Starting /dee2/code/volunteer_pipeline.sh SRR7170202 current disk space = 3051378696192 free memory = 1441604040 SRR7170202 SRAfilesize 8697aaa3d163a5313a277298f163fe42 SRR7170202.sra SRR7170202.sra file validated SRR7170202 is paired end SRR7170202 is conventional basespace SRR7170202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.334 34.0 33.0 34.0 33.0 34.0 2 33.506 34.0 34.0 34.0 33.0 34.0 3 33.52075 34.0 34.0 34.0 33.0 34.0 4 33.471 34.0 34.0 34.0 33.0 34.0 5 33.4525 34.0 34.0 34.0 33.0 34.0 6 37.11475 38.0 37.0 38.0 36.0 38.0 7 37.4425 38.0 38.0 38.0 37.0 38.0 8 37.60275 38.0 38.0 38.0 38.0 38.0 9 37.59525 38.0 38.0 38.0 38.0 38.0 10-14 37.543049999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.55735 38.0 38.0 38.0 38.0 38.0 20-24 37.5452 38.0 38.0 38.0 38.0 38.0 25-29 37.50745 38.0 38.0 38.0 38.0 38.0 30-34 37.431349999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.36165 38.0 38.0 38.0 37.4 38.0 40-44 37.190250000000006 38.0 38.0 38.0 36.4 38.0 45-49 37.060950000000005 38.0 38.0 38.0 36.0 38.0 50-54 37.054950000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.9585 38.0 38.0 38.0 35.8 38.0 60-64 36.876549999999995 38.0 38.0 38.0 35.2 38.0 65-69 36.90245 38.0 38.0 38.0 35.0 38.0 70-74 36.84135 38.0 38.0 38.0 35.0 38.0 75-79 36.6386 38.0 38.0 38.0 34.2 38.0 80-84 36.478899999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.4347 38.0 38.0 38.0 34.0 38.0 90-94 36.274499999999996 38.0 37.6 38.0 33.8 38.0 95-99 36.0749 38.0 37.0 38.0 33.0 38.0 100-104 35.9808 38.0 37.0 38.0 32.6 38.0 105-109 35.79774999999999 38.0 37.0 38.0 31.6 38.0 110-114 35.58995 38.0 36.2 38.0 31.0 38.0 115-119 35.1411 38.0 36.0 38.0 28.2 38.0 120-124 34.94955 38.0 35.2 38.0 27.8 38.0 125-129 34.4945 38.0 35.0 38.0 25.2 38.0 130-134 34.218999999999994 38.0 35.0 38.0 23.6 38.0 135-139 33.6722 38.0 34.2 38.0 20.6 38.0 140-144 33.144000000000005 38.0 33.8 38.0 15.0 38.0 145-149 32.272749999999995 38.0 33.4 38.0 11.4 38.0 150-151 28.084125 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 5.0 19 5.0 20 5.0 21 8.0 22 7.0 23 13.0 24 12.0 25 26.0 26 19.0 27 27.0 28 31.0 29 42.0 30 50.0 31 68.0 32 90.0 33 138.0 34 189.0 35 334.0 36 808.0 37 2114.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.217652958876634 15.195586760280843 11.208625877632898 34.37813440320963 2 21.725 21.15 35.099999999999994 22.025 3 18.125 28.299999999999997 25.45 28.125 4 22.475 34.449999999999996 21.175 21.9 5 21.525 36.975 23.35 18.15 6 17.549999999999997 35.199999999999996 25.575 21.675 7 13.775 22.95 43.35 19.925 8 18.475 22.55 29.9 29.075 9 17.9 22.575 31.324999999999996 28.199999999999996 10-14 19.84 30.085 26.009999999999998 24.065 15-19 20.380000000000003 28.42 26.82 24.38 20-24 19.235 28.775000000000002 27.605 24.385 25-29 20.035 28.875 27.655 23.435 30-34 20.06 28.735 27.07 24.135 35-39 20.44 28.485 27.22 23.855 40-44 20.18 29.195 26.665 23.96 45-49 20.419999999999998 28.83 27.215 23.535 50-54 20.395 28.155 27.155 24.295 55-59 20.375 28.265 27.025 24.335 60-64 20.025000000000002 28.62 27.0 24.355 65-69 20.005 28.970000000000002 26.22 24.805 70-74 20.47 28.935 26.625 23.97 75-79 20.155 28.13 27.24 24.474999999999998 80-84 20.275000000000002 28.375 27.095000000000002 24.255 85-89 20.645 