Starting /dee2/code/volunteer_pipeline.sh SRR7170200 current disk space = 3051317522432 free memory = 1505229304 SRR7170200 SRAfilesize 62a59056c7a5e631816800f72321046a SRR7170200.sra SRR7170200.sra file validated SRR7170200 is paired end SRR7170200 is conventional basespace SRR7170200 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170200_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0405 34.0 33.0 34.0 33.0 34.0 2 33.3575 34.0 33.0 34.0 33.0 34.0 3 33.45375 34.0 34.0 34.0 33.0 34.0 4 33.442 34.0 34.0 34.0 33.0 34.0 5 33.51775 34.0 34.0 34.0 33.0 34.0 6 35.6295 38.0 37.0 38.0 30.0 38.0 7 37.0015 38.0 38.0 38.0 36.0 38.0 8 37.36775 38.0 38.0 38.0 37.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10-14 37.509 38.0 38.0 38.0 37.6 38.0 15-19 37.5456 38.0 38.0 38.0 38.0 38.0 20-24 37.519850000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.254099999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.4831 38.0 38.0 38.0 37.8 38.0 35-39 37.4688 38.0 38.0 38.0 37.8 38.0 40-44 37.31875 38.0 38.0 38.0 37.0 38.0 45-49 37.28475 38.0 38.0 38.0 37.0 38.0 50-54 37.25695 38.0 38.0 38.0 37.0 38.0 55-59 37.2521 38.0 38.0 38.0 37.0 38.0 60-64 36.786950000000004 38.0 37.8 38.0 35.0 38.0 65-69 37.2262 38.0 38.0 38.0 37.0 38.0 70-74 37.0796 38.0 38.0 38.0 36.0 38.0 75-79 37.09355000000001 38.0 38.0 38.0 36.2 38.0 80-84 36.78305 38.0 37.8 38.0 34.8 38.0 85-89 36.7351 38.0 37.8 38.0 35.2 38.0 90-94 36.846450000000004 38.0 38.0 38.0 35.6 38.0 95-99 36.91015 38.0 38.0 38.0 35.8 38.0 100-104 36.7393 38.0 38.0 38.0 35.0 38.0 105-109 36.536 38.0 38.0 38.0 34.2 38.0 110-114 36.579550000000005 38.0 38.0 38.0 34.6 38.0 115-119 36.5466 38.0 38.0 38.0 34.4 38.0 120-124 36.33385 38.0 38.0 38.0 34.0 38.0 125-129 36.122299999999996 38.0 38.0 38.0 33.4 38.0 130-134 36.08225 38.0 37.8 38.0 33.4 38.0 135-139 35.753750000000004 38.0 36.6 38.0 32.6 38.0 140-144 35.48745 38.0 36.0 38.0 31.2 38.0 145-149 35.207550000000005 38.0 36.0 38.0 31.6 38.0 150-151 31.674 36.5 31.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 2.0 18 4.0 19 1.0 20 0.0 21 3.0 22 4.0 23 6.0 24 7.0 25 11.0 26 13.0 27 17.0 28 16.0 29 25.0 30 30.0 31 48.0 32 63.0 33 91.0 34 120.0 35 194.0 36 479.0 37 2857.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.41772151898734 15.49367088607595 10.405063291139241 34.68354430379747 2 20.45 20.95 36.225 22.375 3 18.975 26.924999999999997 26.025 28.075 4 20.575 35.175 22.175 22.075 5 21.375 37.675 22.775000000000002 18.175 6 18.21821821821822 36.286286286286284 25.5005005005005 19.994994994994993 7 13.425 23.400000000000002 43.325 19.85 8 18.4 23.25 29.425 28.925 9 18.275 22.875 32.15 26.700000000000003 10-14 19.564999999999998 30.014999999999997 26.174999999999997 24.245 15-19 19.759999999999998 28.494999999999997 27.72 24.025 20-24 20.61 28.48 26.85 24.060000000000002 25-29 20.325 28.999999999999996 27.750000000000004 22.925 30-34 20.395 29.03 27.565 23.01 35-39 19.950000000000003 28.82 27.36 23.87 40-44 20.235 28.615000000000002 27.485 23.665 45-49 20.265 28.425 27.41 23.9 50-54 20.45 28.595 26.915 24.04 55-59 20.225 28.360000000000003 27.544999999999998 23.87 60-64 20.495 29.04 26.805 23.66 65-69 20.375 28.849999999999998 26.884999999999998 23.89 70-74 20.165 28.939999999999998 27.694999999999997 23.200000000000003 75-79 20.135 28.96 27.35 23.555 80-84 20.365 28.860000000000003 27.3 23.474999999999998 85-89 20.825 28.435 26.840000000000003 23.9 90-94 20.830000000000002 28.165000000000003 27.315 23.69 95-99 20.474999999999998 28.58 27.715 23.23 100-104 20.885 29.330000000000002 26.38 23.405 105-109 20.605 28.52 27.02 23.855 110-114 20.385 28.884999999999998 26.895000000000003 23.835 115-119 20.95 28.110000000000003 27.015 23.925 120-124 20.785 28.49 27.105 23.62 125-129 20.8970897089709 27.867786778677868 27.017701770177016 24.217421742174217 130-134 20.549999999999997 28.060000000000002 27.425 23.965 