Starting /dee2/code/volunteer_pipeline.sh SRR7170205 current disk space = 3051158790144 free memory = 1543025864 SRR7170205 SRAfilesize 66d24d8ff10afcd9fdd3821a775210e9 SRR7170205.sra SRR7170205.sra file validated SRR7170205 is paired end SRR7170205 is conventional basespace SRR7170205 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.169 34.0 33.0 34.0 33.0 34.0 2 33.4585 34.0 34.0 34.0 33.0 34.0 3 33.4635 34.0 34.0 34.0 33.0 34.0 4 33.4875 34.0 34.0 34.0 33.0 34.0 5 33.4875 34.0 34.0 34.0 33.0 34.0 6 36.96975 38.0 37.0 38.0 36.0 38.0 7 37.3 38.0 38.0 38.0 36.0 38.0 8 37.426 38.0 38.0 38.0 37.0 38.0 9 37.51825 38.0 38.0 38.0 37.0 38.0 10-14 37.4841 38.0 38.0 38.0 37.0 38.0 15-19 37.43755 38.0 38.0 38.0 37.0 38.0 20-24 37.46465 38.0 38.0 38.0 37.0 38.0 25-29 37.4195 38.0 38.0 38.0 37.0 38.0 30-34 37.36635 38.0 38.0 38.0 37.0 38.0 35-39 37.26180000000001 38.0 38.0 38.0 36.8 38.0 40-44 36.86995 38.0 38.0 38.0 35.4 38.0 45-49 36.74595 38.0 38.0 38.0 34.8 38.0 50-54 36.64620000000001 38.0 38.0 38.0 34.2 38.0 55-59 36.63335 38.0 38.0 38.0 34.0 38.0 60-64 36.47115 38.0 37.8 38.0 34.0 38.0 65-69 36.461850000000005 38.0 37.8 38.0 34.0 38.0 70-74 36.24435 38.0 37.0 38.0 33.4 38.0 75-79 36.15509999999999 38.0 37.0 38.0 33.2 38.0 80-84 36.0004 38.0 37.0 38.0 32.8 38.0 85-89 35.8463 38.0 37.0 38.0 31.6 38.0 90-94 35.58705 38.0 36.2 38.0 29.8 38.0 95-99 35.3683 38.0 36.0 38.0 29.0 38.0 100-104 35.2483 38.0 36.0 38.0 29.0 38.0 105-109 34.900650000000006 38.0 35.4 38.0 27.6 38.0 110-114 34.56755 38.0 34.6 38.0 25.8 38.0 115-119 34.10210000000001 38.0 34.0 38.0 23.0 38.0 120-124 33.97795000000001 38.0 34.0 38.0 23.0 38.0 125-129 33.4104 38.0 33.8 38.0 19.4 38.0 130-134 32.778999999999996 37.0 33.0 38.0 15.0 38.0 135-139 32.25405 36.4 31.4 38.0 14.8 38.0 140-144 31.377850000000002 35.6 29.8 38.0 13.8 38.0 145-149 30.088549999999998 35.6 28.0 38.0 6.4 38.0 150-151 25.629375 33.0 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 2.0 10 0.0 11 0.0 12 2.0 13 4.0 14 3.0 15 2.0 16 3.0 17 2.0 18 7.0 19 8.0 20 8.0 21 5.0 22 7.0 23 16.0 24 18.0 25 23.0 26 29.0 27 27.0 28 48.0 29 55.0 30 65.0 31 104.0 32 122.0 33 194.0 34 289.0 35 547.0 36 1070.0 37 1337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.42078708375378 13.193743693239151 10.847628657921291 37.53784056508577 2 20.5 20.25 36.225 23.025000000000002 3 21.45 26.025 25.2 27.325 4 23.525 33.825 20.95 21.7 5 22.230557639409852 36.159039759939986 23.43085771442861 18.179544886221557 6 18.325 35.925000000000004 25.724999999999998 20.025000000000002 7 14.099999999999998 22.900000000000002 43.1 19.900000000000002 8 18.975 22.375 28.749999999999996 29.9 9 19.075 23.575 31.15 26.200000000000003 10-14 20.945 29.28 26.090000000000003 23.685000000000002 15-19 20.225 28.435 27.77 23.57 20-24 20.919999999999998 28.4 26.815 23.865 25-29 20.74 29.060000000000002 26.889999999999997 23.31 30-34 20.43 28.89 27.045 23.635 35-39 20.599999999999998 28.71 26.715 23.974999999999998 40-44 20.955 27.834999999999997 27.485 23.724999999999998 45-49 20.495 28.189999999999998 27.42 23.895 50-54 20.07 28.035 27.500000000000004 24.395 55-59 20.724999999999998 27.689999999999998 27.73 23.855 60-64 20.43 28.64 27.045 23.885 65-69 20.630000000000003 28.139999999999997 26.950000000000003 24.279999999999998 70-74 20.57 28.74 27.63 23.06 75-79 19.84 28.37 27.33 24.46 80-84 21.275 