27.694999999999997 27.315 24.345 90-94 20.435 28.194999999999997 27.139999999999997 24.23 95-99 20.54 27.985 27.18 24.295 100-104 20.705000000000002 28.73 26.8 23.765 105-109 20.4 28.395 27.034999999999997 24.169999999999998 110-114 20.560000000000002 28.765 26.52 24.154999999999998 115-119 21.135 28.28 26.815 23.77 120-124 20.96 28.055000000000003 26.61 24.375 125-129 21.25 28.060000000000002 27.065 23.625 130-134 21.595 28.715000000000003 25.97 23.72 135-139 21.325 28.134999999999998 26.669999999999998 23.87 140-144 21.58 28.275 26.174999999999997 23.97 145-149 21.790000000000003 28.285 26.405 23.52 150-151 22.786393196598297 27.826413206603302 26.150575287643825 23.23661830915458 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 0.5 25 2.0 26 6.0 27 9.0 28 8.0 29 8.5 30 10.0 31 21.0 32 27.5 33 39.0 34 57.0 35 60.5 36 70.5 37 98.5 38 130.0 39 151.5 40 182.5 41 211.5 42 241.5 43 261.5 44 255.0 45 265.0 46 291.0 47 274.5 48 237.0 49 207.5 50 168.0 51 142.5 52 125.5 53 100.0 54 81.0 55 59.0 56 43.0 57 34.5 58 22.5 59 23.5 60 18.5 61 9.0 62 8.5 63 7.5 64 6.0 65 7.0 66 4.5 67 1.5 68 3.0 69 2.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.6500000000000004 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.3875 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.800000000000001 0.0 0.0 0.0 0.0 128-129 6.2375 0.0 0.0 0.0 0.0 130-131 6.699999999999999 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAATTG 10 0.006830828 145.0 3 >>END_MODULE SRR7170202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75675 33.0 33.0 34.0 32.0 34.0 2 32.804 33.0 33.0 34.0 32.0 34.0 3 32.6165 34.0 33.0 34.0 32.0 34.0 4 32.2365 34.0 33.0 34.0 32.0 34.0 5 32.309 34.0 33.0 34.0 32.0 34.0 6 36.88075 38.0 38.0 38.0 35.0 38.0 7 36.8865 38.0 38.0 38.0 35.0 38.0 8 37.04725 38.0 38.0 38.0 36.0 38.0 9 37.06225 38.0 38.0 38.0 37.0 38.0 10-14 36.98425 38.0 38.0 38.0 36.4 38.0 15-19 36.820499999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.8957 38.0 38.0 38.0 36.0 38.0 25-29 36.9351 38.0 38.0 38.0 36.2 38.0 30-34 36.99225 38.0 38.0 38.0 36.4 38.0 35-39 36.807550000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.64695 38.0 38.0 38.0 35.8 38.0 45-49 36.6178 38.0 38.0 38.0 35.0 38.0 50-54 36.697599999999994 38.0 38.0 38.0 35.4 38.0 55-59 36.659 38.0 38.0 38.0 35.4 38.0 60-64 36.6316 38.0 38.0 38.0 35.0 38.0 65-69 36.620850000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.5802 38.0 38.0 38.0 34.8 38.0 75-79 36.369499999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.350100000000005 38.0 38.0 38.0 34.0 38.0 85-89 35.92685 38.0 38.0 38.0 32.6 38.0 90-94 35.6708 38.0 38.0 38.0 31.4 38.0 95-99 35.963 38.0 37.8 38.0 32.6 38.0 100-104 35.88275 38.0 37.6 38.0 32.6 38.0 105-109 35.6922 38.0 37.0 38.0 31.0 38.0 110-114 35.4307 38.0 37.0 38.0 29.4 38.0 115-119 35.2236 38.0 36.6 38.0 28.6 38.0 120-124 35.016 38.0 36.0 38.0 27.6 38.0 125-129 34.46175000000001 38.0 35.2 38.0 24.4 38.0 130-134 33.22709999999999 38.0 34.8 38.0 16.0 38.0 135-139 31.9848 38.0 34.0 38.0 6.4 38.0 140-144 31.14425 38.0 32.6 38.0 2.0 38.0 145-149 30.3299 38.0 31.0 38.0 2.0 38.0 150-151 26.356749999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 2.0 7 3.0 8 3.