Starting /dee2/code/volunteer_pipeline.sh SRR7170203 current disk space = 3051263971328 free memory = 1461914444 SRR7170203 SRAfilesize 6b8a3910b21c69ae9c038e5385cf3683 SRR7170203.sra SRR7170203.sra file validated SRR7170203 is paired end SRR7170203 is conventional basespace SRR7170203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65425 34.0 33.0 34.0 33.0 34.0 2 33.31725 34.0 33.0 34.0 33.0 34.0 3 33.3735 34.0 33.0 34.0 33.0 34.0 4 33.39625 34.0 34.0 34.0 33.0 34.0 5 33.376 34.0 33.0 34.0 33.0 34.0 6 36.986 38.0 37.0 38.0 36.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.437 38.0 38.0 38.0 37.0 38.0 10-14 37.4093 38.0 38.0 38.0 37.0 38.0 15-19 37.3725 38.0 38.0 38.0 37.0 38.0 20-24 37.339549999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.23524999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.19134999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.09894999999999 38.0 38.0 38.0 36.4 38.0 40-44 36.7686 38.0 38.0 38.0 34.8 38.0 45-49 36.6178 38.0 38.0 38.0 34.0 38.0 50-54 36.4598 38.0 38.0 38.0 34.0 38.0 55-59 36.4267 38.0 37.4 38.0 34.0 38.0 60-64 36.37025 38.0 37.2 38.0 33.8 38.0 65-69 36.268550000000005 38.0 37.0 38.0 33.0 38.0 70-74 36.12465000000001 38.0 37.0 38.0 33.0 38.0 75-79 36.085 38.0 37.0 38.0 32.2 38.0 80-84 35.9623 38.0 37.0 38.0 32.4 38.0 85-89 35.6608 38.0 36.6 38.0 30.2 38.0 90-94 35.583549999999995 38.0 36.0 38.0 29.8 38.0 95-99 35.283699999999996 38.0 36.0 38.0 29.0 38.0 100-104 35.091449999999995 38.0 36.0 38.0 28.2 38.0 105-109 34.81175 38.0 35.2 38.0 27.0 38.0 110-114 34.534000000000006 38.0 35.0 38.0 25.6 38.0 115-119 34.1759 38.0 34.0 38.0 23.0 38.0 120-124 33.8929 38.0 34.0 38.0 21.0 38.0 125-129 33.3654 38.0 34.0 38.0 16.2 38.0 130-134 32.9188 37.6 33.4 38.0 15.0 38.0 135-139 32.34755 37.0 32.6 38.0 14.6 38.0 140-144 31.501350000000002 36.0 31.0 38.0 13.8 38.0 145-149 30.00525 36.0 28.6 38.0 6.4 38.0 150-151 24.343375 32.0 12.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 6.0 15 5.0 16 3.0 17 2.0 18 7.0 19 5.0 20 11.0 21 10.0 22 18.0 23 13.0 24 23.0 25 28.0 26 44.0 27 47.0 28 37.0 29 58.0 30 79.0 31 89.0 32 143.0 33 163.0 34 273.0 35 481.0 36 1056.0 37 1394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.792573623559534 14.263764404609475 10.345710627400768 33.597951344430214 2 19.68976732549412 21.74130597948461 35.92694520890668 22.641981486114584 3 19.025 27.1 26.950000000000003 26.924999999999997 4 22.5 34.075 22.425 21.0 5 20.91273821464393 36.98595787362086 23.8716148445336 18.229689067201605 6 17.375 36.0 25.0 21.625 7 13.275 22.175 44.3 20.25 8 18.775 23.7 28.999999999999996 28.525 9 17.625 22.725 31.624999999999996 28.025 10-14 19.735 29.635 26.384999999999998 24.245 15-19 19.505 28.615000000000002 27.889999999999997 23.990000000000002 20-24 19.994999999999997 28.694999999999997 27.800000000000004 23.51 25-29 19.75 28.89 28.03 23.330000000000002 30-34 20.255000000000003 28.965000000000003 27.515 23.265 35-39 20.015 28.975 27.295 23.715 40-44 19.885 28.725 27.529999999999998 23.86 45-49 20.115 28.439999999999998 27.83 23.615 50-54 20.01 29.044999999999998 27.185 23.76 55-59 20.655 28.904999999999998 26.76 23.68 60-64 20.79 28.535 26.85 23.825 65-69 20.745 28.945 27.27 23.04 70-74 20.565 28.475 27.47 23.49 75-79 20.34 29.01 26.474999999999998 24.175 80-84 20.45 28.24 27.555000000000003 23.755000000000003 85-89 20.974999999999998 28.694999999999997 27.224999999999998 