Starting /dee2/code/volunteer_pipeline.sh SRR7170207 current disk space = 3051080724480 free memory = 1539820924 SRR7170207 SRAfilesize 437880ab9384c23f773671259376bb57 SRR7170207.sra SRR7170207.sra file validated SRR7170207 is paired end SRR7170207 is conventional basespace SRR7170207 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2995 34.0 33.0 34.0 33.0 34.0 2 33.40475 34.0 33.0 34.0 33.0 34.0 3 33.44525 34.0 34.0 34.0 33.0 34.0 4 33.46625 34.0 34.0 34.0 33.0 34.0 5 33.46675 34.0 34.0 34.0 33.0 34.0 6 37.045 38.0 37.0 38.0 36.0 38.0 7 37.3775 38.0 38.0 38.0 37.0 38.0 8 37.38775 38.0 38.0 38.0 37.0 38.0 9 37.426 38.0 38.0 38.0 37.0 38.0 10-14 37.42585 38.0 38.0 38.0 37.0 38.0 15-19 37.35385 38.0 38.0 38.0 37.0 38.0 20-24 37.3213 38.0 38.0 38.0 37.0 38.0 25-29 37.291199999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.221500000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.13205 38.0 38.0 38.0 36.4 38.0 40-44 36.77365 38.0 38.0 38.0 34.8 38.0 45-49 36.55265 38.0 38.0 38.0 34.0 38.0 50-54 36.5079 38.0 38.0 38.0 34.0 38.0 55-59 36.4262 38.0 37.8 38.0 33.8 38.0 60-64 36.291700000000006 38.0 37.2 38.0 33.4 38.0 65-69 36.2356 38.0 37.0 38.0 33.4 38.0 70-74 36.156549999999996 38.0 37.0 38.0 33.2 38.0 75-79 36.01415 38.0 37.0 38.0 33.0 38.0 80-84 35.83505 38.0 37.0 38.0 31.4 38.0 85-89 35.6546 38.0 36.4 38.0 30.6 38.0 90-94 35.50605 38.0 36.0 38.0 29.8 38.0 95-99 35.3356 38.0 36.0 38.0 29.0 38.0 100-104 35.153650000000006 38.0 36.0 38.0 29.0 38.0 105-109 34.89685 38.0 35.4 38.0 27.6 38.0 110-114 34.62905 38.0 35.0 38.0 26.4 38.0 115-119 34.023900000000005 38.0 34.0 38.0 23.0 38.0 120-124 33.7461 38.0 34.0 38.0 22.2 38.0 125-129 33.264050000000005 38.0 33.8 38.0 16.2 38.0 130-134 33.00365000000001 37.6 33.2 38.0 16.2 38.0 135-139 32.219049999999996 36.6 31.6 38.0 14.6 38.0 140-144 31.539350000000002 36.0 31.0 38.0 14.0 38.0 145-149 30.4618 36.0 29.8 38.0 6.6 38.0 150-151 25.98925 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 2.0 12 2.0 13 3.0 14 2.0 15 4.0 16 5.0 17 7.0 18 6.0 19 7.0 20 10.0 21 8.0 22 9.0 23 25.0 24 18.0 25 24.0 26 15.0 27 32.0 28 56.0 29 53.0 30 85.0 31 94.0 32 138.0 33 189.0 34 262.0 35 503.0 36 1055.0 37 1381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.33802109492717 14.79156202913109 8.613761928679056 29.256654947262682 2 21.525 18.625 38.074999999999996 21.775 3 20.175 25.75 26.85 27.224999999999998 4 22.3 35.025 22.825 19.85 5 20.9 36.05 23.9 19.15 6 16.85 35.75 26.6 20.8 7 13.55 23.3 43.8 19.35 8 17.4 23.075000000000003 31.0 28.525 9 18.075 22.900000000000002 31.7 27.325 10-14 19.935 30.45 26.39 23.225 15-19 19.77 29.34 27.589999999999996 23.3 20-24 20.375 28.725 27.284999999999997 23.615 25-29 20.43 29.080000000000002 27.279999999999998 23.21 30-34 20.544999999999998 28.92 27.175 23.36 35-39 20.535 28.46 27.224999999999998 23.78 40-44 20.28 28.725 27.26 23.735 45-49 20.4 28.685 27.279999999999998 23.635 50-54 20.205000000000002 28.705000000000002 27.58 23.51 55-59 20.505000000000003 29.14 26.915 23.44 60-64 20.05 28.505000000000003 27.389999999999997 24.055 65-69 20.09 28.675 27.675 23.56 70-74 19.765 28.595 27.575 24.065 75-79 20.445 27.97 27.61 23.974999999999998 80-84 20.115 28.849999999999998 27.250000000000004 23.785 85-89 20.415 28.110000000000003 28.035 23.44 