135-139 21.27606380319016 28.171408570428518 26.511325566278316 24.041202060103007 140-144 20.9 29.020000000000003 26.19 23.89 145-149 21.11 29.360000000000003 25.985000000000003 23.544999999999998 150-151 20.825 28.787499999999998 25.7 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 1.0 26 2.0 27 3.0 28 5.5 29 16.0 30 19.0 31 19.5 32 33.5 33 47.5 34 51.0 35 61.5 36 91.0 37 124.0 38 156.5 39 175.0 40 183.0 41 212.5 42 234.5 43 256.0 44 272.5 45 257.5 46 247.0 47 239.0 48 224.5 49 203.0 50 175.5 51 146.5 52 128.5 53 110.0 54 86.5 55 56.0 56 35.5 57 35.0 58 24.0 59 13.0 60 11.5 61 8.5 62 4.0 63 3.5 64 3.5 65 2.5 66 2.5 67 2.5 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.775 0.0 0.0 0.0 0.0 124-125 5.112500000000001 0.0 0.0 0.0 0.0 126-127 5.487500000000001 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.625 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170200 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170200_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83175 33.0 33.0 34.0 32.0 34.0 2 32.99625 34.0 33.0 34.0 32.0 34.0 3 33.06375 34.0 33.0 34.0 32.0 34.0 4 33.04325 34.0 33.0 34.0 32.0 34.0 5 33.0615 34.0 33.0 34.0 32.0 34.0 6 37.24675 38.0 38.0 38.0 37.0 38.0 7 37.2815 38.0 38.0 38.0 37.0 38.0 8 37.22225 38.0 38.0 38.0 37.0 38.0 9 37.1775 38.0 38.0 38.0 37.0 38.0 10-14 37.1825 38.0 38.0 38.0 37.0 38.0 15-19 37.21585 38.0 38.0 38.0 37.0 38.0 20-24 37.15585 38.0 38.0 38.0 37.0 38.0 25-29 37.171749999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.9847 38.0 38.0 38.0 36.8 38.0 35-39 36.67059999999999 38.0 38.0 38.0 35.2 38.0 40-44 36.793150000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.9833 38.0 38.0 38.0 36.4 38.0 50-54 37.035450000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.967499999999994 38.0 38.0 38.0 36.6 38.0 60-64 36.90385 38.0 38.0 38.0 36.0 38.0 65-69 36.9075 38.0 38.0 38.0 36.2 38.0 70-74 36.76955 38.0 38.0 38.0 35.8 38.0 75-79 36.7267 38.0 38.0 38.0 35.6 38.0 80-84 36.7201 38.0 38.0 38.0 35.8 38.0 85-89 36.728750000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.7311 38.0 38.0 38.0 35.6 38.0 95-99 36.68625000000001 38.0 38.0 38.0 35.4 38.0 100-104 36.581399999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.411500000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.28815 38.0 38.0 38.0 34.0 38.0 115-119 36.16155 38.0 38.0 38.0 34.0 38.0 120-124 35.99555 38.0 38.0 38.0 33.8 38.0 125-129 35.777499999999996 38.0 37.6 38.0 32.6 38.0 130-134 35.53595 38.0 37.0 38.0 31.2 38.0 135-139 35.350049999999996 38.0 37.0 38.0 31.6 38.0 140-144 35.056099999999994 38.0 36.0 38.0 30.0 38.0 145-149 34.180899999999994 38.0 35.2 38.0 25.2 38.0 150-151 30.3825 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 2.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 2.0 16 4.0 17 5.0 18 5.0 19 2.0 20 9.0 21 13.0 22 5.0 23 17.0 24 11.0 25 15.0 26 19.0 27 22.0 28 25.0 29 38.0 30 28.0 31 39.0 32 56.0 33 98.0 34 134.0 35 188.0 36 423.0 37 2823.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.48512128032008 17.57939484871218 14.028507126781694 27.906976744186046 2 24.5311327831958 24.981245311327832 33.73343335833959 16.754188547136785 3 20.7551887971993 28.307076769192296 30.632658164541137 20.305076269067268 4 22.95 35.949999999999996 21.25 19.85 5 23.5 35.825 22.075 18.6 6 19.950000000000003 36.725 23.474999999999998 19.85 7 18.875 18.9 40.525 21.7 8 21.15 23.65 26.700000000000003 28.499999999999996 9 22.975 24.099999999999998 27.700000000000003 25.224999999999998 10-14 23.11 27.99 26.889999999999997 22.009999999999998 15-19 23.549999999999997 27.29 27.889999999999997 21.27 20-24 23.105 27.715 27.735 21.445 25-29 23.315 28.01 27.62 21.055 30-34 23.1 27.71 27.765 21.425 35-39 23.015 27.485 28.095 21.404999999999998 40-44 23.465 27.644999999999996 27.975 20.915 45-49 23.26 27.71 28.255000000000003 20.775 50-54 23.515 28.15 27.62 20.715 55-59 