Starting /dee2/code/volunteer_pipeline.sh SRR7170201 current disk space = 3051323490304 free memory = 993962772 SRR7170201 SRAfilesize 51ee99357a639e3744faf78355a65c9c SRR7170201.sra SRR7170201.sra file validated SRR7170201 is paired end SRR7170201 is conventional basespace SRR7170201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06 34.0 33.0 34.0 33.0 34.0 2 33.36 34.0 33.0 34.0 33.0 34.0 3 33.461 34.0 34.0 34.0 33.0 34.0 4 33.43275 34.0 33.0 34.0 33.0 34.0 5 33.424 34.0 33.0 34.0 33.0 34.0 6 37.0685 38.0 37.0 38.0 36.0 38.0 7 35.3085 38.0 37.0 38.0 28.0 38.0 8 36.935 38.0 38.0 38.0 35.0 38.0 9 37.3295 38.0 38.0 38.0 37.0 38.0 10-14 36.947449999999996 38.0 37.8 38.0 35.2 38.0 15-19 37.37689999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.5052 38.0 38.0 38.0 38.0 38.0 25-29 37.4822 38.0 38.0 38.0 38.0 38.0 30-34 37.49895 38.0 38.0 38.0 38.0 38.0 35-39 37.4022 38.0 38.0 38.0 37.2 38.0 40-44 37.2705 38.0 38.0 38.0 37.0 38.0 45-49 36.18470000000001 38.0 37.2 38.0 31.8 38.0 50-54 36.814800000000005 38.0 37.8 38.0 34.8 38.0 55-59 36.972500000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.00325 38.0 38.0 38.0 36.0 38.0 65-69 37.0265 38.0 38.0 38.0 36.0 38.0 70-74 35.902550000000005 38.0 36.8 38.0 30.8 38.0 75-79 36.75665 38.0 38.0 38.0 35.0 38.0 80-84 36.85175 38.0 38.0 38.0 35.2 38.0 85-89 36.5792 38.0 38.0 38.0 34.4 38.0 90-94 36.5981 38.0 38.0 38.0 34.2 38.0 95-99 36.627950000000006 38.0 38.0 38.0 34.8 38.0 100-104 36.421299999999995 38.0 37.8 38.0 34.0 38.0 105-109 36.164 38.0 37.6 38.0 33.2 38.0 110-114 36.1143 38.0 37.4 38.0 33.4 38.0 115-119 35.808800000000005 38.0 36.8 38.0 31.6 38.0 120-124 35.8559 38.0 37.0 38.0 32.2 38.0 125-129 35.762249999999995 38.0 36.6 38.0 31.8 38.0 130-134 35.535399999999996 38.0 36.2 38.0 31.0 38.0 135-139 35.13590000000001 38.0 36.0 38.0 29.6 38.0 140-144 34.72855 38.0 35.2 38.0 27.6 38.0 145-149 34.6248 38.0 35.0 38.0 28.8 38.0 150-151 30.982375 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 5.0 17 2.0 18 4.0 19 5.0 20 2.0 21 7.0 22 5.0 23 5.0 24 10.0 25 11.0 26 13.0 27 22.0 28 28.0 29 29.0 30 45.0 31 56.0 32 86.0 33 103.0 34 160.0 35 249.0 36 700.0 37 2448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.84109311740891 14.752024291497975 11.791497975708502 34.61538461538461 2 20.025000000000002 21.025 33.95 25.0 3 20.175 26.875 25.5 27.450000000000003 4 22.475 35.925000000000004 20.575 21.025 5 21.165874405804352 35.351513635226425 24.418313735301474 19.06429822366775 6 17.925 35.675000000000004 26.150000000000002 20.25 7 13.65 22.075 43.85 20.424999999999997 8 19.075 22.8 29.049999999999997 29.075 9 18.099999999999998 24.85 31.8 25.25 10-14 20.05 30.464999999999996 25.865 23.62 15-19 20.21 29.62 26.590000000000003 23.580000000000002 20-24 20.200000000000003 29.744999999999997 27.065 22.99 25-29 20.01 28.93 27.725 23.335 30-34 20.380000000000003 29.285 26.615 23.72 35-39 20.115 29.054999999999996 27.24 23.59 40-44 20.375 28.82 26.979999999999997 23.825 45-49 20.064999999999998 29.26 26.840000000000003 23.835 50-54 20.13 29.104999999999997 26.805 23.96 55-59 20.07 29.145 26.875 23.91 60-64 19.695 29.299999999999997 27.060000000000002 23.945 65-69 20.315 28.735 26.965 23.985 70-74 21.065 28.83 26.33 23.775 75-79 20.125 28.84 26.985 24.05 80-84 20.435 29.049999999999997 26.465 24.05 85-89 20.64 29.4 26.695 23.265 90-94 20.830000000000002 28.915000000000003 26.540000000000003 23.715 95-99 20.185 28.384999999999998 27.265 24.165 100-104 20.885 28.835 26.35 23.93 105-109 20.575 28.735 26.515 24.175 110-114 21.14 28.310000000000002 27.01 23.54 115-119 21.095 29.044999999999998 26.424999999999997 23.435 120-124 21.4 28.21 26.340000000000003 24.05 125-129 21.005 27.985 26.36 24.65 130-134 