Starting /dee2/code/volunteer_pipeline.sh SRR7170204 current disk space = 3051103420416 free memory = 1579638252 SRR7170204 SRAfilesize d72e451678abdcd4eca0882f1488b2c8 SRR7170204.sra SRR7170204.sra file validated SRR7170204 is paired end SRR7170204 is conventional basespace SRR7170204 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07975 34.0 33.0 34.0 33.0 34.0 2 33.346 34.0 33.0 34.0 33.0 34.0 3 33.378 34.0 33.0 34.0 33.0 34.0 4 33.3535 34.0 34.0 34.0 33.0 34.0 5 33.3865 34.0 34.0 34.0 33.0 34.0 6 35.4305 38.0 37.0 38.0 29.0 38.0 7 36.93225 38.0 37.0 38.0 35.0 38.0 8 37.2315 38.0 38.0 38.0 37.0 38.0 9 37.239 38.0 38.0 38.0 37.0 38.0 10-14 37.400400000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.4541 38.0 38.0 38.0 37.4 38.0 20-24 37.434400000000004 38.0 38.0 38.0 37.4 38.0 25-29 37.18195 38.0 38.0 38.0 37.0 38.0 30-34 37.42645 38.0 38.0 38.0 37.2 38.0 35-39 37.39865 38.0 38.0 38.0 37.4 38.0 40-44 37.22965000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.205799999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.10349999999999 38.0 38.0 38.0 36.2 38.0 55-59 37.114 38.0 38.0 38.0 36.2 38.0 60-64 36.668850000000006 38.0 37.8 38.0 34.2 38.0 65-69 37.1252 38.0 38.0 38.0 36.0 38.0 70-74 36.9986 38.0 38.0 38.0 36.0 38.0 75-79 36.9602 38.0 38.0 38.0 36.0 38.0 80-84 36.722500000000004 38.0 37.8 38.0 34.6 38.0 85-89 36.57674999999999 38.0 37.8 38.0 34.4 38.0 90-94 36.71495 38.0 38.0 38.0 34.8 38.0 95-99 36.74680000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.58235 38.0 38.0 38.0 34.4 38.0 105-109 36.30649999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.29815 38.0 38.0 38.0 34.0 38.0 115-119 36.34645 38.0 38.0 38.0 34.0 38.0 120-124 36.09689999999999 38.0 37.2 38.0 33.4 38.0 125-129 35.88215 38.0 37.0 38.0 32.8 38.0 130-134 35.67065 38.0 36.4 38.0 31.8 38.0 135-139 35.333000000000006 38.0 36.0 38.0 30.0 38.0 140-144 35.0303 38.0 35.8 38.0 29.4 38.0 145-149 34.603249999999996 38.0 35.6 38.0 28.0 38.0 150-151 31.069000000000003 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 2.0 18 2.0 19 3.0 20 1.0 21 0.0 22 6.0 23 8.0 24 13.0 25 7.0 26 15.0 27 17.0 28 24.0 29 41.0 30 44.0 31 50.0 32 64.0 33 95.0 34 143.0 35 254.0 36 545.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.14977307110439 14.094805849722642 11.24558749369642 33.50983358547655 2 20.875 21.125 35.775 22.225 3 19.425 27.325 27.0 26.25 4 22.05 35.25 22.2 20.5 5 21.125 37.525 23.674999999999997 17.675 6 18.704676169042262 36.509127281820454 25.156289072268066 19.629907476869217 7 14.899999999999999 21.525 42.9 20.674999999999997 8 18.425 22.55 30.525000000000002 28.499999999999996 9 18.25 24.25 30.349999999999998 27.150000000000002 10-14 20.21 29.494999999999997 26.534999999999997 23.76 15-19 19.91 28.849999999999998 27.334999999999997 23.905 20-24 20.005 29.065 27.415 23.515 25-29 20.580000000000002 28.715000000000003 27.800000000000004 22.905 30-34 20.0 28.689999999999998 27.500000000000004 23.810000000000002 35-39 20.330000000000002 28.73 27.584999999999997 23.355 40-44 20.385 28.13 27.715 23.77 45-49 20.53 28.775000000000002 27.250000000000004 23.445 50-54 20.255000000000003 28.32 27.6 23.825 55-59 20.24 28.189999999999998 28.17 23.400000000000002 60-64 20.18 28.175 27.52 24.125 65-69 20.45 28.115000000000002 27.755000000000003 23.68 70-74 20.255000000000003 28.34 27.55 23.855 75-79 21.05 28.255000000000003 26.995 23.7 80-84 20.64 28.685 26.82 23.855 85-89 20.46 28.185 27.445000000000004 23.91 90-94 20.349999999999998 29.044999999999998 27.150000000000002 23.455000000000002 95-99 20.875 28.139999999999997 27.575 23.41 100-104 20.645 28.12 27.235 24.0 105-109 21.025 28.455000000000002 27.015 23.505000000000003 110-114 20.225 28.65 26.884999999999998 24.240000000000002 115-119 20.44 28.470000000000002 27.07 24.02 120-124 20.805 28.12 27.334999999999997 23.74 125-129 20.88104405220261 28.006400320016 27.391369568478424 23.721186059302966 130-134 21.275 28.01 26.905 23.810000000000002 135-139 20.60412082416483 28.245649129825967 27.10542108421684 24.04480896179236 140-144 20.95 27.83 26.735 24.485 145-149 21.295 28.29 26.35 24.065 150-151 21.875 27.85 25.7625 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 1.0 18 1.