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 5.0 15 1.0 16 4.0 17 6.0 18 9.0 19 8.0 20 7.0 21 15.0 22 22.0 23 25.0 24 28.0 25 29.0 26 42.0 27 44.0 28 46.0 29 70.0 30 85.0 31 84.0 32 125.0 33 134.0 34 154.0 35 199.0 36 547.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.78716470293307 17.498119829531213 14.414640260716972 27.300075206818754 2 24.73037371457236 25.382493102583396 32.7062954602458 17.180837722598444 3 21.818181818181817 27.853535353535353 29.545454545454547 20.782828282828284 4 22.951238192494255 34.64386009701302 22.51723257595098 19.887669134541742 5 24.199288256227756 35.99389933909507 21.5556685307575 18.251143873919677 6 19.225 36.7 25.05 19.025 7 18.875 17.7 40.975 22.45 8 22.375 24.099999999999998 25.75 27.775 9 20.925 25.374999999999996 29.475 24.224999999999998 10-14 23.334167709637047 28.105131414267838 26.578222778473094 21.982478097622028 15-19 22.889749132773616 27.27866874465839 28.052888240912978 21.77869388165502 20-24 23.685001502855425 27.0814547640517 27.62749223524697 21.606051497845908 25-29 23.705000000000002 27.889999999999997 27.49 20.915 30-34 23.286164308215408 27.67138356917846 27.626381319065953 21.416070803540176 35-39 23.03874880946413 27.66554714522031 27.976339666148682 21.319364379166874 40-44 23.72549019607843 28.089492207139266 27.350427350427353 20.834590246354953 45-49 23.45319405383688 27.164523905182804 28.239252711932505 21.14302932904781 50-54 24.009603841536613 27.270908363345335 27.866146458583437 20.853341336534616 55-59 23.851696187331132 26.76373461422996 28.630041028720104 20.754528169718803 60-64 23.14235676757568 27.875906930197647 28.081060795596695 20.900675506629973 65-69 23.82429457674605 27.636581949169504 27.55153091855113 20.98759255553332 70-74 23.5 27.765 27.775 20.96 75-79 23.895 26.645000000000003 28.444999999999997 21.015 80-84 23.919999999999998 27.900000000000002 27.6 20.580000000000002 85-89 23.48874760318902 27.348874760318903 28.226864466646482 20.935513169845596 90-94 23.607521159596573 27.469464294764585 27.702599969590995 21.220414576047844 95-99 24.044999999999998 27.750000000000004 27.715 20.49 100-104 23.91 27.465 27.815 20.810000000000002 105-109 24.715 27.779999999999998 27.089999999999996 20.415 110-114 24.495 27.255000000000003 27.62 20.630000000000003 115-119 24.285 27.584999999999997 28.084999999999997 20.044999999999998 120-124 24.616230811540575 27.36136806840342 27.556377818890944 20.46602330116506 125-129 25.03012048192771 27.786144578313255 26.977911646586346 20.20582329317269 130-134 25.117601447402432 27.702248643060223 27.174980615146033 20.005169294391315 135-139 25.142826914938638 27.882987727465085 27.39102835378756 19.58315700380872 140-144 25.62964547350409 27.67766429602695 26.506603924923798 20.18608630554516 145-149 25.577591494581885 28.475771825802493 26.06828869351871 19.878347986096912 150-151 25.411794291462343 27.22243178674714 28.479818936250474 18.88595498554005 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 2.0 26 4.0 27 4.0 28 6.5 29 7.5 30 7.5 31 10.5 32 15.5 33 23.5 34 38.5 35 49.5 36 63.0 37 98.5 38 126.5 39 165.5 40 203.5 41 209.5 42 250.0 43 289.5 44 281.0 45 283.0 46 284.0 47 264.0 48 228.5 49 212.5 50 188.5 51 149.5 52 125.0 53 101.0 54 78.5 55 50.0 56 35.5 57 36.0 58 