23.105 90-94 20.555 28.599999999999998 27.29 23.555 95-99 20.65 28.315 27.215 23.82 100-104 20.655 28.660000000000004 27.38 23.305 105-109 21.2 28.415000000000003 27.175 23.21 110-114 20.5 28.139999999999997 27.175 24.185000000000002 115-119 21.195 27.839999999999996 27.38 23.585 120-124 21.42 28.050000000000004 26.86 23.669999999999998 125-129 20.695 28.470000000000002 26.965 23.87 130-134 21.16 28.375 27.165 23.3 135-139 20.97 28.125 27.155 23.75 140-144 20.695 28.48 26.865 23.96 145-149 20.73 29.044999999999998 26.314999999999998 23.91 150-151 22.05050885789672 28.25731875863802 26.121372031662272 23.57080035180299 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 2.5 22 1.5 23 1.0 24 1.5 25 2.0 26 4.0 27 6.5 28 8.0 29 14.0 30 23.5 31 29.0 32 31.5 33 44.5 34 52.0 35 72.0 36 91.5 37 101.0 38 125.5 39 143.0 40 195.0 41 242.5 42 261.0 43 268.0 44 266.0 45 259.0 46 249.0 47 251.5 48 238.0 49 192.5 50 156.5 51 143.0 52 128.0 53 100.0 54 74.5 55 56.5 56 38.5 57 32.5 58 24.0 59 18.0 60 16.5 61 11.5 62 5.0 63 3.0 64 3.0 65 3.0 66 1.5 67 0.0 68 0.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.075 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.137499999999999 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.449999999999999 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.199999999999999 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACTG 10 0.0063413354 148.60257 2 >>END_MODULE SRR7170203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.897 33.0 33.0 34.0 32.0 34.0 2 32.96225 34.0 33.0 34.0 32.0 34.0 3 32.6485 34.0 33.0 34.0 32.0 34.0 4 32.42325 34.0 33.0 34.0 32.0 34.0 5 32.6125 34.0 33.0 34.0 32.0 34.0 6 36.69525 38.0 38.0 38.0 36.0 38.0 7 36.85475 38.0 38.0 38.0 37.0 38.0 8 36.77625 38.0 38.0 38.0 36.0 38.0 9 36.77925 38.0 38.0 38.0 37.0 38.0 10-14 36.48864999999999 38.0 38.0 38.0 35.8 38.0 15-19 36.403549999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.47685 38.0 38.0 38.0 36.0 38.0 25-29 36.6391 38.0 38.0 38.0 36.0 38.0 30-34 36.629149999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.3921 38.0 38.0 38.0 36.0 38.0 40-44 36.20635 38.0 38.0 38.0 35.4 38.0 45-49 36.228300000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.427550000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.380050000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.33305 38.0 38.0 38.0 35.2 38.0 65-69 36.436550000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.3339 38.0 38.0 38.0 34.4 38.0 75-79 36.2926 38.0 38.0 38.0 34.0 38.0 80-84 36.14615 38.0 38.0 38.0 34.0 38.0 85-89 35.5771 38.0 38.0 38.0 32.8 38.0 90-94 35.3618 38.0 38.0 38.0 31.0 38.0 95-99 35.7165 38.0 38.0 38.0 31.8 38.0 100-104 35.772099999999995 38.0 38.0 38.0 33.0 38.0 105-109 35.5809 38.0 37.8 38.0 31.4 38.0 110-114 35.407999999999994 38.0 37.0 38.0 31.0 38.0 115-119 35.24830000000001 38.0 36.8 38.0 29.6 38.0 120-124 35.04305 38.0 36.4 38.0 28.8 38.0 125-129 34.1404 38.0 35.4 38.0 22.2 38.0 130-134 32.9682 38.0 34.6 38.0 14.4 38.0 135-139 32.04145 38.0 34.0 38.0 6.4 38.0 140-144 31.3113 38.0 33.0 38.0 2.0 38.0 145-149 30.74525 38.0 31.8 38.0 2.0 38.0 150-151 26.923625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 5.0 4 2.0 5 2.0 6 2.0 7 1.0 8 2.0 9 0.0 10 2.0 11 2.0 12 2.0 13 3.0 14 5.0 15 2.0 16 8.0 17 9.0 18 13.0 19 7.0 20 10.0 21 14.0 22 15.0 23 19.0 24 15.0 25 30.0 26 28.0 27 31.0 28 29.0 29 59.0 30 59.0 31 77.0 32 117.0 33 146.0 