28.115000000000002 26.985 23.625 85-89 20.655 28.355000000000004 27.62 23.369999999999997 90-94 21.505 28.144999999999996 26.075 24.275 95-99 21.005 28.305000000000003 27.35 23.34 100-104 21.34 28.21 26.51 23.94 105-109 21.3 28.449999999999996 26.61 23.64 110-114 21.349999999999998 27.685 27.005000000000003 23.96 115-119 21.135 28.87 26.395000000000003 23.599999999999998 120-124 21.335 27.950000000000003 27.224999999999998 23.49 125-129 21.845 27.865000000000002 26.229999999999997 24.060000000000002 130-134 21.895 27.515 26.279999999999998 24.310000000000002 135-139 22.035 28.410000000000004 25.855 23.7 140-144 21.8 27.139999999999997 26.83 24.23 145-149 21.84 27.61 26.36 24.19 150-151 21.742935733933482 29.08227056764191 25.218804701175294 23.95598899724931 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.5 22 1.5 23 0.5 24 1.5 25 5.0 26 6.5 27 6.5 28 8.0 29 11.5 30 14.0 31 22.0 32 29.5 33 39.0 34 55.0 35 66.5 36 79.5 37 94.5 38 124.0 39 150.0 40 173.5 41 218.0 42 244.0 43 253.5 44 265.5 45 254.5 46 236.0 47 238.0 48 237.0 49 210.5 50 167.5 51 145.0 52 130.5 53 112.5 54 92.0 55 62.5 56 42.0 57 32.5 58 28.0 59 26.0 60 24.0 61 17.5 62 13.0 63 8.5 64 8.5 65 11.0 66 7.0 67 3.5 68 5.0 69 4.5 70 2.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.5547150781643975 1.0999999999999999 3 0.15128593040847202 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.35 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.612500000000001 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCAC 10 0.006830828 145.0 145 AACAGTG 10 0.006830828 145.0 6 CTTTGAC 10 0.006830828 145.0 5 >>END_MODULE SRR7170205 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88025 33.0 33.0 34.0 32.0 34.0 2 32.99 34.0 33.0 34.0 32.0 34.0 3 32.87225 34.0 33.0 34.0 32.0 34.0 4 32.57075 34.0 33.0 34.0 32.0 34.0 5 32.785 34.0 33.0 34.0 32.0 34.0 6 37.017 38.0 38.0 38.0 36.0 38.0 7 37.14875 38.0 38.0 38.0 37.0 38.0 8 37.09775 38.0 38.0 38.0 37.0 38.0 9 37.20675 38.0 38.0 38.0 37.0 38.0 10-14 37.010149999999996 38.0 38.0 38.0 36.8 38.0 15-19 36.82955 38.0 38.0 38.0 36.2 38.0 20-24 36.969049999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.07715 38.0 38.0 38.0 37.0 38.0 30-34 37.09325 38.0 38.0 38.0 37.0 38.0 35-39 36.842 38.0 38.0 38.0 36.2 38.0 40-44 36.612700000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.6837 38.0 38.0 38.0 36.0 38.0 50-54 36.89635 38.0 38.0 38.0 36.0 38.0 55-59 36.87815 38.0 38.0 38.0 36.0 38.0 60-64 36.783500000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.783 38.0 38.0 38.0 35.8 38.0 70-74 36.737449999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.63285 38.0 38.0 38.0 35.2 38.0 80-84 36.5557 38.0 38.0 38.0 35.0 38.0 85-89 36.05385 38.0 38.0 38.0 34.0 38.0 90-94 35.736599999999996 38.0 38.0 38.0 33.2 38.0 95-99 36.101350000000004 38.0 38.0 38.0 33.4 38.0 100-104 36.11825 38.0 38.0 38.0 33.8 38.0 105-109 35.9701 38.0 37.8 38.0 33.2 38.0 110-114 35.7585 38.0 37.2 38.0 32.4 38.0 115-119 35.4305 38.0 37.0 38.0 30.6 38.0 120-124 35.36725 38.0 36.4 38.0 30.2 38.0 125-129 34.7284 38.0 35.8 38.0 27.2 38.0 130-134 33.48085 38.0 35.0 38.0 17.8 38.0 135-139 32.29925 38.0 34.0 38.0 11.0 38.0 140-144 31.33435 38.0 32.8 38.0 2.0 38.0 145-149 30.83975 38.0 32.8 38.0 2.0 38.0 150-151 27.06325 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 3.0 12 2.0 13 2.0 14 5.0 15 6.0 16 2.0 17 7.0 18 9.0 19 8.0 20 15.0 21 17.0 22 13.0 23 18.0 24 23.0 25 31.0 26 31.0 27 43.0 28 32.0 29 43.0 30 52.0 31 61.0 32 127.0 33 136.0 34 139.0 35 259.0 36 519.