32.0 59 19.0 60 9.0 61 6.5 62 10.5 63 10.0 64 4.5 65 2.0 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.325 3 1.0 4 2.075 5 1.6500000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.125 15-19 0.545 20-24 0.19 25-29 0.0 30-34 0.005 35-39 0.255 40-44 0.5499999999999999 45-49 0.44 50-54 0.04 55-59 0.06999999999999999 60-64 0.075 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.91 90-94 1.345 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.4 130-134 3.2750000000000004 135-139 5.48 140-144 6.494999999999999 145-149 2.18 150-151 0.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.699999999999999 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.4875 0.0 0.0 0.0 0.0 138-139 7.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACACA 10 0.006822205 145.03798 9 GAGACAC 10 0.0070870784 143.225 8 >>END_MODULE Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969160 spots for SRR7170202.sra Written 969160 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra Read 969144 spots for SRR7170202.sra Written 969144 spots for SRR7170202.sra SRR ids: ['SRR7170202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ba408tw SRR7170202.sra spots: 19382896 blocks: [[1, 969144], [969145, 1938288], [1938289, 2907432], [2907433, 3876576], [3876577, 4845720], [4845721, 5814864], [5814865, 6784008], [6784009, 7753152], [7753153, 8722296], [8722297, 9691440], [9691441, 10660584], [10660585, 11629728], [11629729, 12598872], [12598873, 13568016], [13568017, 14537160], [14537161, 15506304], [15506305, 16475448], [16475449, 17444592], [17444593, 18413736], [18413737, 19382896]] SRR7170202 file size 6546527 SRR7170202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170202 SRR7170202_1.fastq SRR7170202_2.fastq Input file: SRR7170202_1.fastq Paired file: SRR7170202_2.fastq trimmed: SRR7170202-trimmed-pair1.fastq, SRR7170202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:31:42 2025 >> started Wed Feb 12 18:32:13 2025 >> done (30.671s) 19382896 read pairs processed; of these: 28438 ( 0.15%) short read pairs filtered out after trimming by size control 35329 ( 0.18%) empty read pairs filtered out after trimming by size control 19319129 (99.67%) read pairs available; of these: 10450338 (54.09%) trimmed read pairs available after processing 8868791 (45.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 8 0.00% 21 7 0.00% 22 8 0.00% 23 6 0.00% 24 9 0.00% 25 6 0.00% 26 8 0.00% 27 5 0.00% 28 13 0.00% 29 6 0.00% 30 16 0.00% 31 14 0.00% 32 16 0.00% 33 12 0.00% 34 14 0.00% 35 25 0.00% 36 17 0.00% 37 20 0.00% 38 32 0.00% 39 30 0.00% 40 32 0.00% 41 41 0.00% 42 46 0.00% 43 51 0.00% 44 54 0.00% 45 67 0.00% 46 60 0.00% 47 78 0.00% 48 117 0.00% 49 112 0.00% 50 140 0.00% 51 159 0.00% 52 151 0.00% 53 179 0.00% 54 203 0.00% 55 197 0.00% 56 238 0.00% 57 247 0.00% 58 351 0.00% 59 389 0.00% 60 383 0.00% 61 453 0.00% 62 519 0.00% 63 647 0.00% 64 684 0.00% 65 735 0.00% 66 873 0.00% 67 983 0.01% 68 1159 0.01% 69 1581 0.01% 70 1942 0.01% 71 1684 0.01% 72 1708 0.01% 73 1975 0.01% 74 2231 0.01% 75 2446 0.01% 76 2597 0.01% 77 2916 0.02% 78 3264 0.02% 79 3782 0.02% 80 4226 0.02% 81 4701 0.02% 82 5506 0.03% 83 6612 0.03% 84 7845 0.04% 85 8619 0.04% 86 9214 0.05% 87 9604 0.05% 88 10460 0.05% 89 