Starting /dee2/code/volunteer_pipeline.sh SRR7170199 current disk space = 3051173748736 free memory = 1577741324 SRR7170199 SRAfilesize 0314271f1a6a3706a158841c02b2d17e SRR7170199.sra SRR7170199.sra file validated SRR7170199 is paired end SRR7170199 is conventional basespace SRR7170199 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170199_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16725 34.0 33.0 34.0 33.0 34.0 2 33.388 34.0 33.0 34.0 33.0 34.0 3 33.38325 34.0 33.0 34.0 33.0 34.0 4 33.3955 34.0 34.0 34.0 33.0 34.0 5 33.44375 34.0 34.0 34.0 33.0 34.0 6 35.40925 38.0 37.0 38.0 29.0 38.0 7 36.8365 38.0 37.0 38.0 34.0 38.0 8 37.21725 38.0 38.0 38.0 36.0 38.0 9 37.23325 38.0 38.0 38.0 37.0 38.0 10-14 37.38555 38.0 38.0 38.0 37.2 38.0 15-19 37.45355000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.4749 38.0 38.0 38.0 37.6 38.0 25-29 37.20235 38.0 38.0 38.0 36.8 38.0 30-34 37.456649999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.3865 38.0 38.0 38.0 37.4 38.0 40-44 37.260949999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.2172 38.0 38.0 38.0 36.8 38.0 50-54 37.12155 38.0 38.0 38.0 36.0 38.0 55-59 37.1326 38.0 38.0 38.0 36.2 38.0 60-64 36.68795 38.0 37.8 38.0 34.2 38.0 65-69 37.14184999999999 38.0 38.0 38.0 36.4 38.0 70-74 36.96235 38.0 38.0 38.0 35.8 38.0 75-79 36.93895 38.0 38.0 38.0 36.0 38.0 80-84 36.585550000000005 38.0 37.8 38.0 34.2 38.0 85-89 36.57785 38.0 37.8 38.0 34.2 38.0 90-94 36.6537 38.0 38.0 38.0 34.6 38.0 95-99 36.67635 38.0 38.0 38.0 35.0 38.0 100-104 36.4566 38.0 38.0 38.0 34.0 38.0 105-109 36.2574 38.0 38.0 38.0 33.8 38.0 110-114 36.2291 38.0 38.0 38.0 33.8 38.0 115-119 36.25555 38.0 38.0 38.0 34.0 38.0 120-124 35.9956 38.0 37.6 38.0 33.2 38.0 125-129 35.79880000000001 38.0 37.0 38.0 32.2 38.0 130-134 35.603300000000004 38.0 36.4 38.0 31.4 38.0 135-139 35.226150000000004 38.0 36.0 38.0 30.4 38.0 140-144 35.0795 38.0 36.0 38.0 30.2 38.0 145-149 34.587 38.0 35.6 38.0 28.4 38.0 150-151 30.945 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 2.0 17 4.0 18 3.0 19 9.0 20 1.0 21 4.0 22 6.0 23 4.0 24 12.0 25 12.0 26 14.0 27 24.0 28 26.0 29 33.0 30 34.0 31 54.0 32 49.0 33 101.0 34 127.0 35 247.0 36 547.0 37 2679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.47103274559194 15.768261964735517 13.09823677581864 31.662468513853902 2 21.05 20.775 35.625 22.55 3 18.175 29.15 26.325 26.35 4 21.3 36.475 21.775 20.45 5 20.95 36.425000000000004 23.825 18.8 6 17.571964956195245 35.99499374217772 26.708385481852314 19.72465581977472 7 14.575 22.5 43.2 19.725 8 19.025 24.075 29.349999999999998 27.55 9 16.575 24.2 32.15 27.075 10-14 19.470000000000002 30.064999999999998 26.935 23.53 15-19 19.314999999999998 29.385 27.200000000000003 24.099999999999998 20-24 19.6 29.310000000000002 27.1 23.990000000000002 25-29 19.759999999999998 29.830000000000002 27.51 22.900000000000002 30-34 19.705000000000002 30.125 26.595000000000002 23.575 35-39 20.13 29.635 26.945000000000004 23.29 40-44 20.215 29.665000000000003 27.200000000000003 22.919999999999998 45-49 20.19 29.085 27.255000000000003 23.47 50-54 20.125 29.475 27.005000000000003 23.395 55-59 