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.592536939644376 16.27848735286752 15.952917605810168 29.17605810167794 2 24.406101525381345 25.381345336334082 33.4333583395849 16.779194798699677 3 22.322775263951737 28.858722976370032 27.77777777777778 21.040723981900452 4 24.601366742596813 33.712984054669704 21.791951404707667 19.893697798025816 5 24.515479486534105 35.66574377045054 21.31890259249937 18.499874150515982 6 20.125 37.0 23.3 19.575 7 18.075 18.5 41.099999999999994 22.325 8 21.675 23.799999999999997 26.650000000000002 27.875 9 22.325 24.525 28.65 24.5 10-14 23.412897402467156 27.941028984053755 26.00040116337378 22.645672450105305 15-19 23.44480764395273 27.21146592909228 27.835051546391753 21.508674880563238 20-24 23.233436904881227 27.618522601984562 27.197554375062644 21.950486118071563 25-29 23.580000000000002 28.249999999999996 26.484999999999996 21.685 30-34 23.815 27.82 27.045 21.32 35-39 23.52704604866278 27.694550573094713 27.63422481399558 21.144178564246932 40-44 22.973519304629068 27.607640994542148 27.824944410753993 21.593895290074794 45-49 23.679307045374426 27.59732084403485 27.426096590622954 21.29727551996777 50-54 23.23742807105329 27.685764323242434 27.535651738804102 21.541155866900176 55-59 23.485 27.544999999999998 27.61 21.36 60-64 23.648006403521936 27.945369953474408 27.29501225674121 21.111611386262442 65-69 23.394564292507134 27.62400520546574 27.278642574703436 21.70278792732369 70-74 23.36 27.125 27.865000000000002 21.65 75-79 23.48 27.63 27.71 21.18 80-84 23.89 27.58 27.595 20.935000000000002 85-89 24.28998126866805 27.347744646382825 27.43380752290791 20.92846656204121 90-94 24.00162791880755 27.1251971307931 28.091773922775605 20.781401027623748 95-99 24.165707710011507 26.9975484064642 27.327763045979886 21.508980837544403 100-104 24.11 28.155 27.045 20.69 105-109 23.815 26.915 27.54 21.73 110-114 24.125 26.950000000000003 27.655 21.27 115-119 24.895 27.474999999999998 26.87 20.76 120-124 24.425 28.03 26.775 20.77 125-129 24.746940625472124 28.010273455204715 26.660623457722714 20.582162461600443 130-134 25.28182852414934 27.531285551763368 26.553935257006927 20.63295066708036 135-139 24.73328403929439 27.886342030210205 26.69272208725045 20.687651843244957 140-144 25.134120171673818 27.065450643776824 27.435622317596565 20.36480686695279 145-149 25.30769230769231 27.81025641025641 26.338461538461537 20.543589743589745 150-151 26.38415941480641 27.821919535880944 25.804010594021943 19.989910455290705 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 0.0 25 1.5 26 4.0 27 5.5 28 5.5 29 6.0 30 6.5 31 10.0 32 17.5 33 22.0 34 38.5 35 61.5 36 66.5 37 84.5 38 120.5 39 150.0 40 178.5 41 208.5 42 236.0 43 266.5 44 293.0 45 298.0 46 288.0 47 258.0 48 231.5 49 209.0 50 188.5 51 168.0 52 120.5 53 87.0 54 78.5 55 61.0 56 50.5 57 41.5 58 28.5 59 24.5 60 15.5 61 10.0 62 9.0 63 9.5 64 7.5 65 5.0 66 7.0 67 5.0 68 2.0 69 2.0 70 3.0 71 2.