Starting /dee2/code/volunteer_pipeline.sh SRR7170198 current disk space = 3051433705472 free memory = 1450101172 SRR7170198 SRAfilesize 17359b7c96c601c714cb81a150cac959 SRR7170198.sra SRR7170198.sra file validated SRR7170198 is paired end SRR7170198 is conventional basespace SRR7170198 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170198_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3185 34.0 33.0 34.0 33.0 34.0 2 33.43425 34.0 33.0 34.0 33.0 34.0 3 33.495 34.0 34.0 34.0 33.0 34.0 4 33.47075 34.0 34.0 34.0 33.0 34.0 5 33.41875 34.0 34.0 34.0 33.0 34.0 6 36.827 38.0 37.0 38.0 34.0 38.0 7 37.20225 38.0 38.0 38.0 36.0 38.0 8 37.36825 38.0 38.0 38.0 37.0 38.0 9 37.39925 38.0 38.0 38.0 37.0 38.0 10-14 37.384600000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.31605 38.0 38.0 38.0 37.0 38.0 20-24 37.24765 38.0 38.0 38.0 36.4 38.0 25-29 37.180899999999994 38.0 38.0 38.0 36.0 38.0 30-34 37.126 38.0 38.0 38.0 36.0 38.0 35-39 37.0043 38.0 38.0 38.0 35.8 38.0 40-44 36.50065 38.0 37.4 38.0 34.0 38.0 45-49 36.3788 38.0 37.0 38.0 33.8 38.0 50-54 36.2245 38.0 37.0 38.0 33.0 38.0 55-59 36.096349999999994 38.0 37.0 38.0 32.8 38.0 60-64 36.04254999999999 38.0 37.0 38.0 32.4 38.0 65-69 35.9707 38.0 37.0 38.0 31.8 38.0 70-74 35.8597 38.0 36.8 38.0 31.0 38.0 75-79 35.65665 38.0 36.0 38.0 29.8 38.0 80-84 35.4906 38.0 36.0 38.0 29.0 38.0 85-89 35.316250000000004 38.0 36.0 38.0 29.0 38.0 90-94 35.1707 38.0 36.0 38.0 29.0 38.0 95-99 34.83885 38.0 35.0 38.0 27.6 38.0 100-104 34.6911 38.0 35.0 38.0 26.8 38.0 105-109 34.31195000000001 38.0 34.4 38.0 25.2 38.0 110-114 34.06114999999999 38.0 34.0 38.0 23.0 38.0 115-119 33.692 38.0 34.0 38.0 21.4 38.0 120-124 33.29365 37.6 33.8 38.0 15.0 38.0 125-129 32.795249999999996 37.0 32.6 38.0 15.0 38.0 130-134 32.19565 36.4 31.0 38.0 15.0 38.0 135-139 31.136850000000003 35.8 28.2 38.0 14.0 38.0 140-144 30.673700000000004 35.2 28.0 38.0 13.6 38.0 145-149 29.579050000000002 35.0 26.2 38.0 6.4 38.0 150-151 24.584625 33.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 2.0 16 1.0 17 5.0 18 8.0 19 12.0 20 11.0 21 7.0 22 17.0 23 18.0 24 29.0 25 36.0 26 34.0 27 41.0 28 65.0 29 66.0 30 82.0 31 117.0 32 134.0 33 220.0 34 340.0 35 653.0 36 1133.0 37 958.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.766298896690074 14.769307923771313 11.45937813440321 35.00501504513541 2 21.3 21.7 35.125 21.875 3 19.950000000000003 27.925 25.525 26.6 4 21.275 35.825 21.525 21.375 5 20.075000000000003 37.7 23.65 18.575 6 17.625 35.425000000000004 25.75 21.2 7 12.775 23.200000000000003 43.325 20.7 8 18.675 22.725 31.0 27.6 9 18.5 23.599999999999998 31.5 26.400000000000002 10-14 20.32 29.709999999999997 26.41 23.56 15-19 20.27 28.725 27.915 23.09 20-24 19.950000000000003 29.270000000000003 27.005000000000003 23.775 25-29 20.080000000000002 28.875 27.715 23.330000000000002 30-34 20.24 28.910000000000004 27.400000000000002 23.45 35-39 19.919999999999998 28.49 27.900000000000002 23.69 40-44 19.685 28.860000000000003 27.765 23.69 45-49 20.674999999999997 28.415000000000003 27.35 23.56 50-54 20.415 29.020000000000003 27.384999999999998 23.18 55-59 20.23 29.43 27.250000000000004 23.09 60-64 19.99 28.4 27.71 23.9 65-69 20.13 28.84 26.955000000000002 24.075 70-74 19.93 29.68 27.139999999999997 23.25 75-79 20.65 28.435 27.345000000000002 23.57 80-84 20.25 29.060000000000002 26.650000000000002 24.04 85-89 20.79 28.715000000000003 27.425 23.07 