20.485 29.330000000000002 27.055 23.13 60-64 20.06 28.970000000000002 27.589999999999996 23.380000000000003 65-69 20.13 29.21 26.935 23.724999999999998 70-74 19.975 29.675 26.735 23.615 75-79 20.115 29.160000000000004 26.915 23.810000000000002 80-84 20.54 29.154999999999998 26.68 23.625 85-89 20.674999999999997 28.735 26.995 23.595 90-94 20.365 29.45 26.56 23.625 95-99 19.985 29.37 26.38 24.265 100-104 20.44 29.32 26.5 23.74 105-109 20.735 28.749999999999996 26.875 23.64 110-114 20.595 28.67 27.29 23.445 115-119 21.15 28.749999999999996 26.825 23.275000000000002 120-124 20.835 28.465 26.479999999999997 24.22 125-129 20.858128719307896 28.00920138020703 26.949042356353452 24.18362754413162 130-134 20.825 28.88 26.625 23.669999999999998 135-139 20.815 28.139999999999997 26.200000000000003 24.845 140-144 21.060000000000002 28.425 25.929999999999996 24.585 145-149 20.349999999999998 28.605000000000004 25.924999999999997 25.119999999999997 150-151 21.775 28.1875 25.412499999999998 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 2.0 21 1.5 22 2.0 23 3.5 24 4.0 25 6.0 26 5.0 27 7.0 28 10.0 29 16.5 30 28.5 31 41.0 32 54.5 33 60.0 34 66.5 35 76.5 36 103.0 37 136.5 38 138.5 39 145.0 40 171.5 41 215.5 42 240.0 43 239.0 44 253.0 45 253.0 46 237.0 47 225.0 48 225.5 49 203.0 50 168.5 51 152.0 52 129.0 53 97.5 54 72.5 55 48.0 56 29.5 57 32.0 58 27.5 59 16.0 60 11.0 61 8.0 62 8.0 63 8.0 64 5.5 65 2.0 66 2.0 67 3.5 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8499999999999996 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.6624999999999996 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.612500000000001 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.824999999999999 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.8625 0.0 0.0 0.0 0.0 136-137 7.324999999999999 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAAAA 10 0.006597606 146.67088 6 TATGCCG 10 0.0068537686 144.8375 145 CAATCAC 10 0.0068537686 144.8375 7 >>END_MODULE SRR7170199 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170199_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8835 33.0 33.0 34.0 32.0 34.0 2 32.8855 34.0 33.0 34.0 32.0 34.0 3 32.9185 34.0 33.0 34.0 32.0 34.0 4 32.9085 34.0 33.0 34.0 32.0 34.0 5 32.934 34.0 33.0 34.0 32.0 34.0 6 37.0365 38.0 38.0 38.0 37.0 38.0 7 37.0795 38.0 38.0 38.0 37.0 38.0 8 37.14525 38.0 38.0 38.0 37.0 38.0 9 37.071 38.0 38.0 38.0 37.0 38.0 10-14 37.00715 38.0 38.0 38.0 37.0 38.0 15-19 36.995 38.0 38.0 38.0 37.0 38.0 20-24 36.96715 38.0 38.0 38.0 37.0 38.0 25-29 36.935 38.0 38.0 38.0 37.0 38.0 30-34 36.7802 38.0 38.0 38.0 35.8 38.0 35-39 36.595150000000004 38.0 38.0 38.0 35.2 38.0 40-44 36.617000000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.75255 38.0 38.0 38.0 36.0 38.0 50-54 36.778549999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.74145 38.0 38.0 38.0 36.2 38.0 60-64 36.652300000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.7022 38.0 38.0 38.0 36.0 38.0 70-74 36.56420000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.43745 38.0 38.0 38.0 34.8 38.0 80-84 36.4689 38.0 38.0 38.0 35.2 38.0 85-89 36.45985 38.0 38.0 