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.025 3 0.5499999999999999 4 1.225 5 0.675 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.29 15-19 0.575 20-24 0.22999999999999998 25-29 0.0 30-34 0.0 35-39 0.54 40-44 1.06 45-49 0.715 50-54 0.075 55-59 0.0 60-64 0.055 65-69 0.105 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.2349999999999999 90-94 1.7149999999999999 95-99 0.065 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.715 130-134 3.3099999999999996 135-139 5.33 140-144 6.800000000000001 145-149 2.5 150-151 0.8875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.4025157232704402 0.8 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.9625000000000004 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 4.887499999999999 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0125 0.0 128-129 5.9625 0.0 0.0 0.025 0.0 130-131 6.4125 0.0 0.0 0.025 0.0 132-133 6.9875 0.0 0.0 0.025 0.0 134-135 7.5 0.0 0.0 0.025 0.0 136-137 7.975 0.0 0.0 0.025 0.0 138-139 8.399999999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGTA 10 0.0060545653 150.86842 145 >>END_MODULE Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra Read 1007785 spots for SRR7170205.sra Written 1007785 spots for SRR7170205.sra Read 1007776 spots for SRR7170205.sra Written 1007776 spots for SRR7170205.sra SRR ids: ['SRR7170205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xeil_ysw SRR7170205.sra spots: 20155529 blocks: [[1, 1007776], [1007777, 2015552], [2015553, 3023328], [3023329, 4031104], [4031105, 5038880], [5038881, 6046656], [6046657, 7054432], [7054433, 8062208], [8062209, 9069984], [9069985, 10077760], [10077761, 11085536], [11085537, 12093312], [12093313, 13101088], [13101089, 14108864], [14108865, 15116640], [15116641, 16124416], [16124417, 17132192], [17132193, 18139968], [18139969, 19147744], [19147745, 20155529]] SRR7170205 file size 6808347 SRR7170205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170205 SRR7170205_1.fastq SRR7170205_2.fastq Input file: SRR7170205_1.fastq Paired file: SRR7170205_2.fastq trimmed: SRR7170205-trimmed-pair1.fastq, SRR7170205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:48:33 2025 >> started Wed Feb 12 18:48:56 2025 >> done (22.614s) 20155529 read pairs processed; of these: 24785 ( 0.12%) short read pairs filtered out after trimming by size control 28838 ( 0.14%) empty read pairs filtered out after trimming by size control 20101906 (99.73%) read pairs available; of these: 12537089 (62.37%) trimmed read pairs available after processing 7564817 (37.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 10 0.00% 23 5 0.00% 24 6 0.00% 25 3 0.00% 26 10 0.00% 27 10 0.00% 28 11 0.00% 29 12 0.00% 30 10 0.00% 31 10 0.00% 32 16 0.00% 33 12 0.00% 34 15 0.00% 35 18 0.00% 36 16 0.00% 37 18 0.00% 38 27 0.00% 39 27 0.00% 40 46 0.00% 41 49 0.00% 42 72 0.00% 43 48 0.00% 44 77 0.00% 45 87 0.00% 46 83 0.00% 47 101 0.00% 48 110 0.00% 49 119 0.00% 50 128 0.00% 51 162 0.00% 52 167 0.00% 53 200 0.00% 54 210 0.00% 55 232 0.00% 56 269 0.00% 57 307 0.00% 58 336 0.00% 59 405 0.00% 60 472 0.00% 61 522 0.00% 62 643 0.00% 63 674 0.00% 64 720 0.00% 65 824 0.00% 66 934 0.00% 67 1159 0.01% 68 1266 0.01% 69 1601 0.01% 70 1867 0.01% 71 1905 0.01% 72 2133 0.01% 73 2355 0.01% 74 2668 0.01% 75 2908 0.01% 76 3169 0.02% 77 3570 0.02% 78 4076 0.02% 79 4530 0.02% 80 5078 0.03% 81 5720 0.03% 82 6642 0.03% 83 7370 0.04% 84 8967 0.04% 85 10132 0.05% 86 10704 0.05% 87 11287 0.06% 88 12207 0.06% 89 13142 0.07% 90 14356 0.07% 91 15415 0.08% 92 16763 0.08% 93 18541 0.09% 94 19733 0.10% 95 21181 0.11% 96 22090 0.11% 97 22904 0.11% 98 