out after trimming by size control 30748 ( 0.19%) empty read pairs filtered out after trimming by size control 15741964 (99.65%) read pairs available; of these: 8907881 (56.59%) trimmed read pairs available after processing 6834083 (43.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 6 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 7 0.00% 29 3 0.00% 30 16 0.00% 31 7 0.00% 32 12 0.00% 33 21 0.00% 34 17 0.00% 35 15 0.00% 36 14 0.00% 37 18 0.00% 38 23 0.00% 39 23 0.00% 40 31 0.00% 41 28 0.00% 42 46 0.00% 43 51 0.00% 44 28 0.00% 45 62 0.00% 46 47 0.00% 47 68 0.00% 48 70 0.00% 49 81 0.00% 50 98 0.00% 51 101 0.00% 52 119 0.00% 53 142 0.00% 54 139 0.00% 55 148 0.00% 56 185 0.00% 57 216 0.00% 58 233 0.00% 59 237 0.00% 60 314 0.00% 61 352 0.00% 62 406 0.00% 63 445 0.00% 64 475 0.00% 65 569 0.00% 66 636 0.00% 67 678 0.00% 68 743 0.00% 69 973 0.01% 70 1221 0.01% 71 1244 0.01% 72 1311 0.01% 73 1482 0.01% 74 1731 0.01% 75 1859 0.01% 76 1957 0.01% 77 2163 0.01% 78 2419 0.02% 79 2756 0.02% 80 3236 0.02% 81 3589 0.02% 82 4051 0.03% 83 4758 0.03% 84 5670 0.04% 85 6345 0.04% 86 6868 0.04% 87 7097 0.05% 88 7582 0.05% 89 8017 0.05% 90 8612 0.05% 91 9546 0.06% 92 10142 0.06% 93 11349 0.07% 94 12190 0.08% 95 12775 0.08% 96 13714 0.09% 97 14104 0.09% 98 14521 0.09% 99 15532 0.10% 100 16423 0.10% 101 17505 0.11% 102 18720 0.12% 103 19962 0.13% 104 21091 0.13% 105 22002 0.14% 106 22933 0.15% 107 23763 0.15% 108 24261 0.15% 109 25006 0.16% 110 26016 0.17% 111 27589 0.18% 112 29051 0.18% 113 30231 0.19% 114 32390 0.21% 115 33543 0.21% 116 34164 0.22% 117 35181 0.22% 118 36448 0.23% 119 37248 0.24% 120 38807 0.25% 121 40628 0.26% 122 42529 0.27% 123 44737 0.28% 124 46789 0.30% 125 49193 0.31% 126 51011 0.32% 127 52982 0.34% 128 54490 0.35% 129 56680 0.36% 130 59604 0.38% 131 62602 0.40% 132 66413 0.42% 133 70735 0.45% 134 74944 0.48% 135 79578 0.51% 136 85404 0.54% 137 91650 0.58% 138 99680 0.63% 139 108448 0.69% 140 116864 0.74% 141 126795 0.81% 142 141118 0.90% 143 159127 1.01% 144 183072 1.16% 145 216948 1.38% 146 268415 1.71% 147 357187 2.27% 148 525788 3.34% 149 1000451 6.36% 150 3795909 24.11% 151 6834083 43.41% 15741964 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=167.15 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.3 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=52.10 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.1 sequence=TGTTGGTGGTGG SRR7170196 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:48:10 Started mapping on | Feb 12 18:48:10 Finished on | Feb 12 18:49:49 Mapping speed, Million of reads per hour | 572.44 Number of input reads | 15741964 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14817772 Uniquely mapped reads % | 94.13% Average mapped length | 291.63 Number of splices: Total | 13531466 Number of splices: Annotated (sjdb) | 13285841 Number of splices: GT/AG | 13333328 Number of splices: GC/AG | 154589 Number of splices: AT/AC | 12337 Number of splices: Non-canonical | 31212 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277486 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 29059 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 663589 663589 663589 N_multimapping 277486 277486 277486 N_noFeature 439961 14643745 511698 N_ambiguous 164889 852 62100 UnstrandedReadsAssigned:14212922 PositiveStrandReadsAssigned:173175 NegativeStrandReadsAssigned:14243974 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170196 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170196-trimmed-pair1.fastq SRR7170196-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,741,964 reads, 14,150,919 reads pseudoaligned [quant] estimated average fragment length: 239.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7170196.ke.tsv 34699 SRR7170196.se.tsv 87100 total ==> SRR7170196.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.28 230 8.99849 Potri.005G024800.1.v4.1 1035 796.281 27 2.36039 Potri.004G059700.1.v4.1 961 722.368 1 0.096367 Potri.007G009000.2.v4.1 1416 1177.28 0 0 Potri.003G141000.2.v4.1 2943 2704.28 219.111 5.64024 Potri.016G087400.1.v4.1 270 83.9882 1559 1292.15 Potri.015G069301.1.v4.1 564 331.785 0 0 Potri.010G195200.1.v4.1 1773 1534.28 11 0.499085 Potri.012G127500.1.v4.1 977 738.328 4981 469.628 ==> SRR7170196.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1636 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170196 completed mapping pipeline successfully