38.0 35.0 38.0 90-94 36.4042 38.0 38.0 38.0 35.0 38.0 95-99 36.36880000000001 38.0 38.0 38.0 34.6 38.0 100-104 36.31305 38.0 38.0 38.0 34.6 38.0 105-109 36.0779 38.0 38.0 38.0 34.0 38.0 110-114 35.98775 38.0 38.0 38.0 34.0 38.0 115-119 35.825100000000006 38.0 38.0 38.0 33.4 38.0 120-124 35.623749999999994 38.0 37.8 38.0 32.0 38.0 125-129 35.3849 38.0 37.0 38.0 30.8 38.0 130-134 35.07289999999999 38.0 36.6 38.0 29.4 38.0 135-139 34.92229999999999 38.0 36.0 38.0 29.4 38.0 140-144 34.621750000000006 38.0 36.0 38.0 27.2 38.0 145-149 33.60215 38.0 35.0 38.0 19.6 38.0 150-151 29.89225 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 6.0 5 2.0 6 2.0 7 0.0 8 1.0 9 1.0 10 3.0 11 5.0 12 3.0 13 4.0 14 4.0 15 8.0 16 4.0 17 8.0 18 7.0 19 9.0 20 8.0 21 8.0 22 10.0 23 11.0 24 10.0 25 14.0 26 18.0 27 27.0 28 25.0 29 18.0 30 30.0 31 49.0 32 70.0 33 80.0 34 112.0 35 219.0 36 486.0 37 2722.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 16.875 17.5 25.6 2 25.324999999999996 23.425 32.275 18.975 3 22.925 28.475 29.349999999999998 19.25 4 24.525 34.949999999999996 21.9 18.625 5 24.75 36.975 20.575 17.7 6 20.474999999999998 35.949999999999996 24.125 19.45 7 19.125 18.65 40.725 21.5 8 23.200000000000003 22.1 27.025 27.675 9 23.150000000000002 25.3 27.150000000000002 24.4 10-14 23.990000000000002 27.815 26.745 21.45 15-19 23.435 27.79 27.375 21.4 20-24 23.200000000000003 27.99 27.66 21.15 25-29 23.555 27.74 27.63 21.075 30-34 23.535 27.67 28.294999999999998 20.5 35-39 23.575 27.915 27.18 21.33 40-44 24.07 27.595 27.625 20.71 45-49 23.474999999999998 27.375 28.384999999999998 20.765 50-54 23.51 27.744999999999997 27.815 20.93 55-59 24.465 26.96 27.93 20.645 60-64 23.405 27.92 27.85 20.825 65-69 23.95 27.215 27.935 20.9 70-74 23.974999999999998 27.189999999999998 28.255000000000003 20.580000000000002 75-79 23.425 26.905 28.38 21.29 80-84 23.43 27.48 28.405 20.685000000000002 85-89 23.438515777366607 27.48412261839276 28.46927039055858 20.60809121368205 90-94 23.755000000000003 27.800000000000004 27.985 20.46 95-99 23.400000000000002 27.465 28.349999999999998 20.785 100-104 23.685000000000002 27.425 28.255000000000003 20.635 105-109 23.76926155693416 27.496497898739243 27.726635981588956 21.00760456273764 110-114 24.143621543231486 27.85417812671901 27.48412261839276 20.518077711656748 115-119 24.185000000000002 28.29 27.455000000000002 20.07 120-124 23.92119605980299 27.716385819290963 27.966398319915996 20.39601980099005 125-129 25.115 27.215 27.97 19.7 130-134 24.729891956782712 27.936174469787918 27.506002400960384 19.827931172468986 135-139 25.112533760128038 27.45823747124137 27.57827348204461 19.850955286585975 140-144 25.35 28.24 26.590000000000003 19.82 145-149 25.267633816908454 27.583791895947975 27.208604302151073 19.939969984992494 150-151 25.190935269813448 27.169149868536373 27.594841617628646 20.045073244021534 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 1.0 25 1.5 26 2.5 27 4.0 28 5.5 29 6.0 30 7.5 31 14.5 32 17.0 33 27.0 34 39.0 35 53.0 36 76.0 37 98.5 38 123.0 39 158.5 40 200.0 41 221.5 42 235.5 43 250.0 44 260.0 45 274.5 46 281.5 47 279.0 48 256.5 49 219.0 