Starting /dee2/code/volunteer_pipeline.sh SRR7170206 current disk space = 3051176648704 free memory = 991240576 SRR7170206 SRAfilesize 944526fd5eb877aad1fae1f312e74249 SRR7170206.sra SRR7170206.sra file validated SRR7170206 is paired end SRR7170206 is conventional basespace SRR7170206 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09525 34.0 33.0 34.0 33.0 34.0 2 33.42525 34.0 33.0 34.0 33.0 34.0 3 33.47825 34.0 34.0 34.0 33.0 34.0 4 33.4935 34.0 34.0 34.0 33.0 34.0 5 33.36825 34.0 34.0 34.0 33.0 34.0 6 37.152 38.0 37.0 38.0 36.0 38.0 7 35.305 38.0 37.0 38.0 28.0 38.0 8 36.9715 38.0 38.0 38.0 35.0 38.0 9 37.376 38.0 38.0 38.0 37.0 38.0 10-14 37.00984999999999 38.0 37.8 38.0 35.4 38.0 15-19 37.421549999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.5498 38.0 38.0 38.0 38.0 38.0 25-29 37.4946 38.0 38.0 38.0 37.8 38.0 30-34 37.50715 38.0 38.0 38.0 38.0 38.0 35-39 37.41415 38.0 38.0 38.0 37.0 38.0 40-44 37.2856 38.0 38.0 38.0 37.0 38.0 45-49 36.191050000000004 38.0 37.4 38.0 32.0 38.0 50-54 36.7822 38.0 37.8 38.0 34.8 38.0 55-59 36.995799999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.03505 38.0 38.0 38.0 36.0 38.0 65-69 37.02235 38.0 38.0 38.0 36.0 38.0 70-74 35.945499999999996 38.0 36.8 38.0 31.0 38.0 75-79 36.81205 38.0 38.0 38.0 35.2 38.0 80-84 36.79655 38.0 38.0 38.0 35.0 38.0 85-89 36.5772 38.0 38.0 38.0 34.4 38.0 90-94 36.5363 38.0 38.0 38.0 34.4 38.0 95-99 36.5518 38.0 38.0 38.0 34.4 38.0 100-104 36.53605 38.0 38.0 38.0 34.4 38.0 105-109 36.264300000000006 38.0 37.4 38.0 33.6 38.0 110-114 36.098949999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.8476 38.0 36.8 38.0 31.8 38.0 120-124 35.87235 38.0 37.0 38.0 32.6 38.0 125-129 35.61645 38.0 36.0 38.0 31.0 38.0 130-134 35.43495 38.0 36.0 38.0 30.6 38.0 135-139 35.19525 38.0 36.0 38.0 30.0 38.0 140-144 34.626599999999996 38.0 35.2 38.0 27.2 38.0 145-149 34.31420000000001 38.0 35.0 38.0 26.2 38.0 150-151 30.530125 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 1.0 14 1.0 15 3.0 16 0.0 17 1.0 18 4.0 19 3.0 20 2.0 21 4.0 22 4.0 23 2.0 24 5.0 25 16.0 26 21.0 27 18.0 28 26.0 29 35.0 30 35.0 31 72.0 32 73.0 33 92.0 34 182.0 35 287.0 36 737.0 37 2371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.642062689585444 14.711830131445906 14.231547017189081 35.414560161779576 2 22.325 20.95 33.925 22.8 3 19.725 28.549999999999997 24.725 27.0 4 20.825 36.425000000000004 21.975 20.775 5 21.226533166458072 35.19399249061327 22.678347934918648 20.90112640801001 6 18.275 35.949999999999996 25.324999999999996 20.45 7 13.825000000000001 23.05 43.375 19.75 8 18.4 23.35 28.675 29.575000000000003 9 17.575 24.5 31.55 26.375 10-14 19.830000000000002 29.580000000000002 26.46 24.13 15-19 19.34 28.73 28.33 23.599999999999998 20-24 19.900000000000002 29.020000000000003 27.224999999999998 23.855 25-29 20.02 28.68 27.735 23.565 30-34 20.215 28.87 27.11 23.805 35-39 20.31 29.185 26.99 23.515 40-44 19.62 28.515 27.700000000000003 24.165 45-49 19.895 29.294999999999998 26.91 23.9 50-54 19.97 29.080000000000002 27.0 23.95 55-59 20.505000000000003 28.51 27.07 23.915 60-64 20.345 29.13 26.900000000000002 23.625 65-69 20.485 29.01 26.52 23.985 70-74 20.34 29.26 26.595000000000002 23.805 75-79 20.064999999999998 29.285 27.1 23.549999999999997 80-84 20.294999999999998 28.63 27.57 23.505000000000003 85-89 20.54 28.15 26.950000000000003 24.36 90-94 20.76 28.365000000000002 26.83 24.044999999999998 95-99 19.545 28.349999999999998 27.250000000000004 24.855 100-104 21.115000000000002 28.075 27.04 23.77 105-109 20.825 27.894999999999996 27.065 24.215 110-114 20.76 28.225 26.965 24.05 115-119 20.65 