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.5 26 3.5 27 5.0 28 10.0 29 14.0 30 17.0 31 20.0 32 27.5 33 40.0 34 52.5 35 74.0 36 91.0 37 97.5 38 123.0 39 154.5 40 187.0 41 212.0 42 238.0 43 264.5 44 268.5 45 284.5 46 286.5 47 260.0 48 239.0 49 204.5 50 169.5 51 156.0 52 134.5 53 93.5 54 62.0 55 47.0 56 36.5 57 33.0 58 24.0 59 17.0 60 12.0 61 7.0 62 5.0 63 3.0 64 2.0 65 3.0 66 3.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.02 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.9 0.0 0.0 0.0 0.0 138-139 7.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170204 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82625 33.0 33.0 34.0 32.0 34.0 2 32.932 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 33.046 34.0 33.0 34.0 33.0 34.0 5 32.95725 34.0 33.0 34.0 32.0 34.0 6 37.1265 38.0 38.0 38.0 37.0 38.0 7 37.18125 38.0 38.0 38.0 37.0 38.0 8 37.1985 38.0 38.0 38.0 37.0 38.0 9 37.168 38.0 38.0 38.0 37.0 38.0 10-14 37.09805 38.0 38.0 38.0 37.0 38.0 15-19 37.12905 38.0 38.0 38.0 37.0 38.0 20-24 37.11125 38.0 38.0 38.0 37.0 38.0 25-29 37.085049999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.923649999999995 38.0 38.0 38.0 36.6 38.0 35-39 36.6718 38.0 38.0 38.0 35.8 38.0 40-44 36.7434 38.0 38.0 38.0 35.8 38.0 45-49 36.87265000000001 38.0 38.0 38.0 36.6 38.0 50-54 36.9147 38.0 38.0 38.0 36.8 38.0 55-59 36.87349999999999 38.0 38.0 38.0 36.6 38.0 60-64 36.76525 38.0 38.0 38.0 35.8 38.0 65-69 36.84035 38.0 38.0 38.0 36.0 38.0 70-74 36.612849999999995 38.0 38.0 38.0 35.4 38.0 75-79 36.560449999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.6622 38.0 38.0 38.0 35.6 38.0 85-89 36.658699999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.612049999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.50750000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.41895 38.0 38.0 38.0 34.8 38.0 105-109 36.27145 38.0 38.0 38.0 34.0 38.0 110-114 36.1173 38.0 38.0 38.0 33.8 38.0 115-119 35.9774 38.0 38.0 38.0 33.6 38.0 120-124 35.772450000000006 38.0 38.0 38.0 32.8 38.0 125-129 35.48605 38.0 37.0 38.0 31.2 38.0 130-134 35.342150000000004 38.0 36.8 38.0 31.0 38.0 135-139 35.06935 38.0 36.2 38.0 29.6 38.0 140-144 34.87070000000001 38.0 36.0 38.0 29.2 38.0 145-149 33.994699999999995 38.0 35.2 38.0 23.2 38.0 150-151 30.501125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 5.0 5 3.0 6 3.0 7 2.0 8 0.0 9 2.0 10 3.0 11 0.0 12 0.0 13 0.0 14 4.0 15 3.0 16 3.0 17 4.0 18 4.0 19 10.0 20 8.0 21 11.0 22 5.0 23 9.0 24 10.0 25 18.0 26 16.0 27 29.0 28 23.0 29 39.0 30 35.0 31 53.0 32 68.0 33 78.0 34 122.0 35 186.0 36 475.0 37 2761.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.38534633658414 18.42960740185046 14.028507126781694 26.156539134783696 2 23.830957739434858 25.03125781445361 32.78319579894974 18.35458864716179 3 20.05501375343836 28.632158039509875 29.48237059264816 21.8304576144036 4 23.724999999999998 35.425000000000004 21.55 19.3 5 23.200000000000003 36.775000000000006 20.674999999999997 19.35 6 18.5 36.75 24.675 20.075000000000003 7 19.15 17.724999999999998 41.575 21.55 8 20.05 23.625 26.375 29.95 9 21.15 24.7 28.999999999999996 25.15 10-14 22.145 28.720000000000002 26.729999999999997 22.405 15-19 22.985 26.979999999999997 27.735 22.3 20-24 22.564999999999998 27.79 28.025 21.62 25-29 22.79 27.860000000000003 28.050000000000004 21.3 30-34 23.125 27.665 27.905 21.305 35-39 23.494999999999997 27.72 27.515 21.27 40-44 23.39 27.42 27.82 21.37 45-49 23.22 27.439999999999998 28.265 21.075 50-54 22.235 