50 191.5 51 163.5 52 132.5 53 97.5 54 67.5 55 54.0 56 44.0 57 29.5 58 16.5 59 18.0 60 18.5 61 13.0 62 9.5 63 4.0 64 3.5 65 3.5 66 4.0 67 3.0 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.06 110-114 0.015 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.04 135-139 0.03 140-144 0.0 145-149 0.05 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.65 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.5875 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTC 10 0.006901744 144.5 1 >>END_MODULE Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742871 spots for SRR7170199.sra Written 742871 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra Read 742857 spots for SRR7170199.sra Written 742857 spots for SRR7170199.sra SRR ids: ['SRR7170199.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g5avlv97 SRR7170199.sra spots: 14857154 blocks: [[1, 742857], [742858, 1485714], [1485715, 2228571], [2228572, 2971428], [2971429, 3714285], [3714286, 4457142], [4457143, 5199999], [5200000, 5942856], [5942857, 6685713], [6685714, 7428570], [7428571, 8171427], [8171428, 8914284], [8914285, 9657141], [9657142, 10399998], [10399999, 11142855], [11142856, 11885712], [11885713, 12628569], [12628570, 13371426], [13371427, 14114283], [14114284, 14857154]] SRR7170199 file size 5012901 SRR7170199 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170199 SRR7170199_1.fastq SRR7170199_2.fastq Input file: SRR7170199_1.fastq Paired file: SRR7170199_2.fastq trimmed: SRR7170199-trimmed-pair1.fastq, SRR7170199-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:05:12 2025 >> started Wed Feb 12 19:05:28 2025 >> done (15.816s) 14857154 read pairs processed; of these: 26204 ( 0.18%) short read pairs filtered out after trimming by size control 29108 ( 0.20%) empty read pairs filtered out after trimming by size control 14801842 (99.63%) read pairs available; of these: 7070610 (47.77%) trimmed read pairs available after processing 7731232 (52.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 10 0.00% 23 6 0.00% 24 10 0.00% 25 8 0.00% 26 7 0.00% 27 7 0.00% 28 15 0.00% 29 10 0.00% 30 13 0.00% 31 4 0.00% 32 11 0.00% 33 15 0.00% 34 13 0.00% 35 14 0.00% 36 11 0.00% 37 22 0.00% 38 15 0.00% 39 21 0.00% 40 18 0.00% 41 36 0.00% 42 31 0.00% 43 31 0.00% 44 31 0.00% 45 44 0.00% 46 52 0.00% 47 58 0.00% 48 63 0.00% 49 63 0.00% 50 67 0.00% 51 109 0.00% 52 116 0.00% 53 121 0.00% 54 130 0.00% 55 128 0.00% 56 154 0.00% 57 172 0.00% 58 222 0.00% 59 240 0.00% 60 267 0.00% 61 361 0.00% 62 353 0.00% 63 411 0.00% 64 490 0.00% 65 487 0.00% 66 586 0.00% 67 745 0.01% 68 1019 0.01% 69 1469 0.01% 70 1605 0.01% 71 1293 0.01% 72 1388 0.01% 73 1587 0.01% 74 1706 0.01% 75 1789 0.01% 76 1936 0.01% 77 2225 0.02% 78 2443 0.02% 79 2803 0.02% 80 3113 0.02% 81 3594 0.02% 82 4082 0.03% 83 4682 0.03% 84 6035 0.04% 85 6982 0.05% 86 7462 0.05% 87 7860 0.05% 88 8328 0.06% 89 8575 0.06% 90 9371 0.06% 91 10120 0.07% 92 10970 0.07% 93 11681 0.08% 94 12163 0.08% 95 13111 0.09% 96 13722 0.09% 97 14149 0.10% 98 14559 0.10% 99 15215 0.10% 100 16041 0.11% 101 17210 0.12% 102 18271 0.12% 103 19567 0.13% 104 20736 0.14% 105 21404 0.14% 