29.025000000000002 25.945 24.38 120-124 20.82 28.28 26.935 23.965 125-129 20.974999999999998 27.944999999999997 26.729999999999997 24.349999999999998 130-134 20.815 27.955000000000002 26.924999999999997 24.305 135-139 20.97 28.37 26.91 23.75 140-144 21.12 27.944999999999997 26.395000000000003 24.54 145-149 20.745 28.455000000000002 26.57 24.23 150-151 21.393719504566498 28.5124483923433 25.372200675591145 24.721631427499062 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 3.5 25 4.5 26 6.0 27 10.0 28 12.0 29 12.0 30 21.5 31 34.5 32 36.5 33 36.5 34 46.5 35 69.0 36 90.0 37 102.0 38 127.5 39 160.5 40 185.5 41 200.5 42 235.5 43 259.0 44 244.5 45 260.0 46 264.0 47 259.5 48 237.0 49 209.0 50 186.0 51 149.0 52 130.5 53 106.5 54 84.5 55 62.5 56 41.0 57 28.0 58 19.5 59 15.0 60 10.0 61 7.5 62 8.0 63 6.0 64 4.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.5999999999999996 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.3 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.9875 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCAT 10 0.006577216 146.82278 1 GATAATG 10 0.006832588 144.9875 7 GGATAAT 10 0.006832588 144.9875 6 >>END_MODULE SRR7170206 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.895 33.0 33.0 34.0 32.0 34.0 2 33.0655 34.0 33.0 34.0 32.0 34.0 3 32.96825 34.0 33.0 34.0 32.0 34.0 4 32.88125 34.0 33.0 34.0 32.0 34.0 5 32.92625 34.0 33.0 34.0 32.0 34.0 6 37.01425 38.0 38.0 38.0 37.0 38.0 7 37.1395 38.0 38.0 38.0 37.0 38.0 8 36.9605 38.0 38.0 38.0 37.0 38.0 9 37.02175 38.0 38.0 38.0 37.0 38.0 10-14 36.921350000000004 38.0 38.0 38.0 36.6 38.0 15-19 36.94855 38.0 38.0 38.0 36.8 38.0 20-24 36.8452 38.0 38.0 38.0 36.4 38.0 25-29 36.84085 38.0 38.0 38.0 36.6 38.0 30-34 36.8298 38.0 38.0 38.0 36.2 38.0 35-39 36.8019 38.0 38.0 38.0 36.2 38.0 40-44 36.765750000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.7913 38.0 38.0 38.0 36.4 38.0 50-54 36.80305 38.0 38.0 38.0 36.4 38.0 55-59 36.749100000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.773900000000005 38.0 38.0 38.0 36.2 38.0 65-69 36.72435 38.0 38.0 38.0 36.0 38.0 70-74 36.556799999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.21155 38.0 38.0 38.0 34.0 38.0 80-84 36.5132 38.0 38.0 38.0 35.2 38.0 85-89 36.478750000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.35885 38.0 38.0 38.0 34.6 38.0 95-99 36.3366 38.0 38.0 38.0 34.2 38.0 100-104 36.24515 38.0 38.0 38.0 34.2 38.0 105-109 36.13 38.0 38.0 38.0 34.0 38.0 110-114 35.9657 38.0 38.0 38.0 33.8 38.0 115-119 35.79005 38.0 38.0 38.0 33.0 38.0 120-124 35.656800000000004 38.0 37.8 38.0 32.2 38.0 125-129 35.451049999999995 38.0 37.0 38.0 31.0 38.0 130-134 35.00055 38.0 36.4 38.0 29.2 38.0 135-139 34.6675 38.0 35.6 38.0 27.2 38.0 140-144 34.53815 38.0 35.8 38.0 27.4 38.0 145-149 34.021699999999996 38.0 35.0 38.0 24.4 38.0 150-151 29.883875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 6.0 4 1.0 5 1.0 6 4.0 7 1.0 8 2.0 9 2.0 10 2.0 11 2.0 12 2.0 13 2.0 14 10.0 15 1.0 16 5.0 17 5.0 18 8.0 19 7.0 20 4.0 21 5.0 22 9.0 23 15.0 24 8.0 25 9.0 26 24.0 27 23.0 28 27.0 29 30.0 30 51.0 31 49.0 32 48.0 33 91.0 34 122.0 35 208.0 36 485.0 37 2716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.275 18.425 17.175 28.125 2 24.95 24.9 32.15 18.0 3 21.025 29.175 30.8 19.0 4 24.075 33.7 22.5 19.725 5 23.325000000000003 35.15 23.05 18.475 6 20.275000000000002 34.9 25.05 19.775000000000002 7 17.95 17.599999999999998 41.075 23.375 8 22.25 23.65 27.025 27.075 9 22.525000000000002 24.65 28.825 24.0 10-14 23.255 27.85 26.405 22.49 15-19 23.47 27.845 27.365000000000002 21.32 20-24 23.385 27.855 27.339999999999996 21.42 25-29 