90-94 20.14 28.389999999999997 27.805000000000003 23.665 95-99 21.21 28.310000000000002 27.605 22.875 100-104 20.810000000000002 28.955 26.63 23.605 105-109 20.65 28.599999999999998 27.12 23.630000000000003 110-114 21.215 28.575 26.729999999999997 23.48 115-119 21.205 27.889999999999997 27.37 23.535 120-124 21.015 28.03 27.195000000000004 23.76 125-129 20.880000000000003 27.655 27.715 23.75 130-134 21.375 27.900000000000002 27.18 23.544999999999998 135-139 21.349999999999998 28.46 26.39 23.799999999999997 140-144 21.095 27.834999999999997 27.255000000000003 23.815 145-149 21.66 28.42 26.224999999999998 23.695 150-151 21.102637829728714 27.84098012251531 27.25340667583448 23.80297537192149 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 3.0 25 3.0 26 6.0 27 11.5 28 15.0 29 14.0 30 13.0 31 21.0 32 36.5 33 46.5 34 53.0 35 73.0 36 100.5 37 114.5 38 130.0 39 154.5 40 178.5 41 200.0 42 239.0 43 267.5 44 261.0 45 261.0 46 264.5 47 258.5 48 225.0 49 195.5 50 186.5 51 151.0 52 118.0 53 98.0 54 72.0 55 55.5 56 37.5 57 25.5 58 26.5 59 23.0 60 15.5 61 10.0 62 6.5 63 3.5 64 3.0 65 2.5 66 2.0 67 3.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.5875000000000004 0.0 0.0 0.0 0.0 120-121 4.012499999999999 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 7.925 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAAT 10 0.006830828 145.0 5 >>END_MODULE SRR7170207 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170207_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85775 33.0 33.0 34.0 32.0 34.0 2 32.917 34.0 33.0 34.0 32.0 34.0 3 32.60775 34.0 33.0 34.0 32.0 34.0 4 32.335 34.0 33.0 34.0 32.0 34.0 5 32.362 34.0 33.0 34.0 32.0 34.0 6 36.8045 38.0 38.0 38.0 35.0 38.0 7 36.91775 38.0 38.0 38.0 36.0 38.0 8 36.9765 38.0 38.0 38.0 36.0 38.0 9 37.122 38.0 38.0 38.0 37.0 38.0 10-14 36.953649999999996 38.0 38.0 38.0 36.6 38.0 15-19 36.66305 38.0 38.0 38.0 36.0 38.0 20-24 36.8044 38.0 38.0 38.0 36.0 38.0 25-29 36.96745 38.0 38.0 38.0 36.2 38.0 30-34 36.99195 38.0 38.0 38.0 36.2 38.0 35-39 36.7385 38.0 38.0 38.0 36.0 38.0 40-44 36.59425 38.0 38.0 38.0 36.0 38.0 45-49 36.58825 38.0 38.0 38.0 35.2 38.0 50-54 36.794399999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.683949999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.604 38.0 38.0 38.0 35.0 38.0 65-69 36.57405 38.0 38.0 38.0 34.8 38.0 70-74 36.58425 38.0 38.0 38.0 35.0 38.0 75-79 36.430800000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.46185 38.0 38.0 38.0 34.0 38.0 85-89 35.935199999999995 38.0 38.0 38.0 33.4 38.0 90-94 35.67845 38.0 38.0 38.0 32.6 38.0 95-99 36.005449999999996 38.0 38.0 38.0 33.0 38.0 100-104 35.86965 38.0 37.6 38.0 32.8 38.0 105-109 35.74865 38.0 37.0 38.0 31.8 38.0 110-114 35.56055 38.0 37.0 38.0 31.2 38.0 115-119 35.31835 38.0 36.6 38.0 30.0 38.0 120-124 35.06035000000001 38.0 36.0 38.0 28.2 38.0 125-129 34.4903 38.0 35.6 38.0 25.2 38.0 130-134 33.355399999999996 38.0 35.0 38.0 16.6 38.0 135-139 32.16185 38.0 34.0 38.0 13.2 38.0 140-144 31.3898 38.0 33.0 38.0 2.0 38.0 145-149 30.5072 38.0 31.0 38.0 2.0 38.0 150-151 26.385625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 4.0 12 4.0 13 4.0 14 1.0 15 2.0 16 6.0 17 6.0 18 9.0 19 8.0 20 13.0 21 17.0 22 13.0 23 16.0 24 25.0 25 25.0 26 38.0 27 34.0 28 48.0 29 50.0 30 68.0 31 56.0 