27.955000000000002 27.85 21.959999999999997 55-59 23.535 27.525 27.894999999999996 21.044999999999998 60-64 23.599999999999998 27.365000000000002 27.845 21.19 65-69 22.564999999999998 27.694999999999997 28.735 21.005 70-74 23.455000000000002 27.450000000000003 27.805000000000003 21.29 75-79 23.44 27.82 28.03 20.71 80-84 23.74 27.68 27.555000000000003 21.025 85-89 24.26 26.939999999999998 27.79 21.01 90-94 23.815 27.495000000000005 28.125 20.565 95-99 23.93 26.815 28.044999999999998 21.21 100-104 24.26 27.544999999999998 27.525 20.669999999999998 105-109 24.151037759439863 27.401850462615652 27.60190047511878 20.845211302825707 110-114 24.25 27.634999999999998 27.735 20.380000000000003 115-119 24.375 27.87 27.115000000000002 20.64 120-124 23.95 28.26 27.284999999999997 20.505000000000003 125-129 24.610000000000003 28.315 26.545 20.53 130-134 24.6749349869974 27.595519103820763 27.615523104620927 20.114022804560914 135-139 24.61992398479696 27.825565113022606 26.960392078415683 20.594118823764752 140-144 24.605 28.185 26.979999999999997 20.23 145-149 24.722416725017503 28.7186155846754 26.61798539561869 19.940982294688407 150-151 25.753973219872357 27.893880615692655 26.429733450131398 19.92241271430359 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 3.5 26 3.0 27 2.0 28 4.0 29 6.5 30 10.0 31 15.0 32 21.0 33 30.5 34 37.0 35 50.5 36 83.5 37 97.5 38 118.5 39 147.0 40 181.0 41 218.0 42 245.0 43 274.5 44 271.5 45 283.5 46 295.0 47 264.0 48 246.0 49 215.5 50 175.5 51 149.0 52 136.0 53 113.0 54 70.5 55 52.5 56 41.5 57 35.0 58 27.0 59 20.0 60 15.0 61 9.5 62 8.5 63 5.0 64 2.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.02 140-144 0.0 145-149 0.03 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.025 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.4875 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.1875 0.0 0.0 0.0 0.0 130-131 5.512499999999999 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.425 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATCC 10 0.006830828 145.0 1 >>END_MODULE Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772097 spots for SRR7170204.sra Written 772097 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra Read 772093 spots for SRR7170204.sra Written 772093 spots for SRR7170204.sra SRR ids: ['SRR7170204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2qikq133 SRR7170204.sra spots: 15441864 blocks: [[1, 772093], [772094, 1544186], [1544187, 2316279], [2316280, 3088372], [3088373, 3860465], [3860466, 4632558], [4632559, 5404651], [5404652, 6176744], [6176745, 6948837], [6948838, 7720930], [7720931, 8493023], [8493024, 9265116], [9265117, 10037209], [10037210, 10809302], [10809303, 11581395], [11581396, 12353488], [12353489, 13125581], [13125582, 13897674], [13897675, 14669767], [14669768, 15441864]] SRR7170204 file size 5211040 SRR7170204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170204 SRR7170204_1.fastq SRR7170204_2.fastq Input file: SRR7170204_1.fastq Paired file: SRR7170204_2.fastq trimmed: SRR7170204-trimmed-pair1.fastq, SRR7170204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:20:57 2025 >> started Wed Feb 12 19:21:18 2025 >> done (21.010s) 15441864 read pairs processed; of these: 19028 ( 0.12%) short read pairs filtered out after trimming by size control 25242 ( 0.16%) empty read pairs filtered out after trimming by size control 15397594 (99.71%) read pairs available; of these: 7380478 (47.93%) trimmed read pairs available after processing 8017116 (52.