90-94 20.3 28.785 27.189999999999998 23.724999999999998 95-99 19.985999299965 28.551427571378568 27.51137556877844 23.951197559877993 100-104 20.555 28.125 27.815 23.505000000000003 105-109 20.599999999999998 28.439999999999998 27.205000000000002 23.755000000000003 110-114 20.76 29.020000000000003 26.955000000000002 23.265 115-119 20.95604780239012 29.141457072853644 26.86134306715336 23.04115205760288 120-124 20.192019201920193 28.947894789478944 27.342734273427343 23.517351735173516 125-129 20.705000000000002 28.79 26.76 23.745 130-134 21.035 28.804999999999996 26.815 23.345 135-139 20.94 28.52 26.915 23.625 140-144 20.995 28.725 26.93 23.35 145-149 21.065 29.885 25.4 23.65 150-151 20.515064383047882 29.053631703962996 27.015876984623077 23.415426928366045 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 1.5 23 1.0 24 4.5 25 7.0 26 6.5 27 9.5 28 11.0 29 15.0 30 21.0 31 24.5 32 29.5 33 44.5 34 64.0 35 73.5 36 93.5 37 119.0 38 141.0 39 164.0 40 184.0 41 196.0 42 216.5 43 257.5 44 265.0 45 262.0 46 273.5 47 264.0 48 238.5 49 208.0 50 166.0 51 139.5 52 123.5 53 95.5 54 77.5 55 56.5 56 33.5 57 26.0 58 22.0 59 16.0 60 12.5 61 8.0 62 5.0 63 3.5 64 1.0 65 0.5 66 3.0 67 3.0 68 2.0 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.449999999999999 0.0 0.0 0.0 0.0 136-137 5.949999999999999 0.0 0.0 0.0 0.0 138-139 6.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAGAC 10 0.006830828 145.0 1 ACCTCTT 10 0.006830828 145.0 6 >>END_MODULE SRR7170198 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170198_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.713 33.0 33.0 34.0 32.0 34.0 2 32.7805 33.0 33.0 34.0 32.0 34.0 3 32.64675 34.0 33.0 34.0 32.0 34.0 4 32.4595 34.0 33.0 34.0 32.0 34.0 5 32.42025 34.0 33.0 34.0 32.0 34.0 6 36.69025 38.0 38.0 38.0 35.0 38.0 7 36.74975 38.0 38.0 38.0 36.0 38.0 8 36.75325 38.0 38.0 38.0 36.0 38.0 9 36.7725 38.0 38.0 38.0 36.0 38.0 10-14 36.616699999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.5288 38.0 38.0 38.0 35.8 38.0 20-24 36.53225 38.0 38.0 38.0 35.8 38.0 25-29 36.599000000000004 38.0 38.0 38.0 35.6 38.0 30-34 36.59285 38.0 38.0 38.0 36.0 38.0 35-39 36.43805 38.0 38.0 38.0 35.2 38.0 40-44 36.35515 38.0 38.0 38.0 35.2 38.0 45-49 36.28705 38.0 38.0 38.0 35.0 38.0 50-54 36.377750000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.3414 38.0 38.0 38.0 34.6 38.0 60-64 36.2828 38.0 38.0 38.0 34.4 38.0 65-69 36.26375 38.0 38.0 38.0 34.0 38.0 70-74 36.17205 38.0 38.0 38.0 33.8 38.0 75-79 36.059549999999994 38.0 38.0 38.0 33.6 38.0 80-84 36.01925 38.0 38.0 38.0 33.6 38.0 85-89 35.58985 38.0 37.6 38.0 31.8 38.0 90-94 35.21255 38.0 37.0 38.0 29.4 38.0 95-99 35.569300000000005 38.0 37.0 38.0 30.8 38.0 100-104 35.545899999999996 38.0 37.0 38.0 31.0 38.0 105-109 35.26585 38.0 37.0 38.0 29.0 38.0 110-114 35.10505 38.0 36.4 38.0 28.6 38.0 115-119 35.01465 38.0 36.0 38.0 28.2 38.0 120-124 34.703149999999994 38.0 36.0 38.0 27.0 38.0 125-129 34.145149999999994 38.0 35.0 38.0 23.2 38.0 130-134 32.884249999999994 38.0 34.8 38.0 14.2 38.0 135-139 31.591250000000002 38.0 33.0 38.0 4.2 38.0 140-144 30.73435 38.0 31.2 38.0 2.0 38.0 145-149 30.111399999999996 38.0 30.6 38.0 2.0 38.0 150-151 26.177625 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 9.0 4 3.0 5 0.0 6 2.0 7 1.0 8 4.0 9 1.0 10 2.0 11 3.0 12 1.0 13 0.0 14 3.0 15 5.0 16 6.0 17 10.0 18 9.0 19 10.0 20 12.0 21 20.0 22 15.0 23 14.0 24 22.0 25 28.0 26 27.0 