20.979999999999997 28.725 26.279999999999998 24.015 135-139 21.154999999999998 28.23 26.31 24.305 140-144 20.96604830241512 28.671433571678584 26.351317565878297 24.011200560028 145-149 20.645 28.249999999999996 26.534999999999997 24.57 150-151 21.28298111791922 28.973365011879455 25.4345379517319 24.309115918469427 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 2.0 23 3.0 24 3.0 25 4.0 26 8.5 27 11.0 28 14.0 29 17.5 30 19.5 31 27.5 32 38.5 33 46.0 34 52.5 35 68.0 36 92.0 37 113.0 38 134.5 39 164.5 40 176.0 41 194.5 42 213.5 43 241.5 44 269.5 45 273.0 46 272.5 47 254.5 48 230.0 49 190.5 50 153.5 51 136.0 52 119.5 53 101.5 54 83.0 55 63.0 56 45.0 57 35.5 58 29.0 59 23.0 60 19.5 61 12.5 62 9.0 63 6.5 64 3.5 65 4.0 66 4.0 67 2.0 68 3.5 69 4.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.112500000000001 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTCTGG 10 0.006832588 144.9875 4 >>END_MODULE SRR7170201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85375 33.0 33.0 34.0 32.0 34.0 2 32.99 34.0 33.0 34.0 32.0 34.0 3 32.878 34.0 33.0 34.0 32.0 34.0 4 32.75625 34.0 33.0 34.0 32.0 34.0 5 32.91725 34.0 33.0 34.0 32.0 34.0 6 37.0025 38.0 38.0 38.0 37.0 38.0 7 36.984 38.0 38.0 38.0 37.0 38.0 8 36.8355 38.0 38.0 38.0 36.0 38.0 9 36.817 38.0 38.0 38.0 36.0 38.0 10-14 36.777300000000004 38.0 38.0 38.0 36.4 38.0 15-19 36.79655 38.0 38.0 38.0 36.6 38.0 20-24 36.69185 38.0 38.0 38.0 36.2 38.0 25-29 36.68405 38.0 38.0 38.0 36.2 38.0 30-34 36.646899999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.58475 38.0 38.0 38.0 35.6 38.0 40-44 36.5704 38.0 38.0 38.0 35.6 38.0 45-49 36.552499999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.5928 38.0 38.0 38.0 35.8 38.0 55-59 36.55445 38.0 38.0 38.0 35.8 38.0 60-64 36.637550000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.53335 38.0 38.0 38.0 35.4 38.0 70-74 36.357299999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.04815 38.0 38.0 38.0 33.6 38.0 80-84 36.21395 38.0 38.0 38.0 34.4 38.0 85-89 36.3317 38.0 38.0 38.0 35.0 38.0 90-94 36.2678 38.0 38.0 38.0 34.6 38.0 95-99 36.25165 38.0 38.0 38.0 34.8 38.0 100-104 36.137449999999994 38.0 38.0 38.0 34.4 38.0 105-109 35.9967 38.0 38.0 38.0 34.0 38.0 110-114 35.8158 38.0 38.0 38.0 33.2 38.0 115-119 35.6993 38.0 38.0 38.0 32.8 38.0 120-124 35.5898 38.0 37.8 38.0 32.4 38.0 125-129 35.378 38.0 37.4 38.0 31.2 38.0 130-134 34.9775 38.0 36.4 38.0 29.0 38.0 135-139 34.623599999999996 38.0 35.8 38.0 26.8 38.0 140-144 34.53165 38.0 35.8 38.0 27.2 38.0 145-149 33.8842 38.0 34.8 38.0 21.6 38.0 150-151 29.885125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 11.0 4 3.0 5 1.0 6 7.0 7 5.0 8 2.0 9 5.0 10 1.0 11 4.0 12 4.0 13 6.0 14 4.0 15 5.0 16 4.0 17 9.0 18 4.0 19 6.0 20 4.0 21 7.0 22 12.0 23 7.0 24 10.0 25 10.0 26 11.0 27 29.0 28 24.0 29 35.0 30 44.0 31 48.0 32 62.0 33 78.0 34 112.0 35 195.0 36 447.0 37 2765.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.625 16.950000000000003 16.825000000000003 26.6 2 24.6 24.725 33.125 17.549999999999997 3 22.725 27.575 28.825 20.875 4 25.0 33.650000000000006 22.025 19.325 5 23.325000000000003 36.425000000000004 22.3 17.95 6 21.25 34.9 24.0 19.85 7 19.400000000000002 18.125 40.65 21.825 8 22.2 24.775 27.200000000000003 25.825 9 22.775000000000002 24.275 29.125 23.825 10-14 23.515 27.889999999999997 26.119999999999997 22.475 15-19 23.525 27.48 27.21 21.785 20-24 23.315 27.79 27.500000000000004 21.395 25-29 23.69 27.735 27.395000000000003 21.18 30-34 24.485 27.51 27.205000000000002 20.8 35-39 24.11 27.145000000000003 27.24 21.505 40-44 23.49852477871681 28.0892133820073 27.054058108716305 21.358203730559584 45-49 23.82238223822382 26.98769876987699 27.947794779477945 21.242124212421242 50-54 