106 21852 0.15% 107 22215 0.15% 108 22912 0.15% 109 23673 0.16% 110 24433 0.17% 111 25848 0.17% 112 27282 0.18% 113 28187 0.19% 114 30101 0.20% 115 31023 0.21% 116 31765 0.21% 117 32037 0.22% 118 32809 0.22% 119 33172 0.22% 120 33951 0.23% 121 35560 0.24% 122 37194 0.25% 123 38798 0.26% 124 41047 0.28% 125 42469 0.29% 126 44131 0.30% 127 44823 0.30% 128 45702 0.31% 129 47029 0.32% 130 48305 0.33% 131 50375 0.34% 132 51944 0.35% 133 55676 0.38% 134 58398 0.39% 135 61692 0.42% 136 64571 0.44% 137 67286 0.45% 138 71392 0.48% 139 74807 0.51% 140 78876 0.53% 141 85363 0.58% 142 93797 0.63% 143 104616 0.71% 144 119492 0.81% 145 141064 0.95% 146 174350 1.18% 147 227331 1.54% 148 331568 2.24% 149 629113 4.25% 150 3356497 22.68% 151 7731232 52.23% 14801842 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=41 prefix-density=0.31 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=163.90 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.89 fanout-score-rank=20 prefix-density=0.28 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=200.86 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATG SRR7170199 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:06:10 Started mapping on | Feb 12 19:06:10 Finished on | Feb 12 19:07:21 Mapping speed, Million of reads per hour | 750.52 Number of input reads | 14801842 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13960065 Uniquely mapped reads % | 94.31% Average mapped length | 292.42 Number of splices: Total | 12374883 Number of splices: Annotated (sjdb) | 12164275 Number of splices: GT/AG | 12197357 Number of splices: GC/AG | 138676 Number of splices: AT/AC | 10259 Number of splices: Non-canonical | 28591 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250643 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 27959 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 615109 615109 615109 N_multimapping 250643 250643 250643 N_noFeature 308716 13789789 369838 N_ambiguous 164721 1249 54619 UnstrandedReadsAssigned:13486628 PositiveStrandReadsAssigned:169027 NegativeStrandReadsAssigned:13535608 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170199 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170199-trimmed-pair1.fastq SRR7170199-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,801,842 reads, 13,450,055 reads pseudoaligned [quant] estimated average fragment length: 231.422 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR7170199.ke.tsv 34699 SRR7170199.se.tsv 87100 total ==> SRR7170199.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.58 182 6.90559 Potri.005G024800.1.v4.1 1035 804.578 23 1.93889 Potri.004G059700.1.v4.1 961 730.596 2 0.185672 Potri.007G009000.2.v4.1 1416 1185.58 0 0 Potri.003G141000.2.v4.1 2943 2712.58 235.033 5.87679 Potri.016G087400.1.v4.1 270 85.6273 1301.53 1030.95 Potri.015G069301.1.v4.1 564 338.016 0 0 Potri.010G195200.1.v4.1 1773 1542.58 10 0.439691 Potri.012G127500.1.v4.1 977 746.59 5891 535.182 ==> SRR7170199.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1140 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170199 completed mapping pipeline successfully