11016 0.06% 90 12066 0.06% 91 13110 0.07% 92 14227 0.07% 93 15893 0.08% 94 17357 0.09% 95 18146 0.09% 96 19220 0.10% 97 19897 0.10% 98 20749 0.11% 99 22293 0.12% 100 23600 0.12% 101 24999 0.13% 102 27090 0.14% 103 29067 0.15% 104 30831 0.16% 105 33062 0.17% 106 33689 0.17% 107 35287 0.18% 108 36489 0.19% 109 36674 0.19% 110 38137 0.20% 111 40450 0.21% 112 43051 0.22% 113 45287 0.23% 114 47752 0.25% 115 50042 0.26% 116 51051 0.26% 117 52681 0.27% 118 53872 0.28% 119 54738 0.28% 120 56353 0.29% 121 58877 0.30% 122 61714 0.32% 123 65317 0.34% 124 68976 0.36% 125 71353 0.37% 126 74659 0.39% 127 76822 0.40% 128 77878 0.40% 129 80836 0.42% 130 83534 0.43% 131 86230 0.45% 132 91335 0.47% 133 96843 0.50% 134 101946 0.53% 135 108215 0.56% 136 114246 0.59% 137 119767 0.62% 138 127469 0.66% 139 136668 0.71% 140 144473 0.75% 141 155671 0.81% 142 169868 0.88% 143 184897 0.96% 144 208681 1.08% 145 241285 1.25% 146 286415 1.48% 147 370954 1.92% 148 537243 2.78% 149 1006768 5.21% 150 4310681 22.31% 151 8868791 45.91% 19319129 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=270.59 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=29.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=240.45 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=25.9 sequence=GAAGAAGAAGAAA SRR7170202 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:32:58 Started mapping on | Feb 12 18:32:58 Finished on | Feb 12 18:34:58 Mapping speed, Million of reads per hour | 579.57 Number of input reads | 19319129 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18112811 Uniquely mapped reads % | 93.76% Average mapped length | 290.77 Number of splices: Total | 17273986 Number of splices: Annotated (sjdb) | 16983517 Number of splices: GT/AG | 17014056 Number of splices: GC/AG | 208558 Number of splices: AT/AC | 13908 Number of splices: Non-canonical | 37464 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360009 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 157838 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867172 867172 867172 N_multimapping 360009 360009 360009 N_noFeature 402288 17928716 487508 N_ambiguous 167149 1016 67538 UnstrandedReadsAssigned:17543374 PositiveStrandReadsAssigned:183079 NegativeStrandReadsAssigned:17557765 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170202-trimmed-pair1.fastq SRR7170202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,319,129 reads, 17,587,207 reads pseudoaligned [quant] estimated average fragment length: 228.144 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7170202.ke.tsv 34699 SRR7170202.se.tsv 87100 total ==> SRR7170202.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.86 292 9.18101 Potri.005G024800.1.v4.1 1035 807.856 51 3.55471 Potri.004G059700.1.v4.1 961 733.909 1 0.076723 Potri.007G009000.2.v4.1 1416 1188.86 0 0 Potri.003G141000.2.v4.1 2943 2715.86 299.157 6.2024 Potri.016G087400.1.v4.1 270 89.386 1980 1247.28 Potri.015G069301.1.v4.1 564 342.703 0 0 Potri.010G195200.1.v4.1 1773 1545.86 8 0.2914 Potri.012G127500.1.v4.1 977 749.876 7456 559.867 ==> SRR7170202.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 965 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170202 completed mapping pipeline successfully