34 147.0 35 239.0 36 525.0 37 2330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.075381918357124 17.28024042073629 14.375156523916854 25.269221136989735 2 23.510265398097147 25.062593890836254 34.15122684026039 17.27591387080621 3 21.746835443037973 28.48101265822785 29.974683544303797 19.797468354430382 4 23.98674483813408 35.024216161101194 21.208258985470305 19.780780015294415 5 22.920892494929006 36.637931034482754 22.489858012170387 17.951318458417852 6 19.356473270838613 35.57131998986572 25.183683810488976 19.888522928806687 7 19.102822580645164 16.708669354838708 41.91028225806452 22.278225806451612 8 21.219018715225086 22.281234193222055 28.426909458775924 28.072837632776938 9 21.746790838157565 24.515479486534105 27.73722627737226 26.000503397936072 10-14 22.97675364972786 28.836665140648048 26.415382267663666 21.771198941960428 15-19 23.115757266700662 27.95002549719531 27.358490566037734 21.57572667006629 20-24 23.110907982937235 27.94028031687995 27.066829169205768 21.881982530977044 25-29 23.273204992168157 28.270425951189935 27.60850891819514 20.84786013844677 30-34 23.49105247194419 27.246992215145085 28.252957233848953 21.008998079061772 35-39 23.06438467807661 28.0358598207009 27.56723716381418 21.332518337408313 40-44 23.638037751291627 27.899125274950126 27.628011663000663 20.834825310757584 45-49 22.788231094793737 28.453418999541075 27.821120799551274 20.937229106113918 50-54 23.007594936708863 28.212658227848102 27.98481012658228 20.79493670886076 55-59 23.013060645945124 27.376733826060544 28.13607370659107 21.47413182140326 60-64 23.493029150823826 28.314321926489228 27.792141951837767 20.400506970849175 65-69 23.82032667876588 27.369429320427507 27.873563218390807 20.93668078241581 70-74 23.979745312343326 27.509275042615062 27.499247969517697 21.011731675523915 75-79 23.550017514887656 27.073012060251212 28.22899464544863 21.1479757794125 80-84 23.53887938839151 27.45196660295745 28.362337792978575 20.646816215672466 85-89 23.406548291080775 27.491532382223134 28.30750282253926 20.794416504156832 90-94 23.735268385569448 27.6722762595852 28.578045391384897 20.01440996346045 95-99 23.682622687047466 27.2777554304103 28.394006436041835 20.6456154465004 100-104 24.110097262609045 27.94043918580166 27.629599919783416 20.319863631805877 105-109 24.018545582825176 27.374892909338307 28.312251171697827 20.294310336138686 110-114 24.01634382566586 27.653349475383376 27.708837772397093 20.62146892655367 115-119 24.263527054108216 28.14128256513026 27.47995991983968 20.115230460921843 120-124 24.570713391739673 28.130162703379224 26.588235294117645 20.710888610763455 125-129 25.02416441979956 27.445693646029408 27.588136541689984 19.94200539248105 130-134 24.317240656287677 27.944645384494414 27.577711380196046 20.16040257902186 135-139 24.79935794542536 27.538790797217764 28.057784911717498 19.604066345639378 140-144 24.96486866284726 27.569992433250462 27.288941736028537 20.176197167873745 145-149 25.07150657860523 27.80175776171408 27.07369077955172 20.053044880128972 150-151 24.974358974358974 27.807692307692307 26.80769230769231 20.410256410256412 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.5 6 2.5 7 4.0 8 4.5 9 5.0 10 5.5 11 4.0 12 2.0 13 2.0 14 3.5 15 3.0 16 1.5 17 2.5 18 3.0 19 1.0 20 2.0 21 2.0 22 2.5 23 4.5 24 4.0 25 2.5 26 3.0 27 7.0 28 9.5 29 8.5 30 10.5 31 16.5 32 24.0 33 38.5 34 47.5 35 61.0 36 81.5 37 93.0 38 120.0 39 168.5 40 201.0 41 218.5 42 229.5 43 246.0 44 273.0 45 283.0 46 275.0 47 270.5 48 234.0 49 182.5 50 157.0 51 143.0 52 132.5 53 107.5 54 76.0 55 49.5 56 42.5 57 31.5 58 20.5 59 22.5 60 19.0 61 10.5 62 6.0 63 4.0 64 2.0 65 1.5 66 0.0 67 1.0 68 2.