22.955000000000002 28.02 28.060000000000002 20.965 30-34 23.405 27.345000000000002 27.500000000000004 21.75 35-39 22.89 28.23 27.275 21.605 40-44 23.289657931586316 27.620524104820966 27.740548109621926 21.349269853970796 45-49 23.31 28.285 27.255000000000003 21.15 50-54 23.125 27.48 28.005000000000003 21.39 55-59 23.28 27.975 27.615000000000002 21.13 60-64 23.849999999999998 27.834999999999997 27.389999999999997 20.925 65-69 23.294999999999998 26.77 27.805000000000003 22.13 70-74 23.965 26.950000000000003 28.265 20.82 75-79 24.165 27.215 27.834999999999997 20.785 80-84 23.025000000000002 27.37 28.17 21.435000000000002 85-89 23.880000000000003 27.24 27.939999999999998 20.94 90-94 23.825 27.43 28.17 20.575 95-99 23.875 27.97 27.725 20.43 100-104 24.0 26.82 28.78 20.4 105-109 24.14 27.675 27.67 20.515 110-114 24.04 27.52 27.310000000000002 21.13 115-119 24.015 27.894999999999996 27.295 20.794999999999998 120-124 24.610000000000003 27.295 27.6 20.495 125-129 24.72 27.35 27.46 20.47 130-134 24.055 27.815 27.71 20.419999999999998 135-139 24.7 28.244999999999997 26.834999999999997 20.22 140-144 24.66 27.61 27.71 20.02 145-149 25.155 27.47 27.365000000000002 20.01 150-151 25.131545978451513 27.023302430468554 27.574542721122526 20.270608869957403 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.0 23 0.0 24 0.5 25 1.5 26 3.0 27 3.5 28 3.5 29 4.0 30 5.5 31 7.5 32 15.5 33 21.0 34 31.5 35 45.5 36 71.0 37 105.5 38 139.5 39 174.5 40 184.0 41 201.5 42 237.0 43 270.5 44 274.5 45 269.5 46 275.0 47 265.0 48 249.0 49 225.0 50 191.5 51 164.0 52 140.5 53 107.0 54 77.0 55 55.5 56 45.0 57 36.5 58 25.0 59 17.0 60 12.5 61 9.5 62 8.0 63 7.5 64 3.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.675000000000001 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924113 spots for SRR7170206.sra Written 924113 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra Read 924107 spots for SRR7170206.sra Written 924107 spots for SRR7170206.sra SRR ids: ['SRR7170206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_obfpj2z7 SRR7170206.sra spots: 18482146 blocks: [[1, 924107], [924108, 1848214], [1848215, 2772321], [2772322, 3696428], [3696429, 4620535], [4620536, 5544642], [5544643, 6468749], [6468750, 7392856], [7392857, 8316963], [8316964, 9241070], [9241071, 10165177], [10165178, 11089284], [11089285, 12013391], [12013392, 12937498], [12937499, 13861605], [13861606, 14785712], [14785713, 15709819], [15709820, 16633926], [16633927, 17558033], [17558034, 18482146]] SRR7170206 file size 6241292 SRR7170206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170206 SRR7170206_1.fastq SRR7170206_2.fastq Input file: SRR7170206_1.fastq Paired file: SRR7170206_2.fastq trimmed: SRR7170206-trimmed-pair1.fastq, SRR7170206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:42:42 2025 >> started Wed Feb 12 18:43:07 2025 >> done (24.538s) 18482146 read pairs processed; of these: 32140 ( 0.17%) short read pairs filtered out after trimming by size control 36860 ( 0.20%) empty read pairs filtered out after trimming by size control 18413146 (99.63%) read pairs available; of these: 8181235 (44.43%) trimmed read pairs available after processing 10231911 (55.