23.71 28.23 27.105 20.955 55-59 24.115000000000002 27.865000000000002 26.865 21.154999999999998 60-64 23.369999999999997 27.115000000000002 28.244999999999997 21.27 65-69 23.57 27.310000000000002 27.92 21.2 70-74 23.785 27.465 27.805000000000003 20.945 75-79 23.936196809840492 27.321366068303416 27.816390819540977 20.926046302315115 80-84 23.72 27.495000000000005 28.035 20.75 85-89 24.215 26.66 28.325 20.8 90-94 23.825 26.97 27.77 21.435000000000002 95-99 23.48 27.52 27.72 21.279999999999998 100-104 24.05 27.12 28.07 20.76 105-109 23.635 26.85 28.585 20.93 110-114 24.085 27.11 27.815 20.990000000000002 115-119 24.635 26.665 28.125 20.575 120-124 24.505 27.169999999999998 27.525 20.8 125-129 24.26 27.68 27.525 20.535 130-134 24.474999999999998 27.935 27.365000000000002 20.225 135-139 25.335 27.644999999999996 27.089999999999996 19.93 140-144 24.72123606180309 27.406370318515926 27.801390069503473 20.07100355017751 145-149 25.22 27.18 27.57 20.03 150-151 25.93843843843844 26.43893893893894 26.976976976976978 20.645645645645647 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.0 26 2.0 27 2.5 28 4.0 29 6.5 30 10.0 31 12.5 32 13.0 33 16.0 34 26.0 35 44.5 36 58.5 37 84.0 38 131.0 39 146.5 40 167.5 41 207.0 42 226.5 43 266.0 44 290.0 45 288.0 46 305.0 47 290.0 48 242.5 49 215.5 50 189.0 51 148.0 52 126.5 53 116.0 54 86.5 55 61.0 56 54.0 57 42.5 58 26.0 59 20.0 60 15.5 61 13.0 62 13.0 63 7.5 64 3.0 65 2.5 66 2.0 67 3.5 68 2.5 69 2.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.37688442211055273 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.15 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGGC 10 0.006830828 145.0 5 CAGGGTG 10 0.006830828 145.0 4 >>END_MODULE Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915231 spots for SRR7170201.sra Written 915231 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra Read 915227 spots for SRR7170201.sra Written 915227 spots for SRR7170201.sra SRR ids: ['SRR7170201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_18un4gfl SRR7170201.sra spots: 18304544 blocks: [[1, 915227], [915228, 1830454], [1830455, 2745681], [2745682, 3660908], [3660909, 4576135], [4576136, 5491362], [5491363, 6406589], [6406590, 7321816], [7321817, 8237043], [8237044, 9152270], [9152271, 10067497], [10067498, 10982724], [10982725, 11897951], [11897952, 12813178], [12813179, 13728405], [13728406, 14643632], [14643633, 15558859], [15558860, 16474086], [16474087, 17389313], [17389314, 18304544]] SRR7170201 file size 6181108 SRR7170201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170201 SRR7170201_1.fastq SRR7170201_2.fastq Input file: SRR7170201_1.fastq Paired file: SRR7170201_2.fastq trimmed: SRR7170201-trimmed-pair1.fastq, SRR7170201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:25:17 2025 >> started Wed Feb 12 18:25:40 2025 >> done (23.345s) 18304544 read pairs processed; of these: 47428 ( 0.26%) short read pairs filtered out after trimming by size control 56785 ( 0.31%) empty read pairs filtered out after trimming by size control 18200331 (99.43%) read pairs available; of these: 8339389 (45.82%) trimmed read pairs available after processing 9860942 (54.