23.765 27.045 28.15 21.04 60-64 23.849999999999998 27.355 28.435 20.36 65-69 23.31 27.73 27.76 21.2 70-74 23.474999999999998 28.050000000000004 27.525 20.95 75-79 23.48 27.560000000000002 28.235 20.724999999999998 80-84 23.66 28.189999999999998 27.33 20.82 85-89 23.851192559627982 27.57637881894095 27.74638731936597 20.826041302065104 90-94 23.865 27.405 28.310000000000002 20.419999999999998 95-99 23.56 27.3 28.26 20.880000000000003 100-104 23.895 27.52 27.665 20.919999999999998 105-109 24.085838627382323 27.667450352658697 27.69746385873643 20.54924716122255 110-114 24.41622081104055 27.66638331916596 27.74638731936597 20.171008550427523 115-119 24.65 27.35 27.805000000000003 20.195 120-124 24.38 27.750000000000004 27.51 20.36 125-129 24.63 27.265 27.47 20.635 130-134 24.083429200220078 27.229530335617465 27.38458460461161 21.302455859550843 135-139 25.03125781445361 27.686921730432605 26.81670417604401 20.46511627906977 140-144 25.81 27.67 27.005000000000003 19.515 145-149 24.786153769196137 27.717472862788256 27.36231304086839 20.134060327147214 150-151 25.403781144359584 28.446225115813196 26.893702266182544 19.256291473644673 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 3.0 28 2.5 29 6.5 30 8.0 31 7.5 32 16.0 33 28.5 34 39.5 35 50.0 36 79.5 37 107.0 38 125.5 39 145.5 40 184.0 41 225.5 42 242.5 43 278.5 44 289.5 45 279.5 46 289.0 47 277.0 48 246.5 49 223.0 50 185.0 51 151.0 52 125.5 53 100.5 54 78.0 55 56.5 56 44.0 57 30.0 58 19.5 59 12.5 60 9.0 61 7.5 62 6.5 63 4.0 64 2.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.045 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.034999999999999996 135-139 0.025 140-144 0.0 145-149 0.045 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.675000000000001 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.362500000000001 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.175 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.2375 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATCC 10 0.006830828 145.0 7 CTCAAAT 10 0.006830828 145.0 1 GAGAAGG 30 0.0017973486 72.5 3 >>END_MODULE Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845227 spots for SRR7170200.sra Written 845227 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra Read 845224 spots for SRR7170200.sra Written 845224 spots for SRR7170200.sra SRR ids: ['SRR7170200.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r5zjab17 SRR7170200.sra spots: 16904483 blocks: [[1, 845224], [845225, 1690448], [1690449, 2535672], [2535673, 3380896], [3380897, 4226120], [4226121, 5071344], [5071345, 5916568], [5916569, 6761792], [6761793, 7607016], [7607017, 8452240], [8452241, 9297464], [9297465, 10142688], [10142689, 10987912], [10987913, 11833136], [11833137, 12678360], [12678361, 13523584], [13523585, 14368808], [14368809, 15214032], [15214033, 16059256], [16059257, 16904483]] SRR7170200 file size 5706674 SRR7170200 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170200 SRR7170200_1.fastq SRR7170200_2.fastq Input file: SRR7170200_1.fastq Paired file: SRR7170200_2.fastq trimmed: SRR7170200-trimmed-pair1.fastq, SRR7170200-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:22:09 2025 >> started Wed Feb 12 18:22:31 2025 >> done (21.199s) 16904483 read pairs processed; of these: 14256 ( 0.08%) short read pairs filtered out after trimming by size control 23354 ( 0.14%) empty read pairs filtered out after trimming by size control 16866873 (99.78%) read pairs available; of these: 7849435 (46.54%) trimmed read pairs available after processing 9017438 (53.