27 26.0 28 49.0 29 57.0 30 61.0 31 99.0 32 123.0 33 168.0 34 162.0 35 268.0 36 632.0 37 2115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.53039779834876 15.736802601951464 15.711783837878409 28.021015761821367 2 23.85481852315394 25.431789737171464 33.79224030037547 16.921151439299123 3 21.7544744139148 27.123771111671285 29.19082430047895 21.93093017393496 4 24.050632911392405 35.67088607594936 21.139240506329113 19.139240506329113 5 21.44663631765301 37.101669195751136 23.520485584218513 17.931208902377342 6 18.8598694123556 36.66499246609744 25.113008538422903 19.36212958312406 7 18.252378567851775 18.052078117175764 41.58738107160741 22.108162243365047 8 21.557336004006007 22.108162243365047 27.491236855282924 28.84326489734602 9 21.613470721286756 24.780095501382256 28.047248052274444 25.559185725056548 10-14 23.191403491070528 28.120270406618907 27.08606598728685 21.60226011502371 15-19 22.989784565591183 26.88884393648225 28.613330636188934 21.508040861737634 20-24 23.014832004843104 28.135405105438398 27.787307032590054 21.06245585712844 25-29 23.037122620183855 28.05545787913799 28.28653237554629 20.620887125131862 30-34 23.194682243931915 27.379393695236175 28.23547185013597 21.19045221069594 35-39 23.130935542533845 27.939987876338655 28.192564154374622 20.736512426752878 40-44 23.10886075949367 28.08607594936709 28.08607594936709 20.718987341772152 45-49 23.205874905039252 28.204608761711825 27.62724740440618 20.962268928842747 50-54 22.89938150550611 27.89762156182431 28.189269371951525 21.013727560718056 55-59 23.59261501210654 27.819814366424534 28.440274414850684 20.14729620661824 60-64 22.996673722407017 27.69882068339885 28.696703961294222 20.607801632899907 65-69 23.326133909287257 28.288713647094276 27.630719774976143 20.754432668642323 70-74 23.657474600870827 27.601221160102096 28.171763175016267 20.56954106401081 75-79 23.83930358214929 27.181308785271163 28.48208925355213 20.497298379027416 80-84 23.98955666013958 27.760204850128034 28.041371692523974 20.208866797208415 85-89 23.94122731201383 26.600233870557734 28.410188621688953 21.048350195739488 90-94 23.008849557522122 27.36712875338892 28.74827356898051 20.875748120108444 95-99 23.85229040188651 27.469770708945862 28.31267874165872 20.365260147508906 100-104 23.685001502855425 27.86794910329626 28.058310790501956 20.388738603346358 105-109 24.048469002966463 27.407109457489064 28.397606717280908 20.14681482226356 110-114 24.08040201005025 27.5678391959799 28.25628140703518 20.095477386934675 115-119 24.085396411747016 27.573418863385786 27.94928335170893 20.391901373158262 120-124 24.395736375919533 27.82865435620277 27.3182204874143 20.457388780463397 125-129 24.607778842758414 27.700146294708166 27.538717651213236 20.153357211320184 130-134 24.280135381411093 28.305128872689405 27.12314501431919 20.291590731580317 135-139 24.719940253920836 27.81926811053025 27.413848287634696 20.046943347914222 140-144 24.5979492714517 28.219104155423636 26.950890447922287 20.232056125202373 145-149 24.899598393574294 28.205128205128204 27.43280815569972 19.462465245597777 150-151 25.56257901390645 27.989886219974714 27.18078381795196 19.266750948166877 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 1.5 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.5 14 2.0 15 2.5 16 5.5 17 4.5 18 1.0 19 0.0 20 1.0 21 1.5 22 3.0 23 3.5 24 4.5 25 6.0 26 4.5 27 3.5 28 8.5 29 10.0 30 12.5 31 18.0 32 25.0 33 41.5 34 48.0 35 55.5 36 75.5 37 93.0 38 119.5 39 174.0 40 211.5 41 218.5 42 246.0 43 267.5 44 278.5 45 287.5 46 282.0 47 259.5 48 229.0 49 198.0 50 165.5 51 150.0 52 126.0 53 93.0 54 72.5 55 57.0 56 36.0 57 19.5 58 15.5 59 13.0 60 8.0 61 4.0 62 3.5 63 3.5 64 3.0 65 2.0 66 3.0 67 4.5 68 2.