23883 0.12% 99 25062 0.12% 100 27073 0.13% 101 28355 0.14% 102 30551 0.15% 103 32494 0.16% 104 34379 0.17% 105 36419 0.18% 106 37262 0.19% 107 38364 0.19% 108 40058 0.20% 109 41225 0.21% 110 42537 0.21% 111 44585 0.22% 112 47659 0.24% 113 49716 0.25% 114 52603 0.26% 115 54746 0.27% 116 56265 0.28% 117 57324 0.29% 118 58682 0.29% 119 60568 0.30% 120 62503 0.31% 121 65329 0.32% 122 67746 0.34% 123 71696 0.36% 124 75381 0.37% 125 78249 0.39% 126 81528 0.41% 127 84290 0.42% 128 86698 0.43% 129 89938 0.45% 130 93555 0.47% 131 96961 0.48% 132 102459 0.51% 133 109368 0.54% 134 116315 0.58% 135 123965 0.62% 136 130875 0.65% 137 138912 0.69% 138 150973 0.75% 139 161546 0.80% 140 175157 0.87% 141 191311 0.95% 142 214422 1.07% 143 242187 1.20% 144 273322 1.36% 145 324758 1.62% 146 402529 2.00% 147 538014 2.68% 148 792946 3.94% 149 1410736 7.02% 150 4779921 23.78% 151 7564817 37.63% 20101906 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=43 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=116.43 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.3 sequence=CATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCATCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGAC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=48.50 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.9 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTC SRR7170205 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:49:42 Started mapping on | Feb 12 18:49:42 Finished on | Feb 12 18:52:04 Mapping speed, Million of reads per hour | 509.63 Number of input reads | 20101906 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18254776 Uniquely mapped reads % | 90.81% Average mapped length | 289.74 Number of splices: Total | 16534546 Number of splices: Annotated (sjdb) | 16259287 Number of splices: GT/AG | 16297892 Number of splices: GC/AG | 188230 Number of splices: AT/AC | 13956 Number of splices: Non-canonical | 34468 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367075 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 530709 % of reads mapped to too many loci | 2.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1499754 1499754 1499754 N_multimapping 367075 367075 367075 N_noFeature 373646 18053927 451823 N_ambiguous 191680 1441 68076 UnstrandedReadsAssigned:17689450 PositiveStrandReadsAssigned:199408 NegativeStrandReadsAssigned:17734877 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170205-trimmed-pair1.fastq SRR7170205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,101,906 reads, 18,048,232 reads pseudoaligned [quant] estimated average fragment length: 227.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR7170205.ke.tsv 34699 SRR7170205.se.tsv 87100 total ==> SRR7170205.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.21 289 8.68058 Potri.005G024800.1.v4.1 1035 808.212 63 4.19385 Potri.004G059700.1.v4.1 961 734.281 4 0.293086 Potri.007G009000.2.v4.1 1416 1189.21 0 0 Potri.003G141000.2.v4.1 2943 2716.21 366 7.24962 Potri.016G087400.1.v4.1 270 89.6521 1804 1082.61 Potri.015G069301.1.v4.1 564 342.657 0 0 Potri.010G195200.1.v4.1 1773 1546.21 67 2.33133 Potri.012G127500.1.v4.1 977 750.238 5898 422.965 ==> SRR7170205.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1681 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170205 completed mapping pipeline successfully