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 11 0.00% 24 3 0.00% 25 3 0.00% 26 12 0.00% 27 5 0.00% 28 6 0.00% 29 8 0.00% 30 8 0.00% 31 5 0.00% 32 13 0.00% 33 7 0.00% 34 15 0.00% 35 9 0.00% 36 15 0.00% 37 24 0.00% 38 21 0.00% 39 36 0.00% 40 32 0.00% 41 34 0.00% 42 27 0.00% 43 33 0.00% 44 46 0.00% 45 62 0.00% 46 71 0.00% 47 61 0.00% 48 78 0.00% 49 90 0.00% 50 108 0.00% 51 120 0.00% 52 147 0.00% 53 160 0.00% 54 174 0.00% 55 180 0.00% 56 207 0.00% 57 256 0.00% 58 273 0.00% 59 325 0.00% 60 358 0.00% 61 443 0.00% 62 496 0.00% 63 553 0.00% 64 577 0.00% 65 628 0.00% 66 788 0.00% 67 875 0.01% 68 1000 0.01% 69 1234 0.01% 70 1672 0.01% 71 1545 0.01% 72 1719 0.01% 73 1979 0.01% 74 2141 0.01% 75 2312 0.01% 76 2502 0.01% 77 2888 0.02% 78 3228 0.02% 79 3418 0.02% 80 3884 0.02% 81 4444 0.03% 82 5324 0.03% 83 5831 0.03% 84 7164 0.04% 85 7999 0.05% 86 8489 0.05% 87 8884 0.05% 88 9483 0.06% 89 10013 0.06% 90 11028 0.07% 91 11869 0.07% 92 12866 0.08% 93 14237 0.08% 94 14850 0.09% 95 15615 0.09% 96 16616 0.10% 97 16963 0.10% 98 17671 0.10% 99 18799 0.11% 100 19634 0.12% 101 20570 0.12% 102 22379 0.13% 103 23673 0.14% 104 25058 0.15% 105 26176 0.16% 106 27304 0.16% 107 27466 0.16% 108 28237 0.17% 109 28962 0.17% 110 29871 0.18% 111 31192 0.18% 112 33237 0.20% 113 34695 0.21% 114 36842 0.22% 115 38062 0.23% 116 38433 0.23% 117 39189 0.23% 118 39916 0.24% 119 40221 0.24% 120 41503 0.25% 121 43461 0.26% 122 44900 0.27% 123 47784 0.28% 124 49495 0.29% 125 51064 0.30% 126 53154 0.32% 127 53586 0.32% 128 54558 0.32% 129 55687 0.33% 130 57676 0.34% 131 58919 0.35% 132 61952 0.37% 133 65959 0.39% 134 69372 0.41% 135 73209 0.43% 136 76011 0.45% 137 79188 0.47% 138 82788 0.49% 139 84960 0.50% 140 89544 0.53% 141 96802 0.57% 142 104399 0.62% 143 116438 0.69% 144 132561 0.79% 145 154381 0.92% 146 187319 1.11% 147 240839 1.43% 148 344393 2.04% 149 646976 3.84% 150 3664350 21.73% 151 9017438 53.46% 16866873 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=110.78 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=17.4 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.48 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=132.79 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.0 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7170200 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:23:18 Started mapping on | Feb 12 18:23:18 Finished on | Feb 12 18:24:58 Mapping speed, Million of reads per hour | 607.21 Number of input reads | 16866873 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16043932 Uniquely mapped reads % | 95.12% Average mapped length | 292.22 Number of splices: Total | 14818425 Number of splices: Annotated (sjdb) | 14575717 Number of splices: GT/AG | 14601223 Number of splices: GC/AG | 170638 Number of splices: AT/AC | 12066 Number of splices: Non-canonical | 34498 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278706 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 42044 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559939 559939 559939 N_multimapping 278706 278706 278706 N_noFeature 334766 15878245 400836 N_ambiguous 160532 792 60428 UnstrandedReadsAssigned:15548634 PositiveStrandReadsAssigned:164895 NegativeStrandReadsAssigned:15582668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170200 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170200-trimmed-pair1.fastq SRR7170200-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,866,873 reads, 15,501,708 reads pseudoaligned [quant] estimated average fragment length: 226.87 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7170200.ke.tsv 34699 SRR7170200.se.tsv 87100 total ==> SRR7170200.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.13 269 9.48709 Potri.005G024800.1.v4.1 1035 809.13 49 3.82761 Potri.004G059700.1.v4.1 961 735.183 1 0.0859716 Potri.007G009000.2.v4.1 1416 1190.13 0 0 Potri.003G141000.2.v4.1 2943 2717.13 319.034 7.42125 Potri.016G087400.1.v4.1 270 87.8237 1454.02 1046.43 Potri.015G069301.1.v4.1 564 342.892 0 0 Potri.010G195200.1.v4.1 1773 1547.13 33 1.34815 Potri.012G127500.1.v4.1 977 751.166 5505 463.204 ==> SRR7170200.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170200 completed mapping pipeline successfully