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.125 3 0.8250000000000001 4 1.25 5 1.15 6 0.44999999999999996 7 0.15 8 0.15 9 0.525 10-14 0.89 15-19 1.13 20-24 0.89 25-29 0.46499999999999997 30-34 0.7100000000000001 35-39 1.02 40-44 1.25 45-49 1.275 50-54 0.565 55-59 0.88 60-64 0.79 65-69 0.455 70-74 0.095 75-79 0.06 80-84 0.415 85-89 1.6549999999999998 90-94 2.255 95-99 0.345 100-104 0.19 105-109 0.555 110-114 0.5 115-119 0.22999999999999998 120-124 0.08499999999999999 125-129 0.885 130-134 3.975 135-139 6.2700000000000005 140-144 7.35 145-149 2.8899999999999997 150-151 1.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCGAA 10 0.0069374256 144.22786 2 >>END_MODULE Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873164 spots for SRR7170198.sra Written 873164 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra Read 873145 spots for SRR7170198.sra Written 873145 spots for SRR7170198.sra SRR ids: ['SRR7170198.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ih1xfa0n SRR7170198.sra spots: 17462919 blocks: [[1, 873145], [873146, 1746290], [1746291, 2619435], [2619436, 3492580], [3492581, 4365725], [4365726, 5238870], [5238871, 6112015], [6112016, 6985160], [6985161, 7858305], [7858306, 8731450], [8731451, 9604595], [9604596, 10477740], [10477741, 11350885], [11350886, 12224030], [12224031, 13097175], [13097176, 13970320], [13970321, 14843465], [14843466, 15716610], [15716611, 16589755], [16589756, 17462919]] SRR7170198 file size 5895909 SRR7170198 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170198 SRR7170198_1.fastq SRR7170198_2.fastq Input file: SRR7170198_1.fastq Paired file: SRR7170198_2.fastq trimmed: SRR7170198-trimmed-pair1.fastq, SRR7170198-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:11:52 2025 >> started Wed Feb 12 18:12:20 2025 >> done (28.003s) 17462919 read pairs processed; of these: 30616 ( 0.18%) short read pairs filtered out after trimming by size control 30422 ( 0.17%) empty read pairs filtered out after trimming by size control 17401881 (99.65%) read pairs available; of these: 10381841 (59.66%) trimmed read pairs available after processing 7020040 (40.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 12 0.00% 30 6 0.00% 31 8 0.00% 32 13 0.00% 33 10 0.00% 34 11 0.00% 35 10 0.00% 36 15 0.00% 37 13 0.00% 38 20 0.00% 39 21 0.00% 40 18 0.00% 41 34 0.00% 42 27 0.00% 43 36 0.00% 44 42 0.00% 45 52 0.00% 46 54 0.00% 47 69 0.00% 48 76 0.00% 49 86 0.00% 50 80 0.00% 51 119 0.00% 52 119 0.00% 53 169 0.00% 54 147 0.00% 55 158 0.00% 56 169 0.00% 57 183 0.00% 58 233 0.00% 59 238 0.00% 60 334 0.00% 61 311 0.00% 62 356 0.00% 63 394 0.00% 64 511 0.00% 65 501 0.00% 66 617 0.00% 67 713 0.00% 68 820 0.00% 69 1027 0.01% 70 1183 0.01% 71 1220 0.01% 72 1334 0.01% 73 1481 0.01% 74 1639 0.01% 75 1804 0.01% 76 2013 0.01% 77 2176 0.01% 78 2472 0.01% 79 2781 0.02% 80 3206 0.02% 81 3668 0.02% 82 4167 0.02% 83 4982 0.03% 84 5987 0.03% 85 6911 0.04% 86 7038 0.04% 87 7340 0.04% 88 7907 0.05% 89 8314 0.05% 90 8964 0.05% 91 9728 0.06% 92 10628 0.06% 93 11352 0.07% 94 12264 0.07% 95 12768 0.07% 96 13723 0.08% 97 