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.15 3 1.25 4 1.925 5 1.4000000000000001 6 1.325 7 0.8 8 1.15 9 0.675 10-14 1.7049999999999998 15-19 1.95 20-24 1.54 25-29 1.045 30-34 1.09 35-39 1.8399999999999999 40-44 2.255 45-49 1.9449999999999998 50-54 1.25 55-59 1.23 60-64 1.375 65-69 0.8200000000000001 70-74 0.27 75-79 0.08499999999999999 80-84 0.59 85-89 2.5700000000000003 90-94 2.8449999999999998 95-99 0.5599999999999999 100-104 0.27 105-109 0.7849999999999999 110-114 0.88 115-119 0.2 120-124 0.125 125-129 1.7149999999999999 130-134 4.614999999999999 135-139 6.550000000000001 140-144 7.489999999999999 145-149 3.855 150-151 2.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.0503651473180559 0.15 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 5.887499999999999 0.0 0.0 0.0 0.0 136-137 6.2 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTTT 25 9.0388383E-4 86.17975 2 >>END_MODULE Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864059 spots for SRR7170203.sra Written 864059 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra Read 864046 spots for SRR7170203.sra Written 864046 spots for SRR7170203.sra SRR ids: ['SRR7170203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pw3mq6s SRR7170203.sra spots: 17280933 blocks: [[1, 864046], [864047, 1728092], [1728093, 2592138], [2592139, 3456184], [3456185, 4320230], [4320231, 5184276], [5184277, 6048322], [6048323, 6912368], [6912369, 7776414], [7776415, 8640460], [8640461, 9504506], [9504507, 10368552], [10368553, 11232598], [11232599, 12096644], [12096645, 12960690], [12960691, 13824736], [13824737, 14688782], [14688783, 15552828], [15552829, 16416874], [16416875, 17280933]] SRR7170203 file size 5834240 SRR7170203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170203 SRR7170203_1.fastq SRR7170203_2.fastq Input file: SRR7170203_1.fastq Paired file: SRR7170203_2.fastq trimmed: SRR7170203-trimmed-pair1.fastq, SRR7170203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:49:16 2025 >> started Wed Feb 12 18:49:36 2025 >> done (20.070s) 17280933 read pairs processed; of these: 31641 ( 0.18%) short read pairs filtered out after trimming by size control 29007 ( 0.17%) empty read pairs filtered out after trimming by size control 17220285 (99.65%) read pairs available; of these: 9719324 (56.44%) trimmed read pairs available after processing 7500961 (43.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 10 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 10 0.00% 29 8 0.00% 30 15 0.00% 31 7 0.00% 32 8 0.00% 33 15 0.00% 34 14 0.00% 35 17 0.00% 36 12 0.00% 37 14 0.00% 38 22 0.00% 39 28 0.00% 40 39 0.00% 41 36 0.00% 42 33 0.00% 43 36 0.00% 44 46 0.00% 45 58 0.00% 46 68 0.00% 47 63 0.00% 48 86 0.00% 49 93 0.00% 50 106 0.00% 51 143 0.00% 52 149 0.00% 53 144 0.00% 54 158 0.00% 55 219 0.00% 56 234 0.00% 57 272 0.00% 58 262 0.00% 59 318 0.00% 60 369 0.00% 61 433 0.00% 62 462 0.00% 63 592 0.00% 64 597 0.00% 65 682 0.00% 66 774 0.00% 67 849 0.00% 68 1023 0.01% 69 1430 0.01% 70 1709 0.01% 71 1746 0.01% 72 1785 0.01% 73 1916 0.01% 74 2107 0.01% 75 2278 0.01% 76 2517 0.01% 77 2810 0.02% 78 3094 0.02% 79 3406 0.02% 