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 6 0.00% 22 9 0.00% 23 9 0.00% 24 6 0.00% 25 4 0.00% 26 5 0.00% 27 13 0.00% 28 9 0.00% 29 8 0.00% 30 11 0.00% 31 8 0.00% 32 9 0.00% 33 11 0.00% 34 19 0.00% 35 24 0.00% 36 25 0.00% 37 19 0.00% 38 19 0.00% 39 16 0.00% 40 27 0.00% 41 29 0.00% 42 33 0.00% 43 32 0.00% 44 38 0.00% 45 57 0.00% 46 48 0.00% 47 53 0.00% 48 59 0.00% 49 90 0.00% 50 83 0.00% 51 95 0.00% 52 87 0.00% 53 119 0.00% 54 114 0.00% 55 142 0.00% 56 134 0.00% 57 180 0.00% 58 203 0.00% 59 231 0.00% 60 263 0.00% 61 339 0.00% 62 300 0.00% 63 377 0.00% 64 440 0.00% 65 533 0.00% 66 603 0.00% 67 857 0.00% 68 992 0.01% 69 1559 0.01% 70 1936 0.01% 71 1461 0.01% 72 1356 0.01% 73 1492 0.01% 74 1546 0.01% 75 1802 0.01% 76 1830 0.01% 77 2065 0.01% 78 2316 0.01% 79 2518 0.01% 80 2800 0.02% 81 3409 0.02% 82 3815 0.02% 83 4393 0.02% 84 6257 0.03% 85 7189 0.04% 86 7603 0.04% 87 7868 0.04% 88 8163 0.04% 89 8656 0.05% 90 9308 0.05% 91 9688 0.05% 92 10559 0.06% 93 11595 0.06% 94 12033 0.07% 95 12824 0.07% 96 13516 0.07% 97 14034 0.08% 98 14323 0.08% 99 14955 0.08% 100 16191 0.09% 101 16938 0.09% 102 18690 0.10% 103 19398 0.11% 104 20720 0.11% 105 21755 0.12% 106 22146 0.12% 107 22850 0.12% 108 23250 0.13% 109 24187 0.13% 110 25491 0.14% 111 26402 0.14% 112 28022 0.15% 113 30120 0.16% 114 30977 0.17% 115 32614 0.18% 116 32758 0.18% 117 34028 0.18% 118 34447 0.19% 119 35239 0.19% 120 36331 0.20% 121 38034 0.21% 122 39789 0.22% 123 41792 0.23% 124 44353 0.24% 125 46590 0.25% 126 47924 0.26% 127 48979 0.27% 128 49634 0.27% 129 51561 0.28% 130 53606 0.29% 131 54936 0.30% 132 58255 0.32% 133 61650 0.33% 134 65580 0.36% 135 69057 0.38% 136 73970 0.40% 137 77361 0.42% 138 80858 0.44% 139 85317 0.46% 140 89543 0.49% 141 97144 0.53% 142 106999 0.58% 143 120374 0.65% 144 139153 0.76% 145 164388 0.89% 146 200988 1.09% 147 264385 1.44% 148 390978 2.12% 149 733834 3.99% 150 4021983 21.84% 151 10231911 55.57% 18413146 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=242.22 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=260.73 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170206 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:43:57 Started mapping on | Feb 12 18:43:57 Finished on | Feb 12 18:45:53 Mapping speed, Million of reads per hour | 571.44 Number of input reads | 18413146 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17408271 Uniquely mapped reads % | 94.54% Average mapped length | 293.82 Number of splices: Total | 15895337 Number of splices: Annotated (sjdb) | 15632213 Number of splices: GT/AG | 15669743 Number of splices: GC/AG | 178597 Number of splices: AT/AC | 13541 Number of splices: Non-canonical | 33456 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303868 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 23942 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 729792 729792 729792 N_multimapping 303868 303868 303868 N_noFeature 350099 17210190 425204 N_ambiguous 188910 976 65262 UnstrandedReadsAssigned:16869262 PositiveStrandReadsAssigned:197105 NegativeStrandReadsAssigned:16917805 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170206-trimmed-pair1.fastq SRR7170206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,413,146 reads, 16,821,483 reads pseudoaligned [quant] estimated average fragment length: 240.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7170206.ke.tsv 34699 SRR7170206.se.tsv 87100 total ==> SRR7170206.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.35 263 8.15177 Potri.005G024800.1.v4.1 1035 795.353 32 2.21771 Potri.004G059700.1.v4.1 961 721.39 2 0.152818 Potri.007G009000.2.v4.1 1416 1176.35 0 0 Potri.003G141000.2.v4.1 2943 2703.35 312 6.3616 Potri.016G087400.1.v4.1 270 81.7484 2147 1447.66 Potri.015G069301.1.v4.1 564 329.469 0 0 Potri.010G195200.1.v4.1 1773 1533.35 36 1.29412 Potri.012G127500.1.v4.1 977 737.375 5187 387.742 ==> SRR7170206.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1987 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170206 completed mapping pipeline successfully