14304 0.08% 98 15109 0.09% 99 15727 0.09% 100 16410 0.09% 101 17878 0.10% 102 19022 0.11% 103 20516 0.12% 104 21470 0.12% 105 22871 0.13% 106 23543 0.14% 107 24533 0.14% 108 26025 0.15% 109 25919 0.15% 110 27476 0.16% 111 28646 0.16% 112 30237 0.17% 113 32287 0.19% 114 33594 0.19% 115 35318 0.20% 116 36461 0.21% 117 37787 0.22% 118 38890 0.22% 119 40371 0.23% 120 42060 0.24% 121 44072 0.25% 122 46501 0.27% 123 49493 0.28% 124 51608 0.30% 125 54531 0.31% 126 57486 0.33% 127 59055 0.34% 128 61855 0.36% 129 65166 0.37% 130 67917 0.39% 131 71736 0.41% 132 76697 0.44% 133 81583 0.47% 134 87425 0.50% 135 94316 0.54% 136 100448 0.58% 137 109049 0.63% 138 117737 0.68% 139 128973 0.74% 140 141665 0.81% 141 154795 0.89% 142 173729 1.00% 143 195660 1.12% 144 229349 1.32% 145 278043 1.60% 146 347608 2.00% 147 458867 2.64% 148 687490 3.95% 149 1248404 7.17% 150 4229200 24.30% 151 7020040 40.34% 17401881 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=54.49 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.1 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAAGACCTTGTTGAATCTTGGATCCGTGCCATGATATTCAAATGCAGTCATCCCATAGGCCTTGTTAAATGGAATTCCTCCATCAAGAATTGCATCTTTCAAATAATACCAGCTTTCCATGAGGACCTTGTCCTGGTTCATGAGA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=51.09 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.8 sequence=TGTTGGTGGTGG SRR7170198 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:13:07 Started mapping on | Feb 12 18:13:08 Finished on | Feb 12 18:14:50 Mapping speed, Million of reads per hour | 614.18 Number of input reads | 17401881 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16426576 Uniquely mapped reads % | 94.40% Average mapped length | 291.60 Number of splices: Total | 14908215 Number of splices: Annotated (sjdb) | 14650285 Number of splices: GT/AG | 14694399 Number of splices: GC/AG | 167093 Number of splices: AT/AC | 11767 Number of splices: Non-canonical | 34956 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282727 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 44646 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714287 714287 714287 N_multimapping 282727 282727 282727 N_noFeature 469524 16241664 541558 N_ambiguous 180609 1297 66689 UnstrandedReadsAssigned:15776443 PositiveStrandReadsAssigned:183615 NegativeStrandReadsAssigned:15818329 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170198 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170198-trimmed-pair1.fastq SRR7170198-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,401,881 reads, 15,732,489 reads pseudoaligned [quant] estimated average fragment length: 242.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7170198.ke.tsv 34699 SRR7170198.se.tsv 87100 total ==> SRR7170198.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.7 266 10.1511 Potri.005G024800.1.v4.1 1035 793.703 13 1.11054 Potri.004G059700.1.v4.1 961 719.746 0 0 Potri.007G009000.2.v4.1 1416 1174.7 0 0 Potri.003G141000.2.v4.1 2943 2701.7 253.092 6.35168 Potri.016G087400.1.v4.1 270 81.9583 1318.4 1090.69 Potri.015G069301.1.v4.1 564 328.614 0 0 Potri.010G195200.1.v4.1 1773 1531.7 16 0.708262 Potri.012G127500.1.v4.1 977 735.736 4558 420.05 ==> SRR7170198.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2057 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 215 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170198 completed mapping pipeline successfully