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 4 0.00% 20 2 0.00% 21 9 0.00% 22 4 0.00% 23 3 0.00% 24 7 0.00% 25 10 0.00% 26 8 0.00% 27 6 0.00% 28 12 0.00% 29 10 0.00% 30 20 0.00% 31 14 0.00% 32 15 0.00% 33 15 0.00% 34 16 0.00% 35 16 0.00% 36 12 0.00% 37 23 0.00% 38 26 0.00% 39 31 0.00% 40 34 0.00% 41 54 0.00% 42 56 0.00% 43 55 0.00% 44 54 0.00% 45 65 0.00% 46 83 0.00% 47 96 0.00% 48 108 0.00% 49 129 0.00% 50 142 0.00% 51 149 0.00% 52 184 0.00% 53 199 0.00% 54 229 0.00% 55 238 0.00% 56 263 0.00% 57 299 0.00% 58 299 0.00% 59 403 0.00% 60 462 0.00% 61 542 0.00% 62 605 0.00% 63 683 0.00% 64 732 0.00% 65 808 0.01% 66 923 0.01% 67 1088 0.01% 68 1249 0.01% 69 1853 0.01% 70 2112 0.01% 71 1916 0.01% 72 2082 0.01% 73 2304 0.01% 74 2416 0.02% 75 2799 0.02% 76 2889 0.02% 77 3179 0.02% 78 3389 0.02% 79 3770 0.02% 80 4290 0.03% 81 4849 0.03% 82 5538 0.04% 83 6315 0.04% 84 7575 0.05% 85 8534 0.06% 86 8851 0.06% 87 9278 0.06% 88 9740 0.06% 89 10055 0.07% 90 10860 0.07% 91 11960 0.08% 92 12854 0.08% 93 13835 0.09% 94 14703 0.10% 95 15470 0.10% 96 15767 0.10% 97 16250 0.11% 98 16440 0.11% 99 16973 0.11% 100 17825 0.12% 101 18813 0.12% 102 20273 0.13% 103 21474 0.14% 104 22401 0.15% 105 23455 0.15% 106 23831 0.15% 107 24332 0.16% 108 24705 0.16% 109 24982 0.16% 110 26086 0.17% 111 27311 0.18% 112 28806 0.19% 113 29651 0.19% 114 31661 0.21% 115 32190 0.21% 116 32560 0.21% 117 33257 0.22% 118 33737 0.22% 119 34208 0.22% 120 34836 0.23% 121 36256 0.24% 122 37682 0.24% 123 39433 0.26% 124 41430 0.27% 125 43069 0.28% 126 44602 0.29% 127 44987 0.29% 128 46307 0.30% 129 47085 0.31% 130 48483 0.31% 131 50008 0.32% 132 52358 0.34% 133 55963 0.36% 134 58881 0.38% 135 62381 0.41% 136 65420 0.42% 137 68096 0.44% 138 72984 0.47% 139 75859 0.49% 140 80127 0.52% 141 87099 0.57% 142 95269 0.62% 143 106855 0.69% 144 123388 0.80% 145 144999 0.94% 146 180954 1.18% 147 237138 1.54% 148 347093 2.25% 149 662744 4.30% 150 3497784 22.72% 151 8017116 52.07% 15397594 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.15 sequence-density-rank=5 fanout-score=87.93 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=37 prefix-density=0.32 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=50.58 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7170204 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:22:52 Started mapping on | Feb 12 19:22:52 Finished on | Feb 12 19:24:14 Mapping speed, Million of reads per hour | 675.99 Number of input reads | 15397594 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14530007 Uniquely mapped reads % | 94.37% Average mapped length | 292.31 Number of splices: Total | 13775495 Number of splices: Annotated (sjdb) | 13557196 Number of splices: GT/AG | 13578827 Number of splices: GC/AG | 158648 Number of splices: AT/AC | 11259 Number of splices: Non-canonical | 26761 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266885 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 253359 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 618284 618284 618284 N_multimapping 266885 266885 266885 N_noFeature 342300 14380693 408344 N_ambiguous 140807 1206 56621 UnstrandedReadsAssigned:14046900 PositiveStrandReadsAssigned:148108 NegativeStrandReadsAssigned:14065042 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170204-trimmed-pair1.fastq SRR7170204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,397,594 reads, 14,104,047 reads pseudoaligned [quant] estimated average fragment length: 241.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7170204.ke.tsv 34699 SRR7170204.se.tsv 87100 total ==> SRR7170204.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.23 219 9.09171 Potri.005G024800.1.v4.1 1035 794.225 20 1.85793 Potri.004G059700.1.v4.1 961 720.33 1 0.102427 Potri.007G009000.2.v4.1 1416 1175.23 0 0 Potri.003G141000.2.v4.1 2943 2702.23 265.027 7.23625 Potri.016G087400.1.v4.1 270 87.087 1035 876.862 Potri.015G069301.1.v4.1 564 331.668 0 0 Potri.010G195200.1.v4.1 1773 1532.23 21 1.01121 Potri.012G127500.1.v4.1 977 736.309 4325 433.381 ==> SRR7170204.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1492 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170204 completed mapping pipeline successfully