80 3860 0.02% 81 4562 0.03% 82 5025 0.03% 83 5760 0.03% 84 7248 0.04% 85 8059 0.05% 86 8288 0.05% 87 8714 0.05% 88 9589 0.06% 89 9812 0.06% 90 10699 0.06% 91 11630 0.07% 92 12561 0.07% 93 13868 0.08% 94 14440 0.08% 95 15145 0.09% 96 16128 0.09% 97 16715 0.10% 98 17601 0.10% 99 18336 0.11% 100 18996 0.11% 101 20259 0.12% 102 21415 0.12% 103 23138 0.13% 104 24432 0.14% 105 25649 0.15% 106 26352 0.15% 107 27176 0.16% 108 27968 0.16% 109 28594 0.17% 110 29904 0.17% 111 31381 0.18% 112 33224 0.19% 113 35104 0.20% 114 36774 0.21% 115 37985 0.22% 116 38717 0.22% 117 40225 0.23% 118 41141 0.24% 119 41822 0.24% 120 43369 0.25% 121 45568 0.26% 122 47167 0.27% 123 50630 0.29% 124 52316 0.30% 125 55034 0.32% 126 57157 0.33% 127 59164 0.34% 128 61386 0.36% 129 63693 0.37% 130 66702 0.39% 131 69451 0.40% 132 74001 0.43% 133 78440 0.46% 134 83272 0.48% 135 88629 0.51% 136 94661 0.55% 137 100893 0.59% 138 109196 0.63% 139 119111 0.69% 140 128135 0.74% 141 138784 0.81% 142 154464 0.90% 143 173621 1.01% 144 199453 1.16% 145 235321 1.37% 146 289182 1.68% 147 384167 2.23% 148 562076 3.26% 149 1072521 6.23% 150 4100109 23.81% 151 7500961 43.56% 17220285 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=247.09 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=27.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=22 prefix-density=0.30 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=227.80 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7170203 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:50:20 Started mapping on | Feb 12 18:50:20 Finished on | Feb 12 18:52:02 Mapping speed, Million of reads per hour | 607.77 Number of input reads | 17220285 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16271516 Uniquely mapped reads % | 94.49% Average mapped length | 291.28 Number of splices: Total | 15351284 Number of splices: Annotated (sjdb) | 15088650 Number of splices: GT/AG | 15122260 Number of splices: GC/AG | 181736 Number of splices: AT/AC | 12554 Number of splices: Non-canonical | 34734 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308974 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 52975 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 662213 662213 662213 N_multimapping 308974 308974 308974 N_noFeature 398923 16105915 471407 N_ambiguous 155812 717 62293 UnstrandedReadsAssigned:15716781 PositiveStrandReadsAssigned:164884 NegativeStrandReadsAssigned:15737816 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170203-trimmed-pair1.fastq SRR7170203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,220,285 reads, 15,669,657 reads pseudoaligned [quant] estimated average fragment length: 236.286 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR7170203.ke.tsv 34699 SRR7170203.se.tsv 87100 total ==> SRR7170203.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.71 289 10.7488 Potri.005G024800.1.v4.1 1035 799.714 35 2.90186 Potri.004G059700.1.v4.1 961 725.802 2 0.182707 Potri.007G009000.2.v4.1 1416 1180.71 0 0 Potri.003G141000.2.v4.1 2943 2707.71 343.129 8.4023 Potri.016G087400.1.v4.1 270 85.2195 1611 1253.43 Potri.015G069301.1.v4.1 564 334.885 0 0 Potri.010G195200.1.v4.1 1773 1537.71 9 0.38807 Potri.012G127500.1.v4.1 977 741.753 6414 573.341 ==> SRR7170203.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1093 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170203 completed mapping pipeline successfully