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 4 0.00% 21 8 0.00% 22 10 0.00% 23 8 0.00% 24 16 0.00% 25 10 0.00% 26 11 0.00% 27 12 0.00% 28 9 0.00% 29 14 0.00% 30 11 0.00% 31 17 0.00% 32 20 0.00% 33 12 0.00% 34 23 0.00% 35 17 0.00% 36 19 0.00% 37 40 0.00% 38 42 0.00% 39 45 0.00% 40 36 0.00% 41 33 0.00% 42 52 0.00% 43 59 0.00% 44 60 0.00% 45 82 0.00% 46 63 0.00% 47 87 0.00% 48 106 0.00% 49 112 0.00% 50 125 0.00% 51 129 0.00% 52 171 0.00% 53 186 0.00% 54 198 0.00% 55 206 0.00% 56 231 0.00% 57 230 0.00% 58 300 0.00% 59 316 0.00% 60 347 0.00% 61 419 0.00% 62 434 0.00% 63 571 0.00% 64 623 0.00% 65 737 0.00% 66 887 0.00% 67 984 0.01% 68 1146 0.01% 69 1870 0.01% 70 2570 0.01% 71 1947 0.01% 72 1786 0.01% 73 1944 0.01% 74 2011 0.01% 75 2205 0.01% 76 2389 0.01% 77 2696 0.01% 78 2912 0.02% 79 3213 0.02% 80 3601 0.02% 81 4213 0.02% 82 4802 0.03% 83 5527 0.03% 84 8031 0.04% 85 9744 0.05% 86 10156 0.06% 87 10471 0.06% 88 10895 0.06% 89 11079 0.06% 90 11941 0.07% 91 12837 0.07% 92 13841 0.08% 93 14927 0.08% 94 15500 0.09% 95 16620 0.09% 96 17160 0.09% 97 17774 0.10% 98 18283 0.10% 99 19326 0.11% 100 20213 0.11% 101 21624 0.12% 102 23242 0.13% 103 24698 0.14% 104 26259 0.14% 105 27235 0.15% 106 28104 0.15% 107 28707 0.16% 108 29672 0.16% 109 30656 0.17% 110 31324 0.17% 111 33008 0.18% 112 35070 0.19% 113 37340 0.21% 114 39162 0.22% 115 40407 0.22% 116 41447 0.23% 117 41867 0.23% 118 42781 0.24% 119 43515 0.24% 120 44302 0.24% 121 46270 0.25% 122 48400 0.27% 123 51169 0.28% 124 53075 0.29% 125 55135 0.30% 126 57135 0.31% 127 58029 0.32% 128 58943 0.32% 129 60801 0.33% 130 61740 0.34% 131 64716 0.36% 132 67930 0.37% 133 71372 0.39% 134 74413 0.41% 135 79061 0.43% 136 83428 0.46% 137 86981 0.48% 138 90404 0.50% 139 94523 0.52% 140 97426 0.54% 141 105252 0.58% 142 114748 0.63% 143 126046 0.69% 144 144465 0.79% 145 168679 0.93% 146 201840 1.11% 147 260063 1.43% 148 378113 2.08% 149 696436 3.83% 150 3820604 20.99% 151 9860942 54.18% 18200331 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=242.86 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.3 sequence=GAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGACAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=198.52 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAA SRR7170201 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:26:31 Started mapping on | Feb 12 18:26:32 Finished on | Feb 12 18:29:28 Mapping speed, Million of reads per hour | 372.28 Number of input reads | 18200331 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16697204 Uniquely mapped reads % | 91.74% Average mapped length | 292.39 Number of splices: Total | 14864749 Number of splices: Annotated (sjdb) | 14615893 Number of splices: GT/AG | 14644783 Number of splices: GC/AG | 176662 Number of splices: AT/AC | 11896 Number of splices: Non-canonical | 31408 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315267 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 128137 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.71% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1225800 1225800 1225800 N_multimapping 315267 315267 315267 N_noFeature 345142 16519134 411988 N_ambiguous 174853 892 63138 UnstrandedReadsAssigned:16177209 PositiveStrandReadsAssigned:177178 NegativeStrandReadsAssigned:16222078 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170201-trimmed-pair1.fastq SRR7170201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,200,331 reads, 16,254,740 reads pseudoaligned [quant] estimated average fragment length: 228.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170201.ke.tsv 34699 SRR7170201.se.tsv 87100 total ==> SRR7170201.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.28 220 6.55554 Potri.005G024800.1.v4.1 1035 807.285 49 3.238 Potri.004G059700.1.v4.1 961 733.29 2 0.1455 Potri.007G009000.2.v4.1 1416 1188.28 0 0 Potri.003G141000.2.v4.1 2943 2715.28 322.038 6.32702 Potri.016G087400.1.v4.1 270 86.1331 1826 1130.94 Potri.015G069301.1.v4.1 564 340.026 0 0 Potri.010G195200.1.v4.1 1773 1545.28 28 0.966624 Potri.012G127500.1.v4.1 977 749.29 8859 630.729 ==> SRR7170201.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1251 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170201 completed mapping pipeline successfully