32 124.0 33 167.0 34 149.0 35 263.0 36 580.0 37 2249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.7983991995998 17.70885442721361 11.78089044522261 23.71185592796398 2 23.6368184092046 24.88744372186093 33.16658329164582 18.309154577288645 3 20.49595141700405 26.897773279352226 32.6163967611336 19.989878542510123 4 25.26772055073942 35.441101478837325 19.913309535951047 19.37786843447221 5 22.58967183922666 38.13279063851437 22.080895446451283 17.196642075807684 6 19.375 37.4 23.3 19.925 7 19.525000000000002 18.925 39.85 21.7 8 19.45 23.25 27.675 29.625 9 21.475 23.875 29.349999999999998 25.3 10-14 22.75848243371924 29.103392973487697 26.34190347316193 21.796221119631134 15-19 23.524958360672287 27.204360773229695 27.628324837228078 21.642356028869933 20-24 23.220823511710716 28.366517879532577 27.71452931440895 20.698129294347762 25-29 22.68 28.23 27.775 21.315 30-34 23.580000000000002 27.415 27.534999999999997 21.47 35-39 23.065326633165828 28.045226130653266 27.462311557788944 21.42713567839196 40-44 22.974814515722 27.794882148084593 28.223893403321053 21.006409932872355 45-49 22.85829267065748 27.612052920167013 28.39680064389557 21.132853765279943 50-54 23.083466773418735 27.286829463570854 28.442754203362693 21.18694955964772 55-59 23.50408091733013 27.77026688698613 27.98057182915227 20.74508036653147 60-64 23.58448060075094 28.020025031289116 27.319148936170212 21.076345431789736 65-69 23.283761454108458 28.16083320815182 27.795303189624953 20.76010214811477 70-74 23.54 27.775 27.905 20.78 75-79 23.355 28.03 28.035 20.580000000000002 80-84 23.235 27.355 28.505000000000003 20.905 85-89 23.829507533623218 27.267671149762364 28.11709980786733 20.785721508747095 90-94 23.882340987604145 27.77890672627515 27.667140825035563 20.671611461085146 95-99 23.265 27.985 27.925 20.825 100-104 23.57 28.139999999999997 27.83 20.46 105-109 24.115000000000002 27.845 27.544999999999998 20.495 110-114 23.82 28.465 27.58 20.135 115-119 24.315 27.689999999999998 27.700000000000003 20.294999999999998 120-124 24.085 28.294999999999998 27.37 20.25 125-129 24.229473578359897 27.643420986474936 27.49258384031374 20.634521594851428 130-134 24.62381715704018 27.979730079114738 26.53704948549563 20.85940327834945 135-139 24.791942751126424 28.242777630532736 27.07659687251524 19.888682745825605 140-144 25.34297963558414 28.07073954983923 26.586280814576636 20.0 145-149 25.285648409079265 27.52984577547779 27.314648767740945 19.869857047702002 150-151 25.3116735927465 27.49024052386349 26.873189774587587 20.324896108802417 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 2.5 25 4.5 26 5.5 27 4.5 28 8.0 29 13.0 30 13.0 31 20.5 32 26.5 33 35.5 34 52.0 35 67.0 36 80.5 37 95.0 38 122.0 39 157.0 40 186.0 41 219.0 42 240.5 43 250.0 44 287.0 45 280.0 46 262.0 47 262.5 48 238.5 49 212.0 50 185.0 51 161.0 52 130.5 53 88.0 54 62.0 55 52.5 56 41.0 57 37.0 58 25.0 59 19.0 60 15.5 61 7.0 62 7.5 63 6.0 64 4.0 65 2.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.05 3 1.2 4 1.95 5 1.725 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.23500000000000001 15-19 0.935 20-24 0.305 25-29 0.0 30-34 0.0 35-39 0.5 40-44 0.935 45-49 0.605 50-54 0.08 55-59 0.145 60-64 0.125 65-69 0.145 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.11 90-94 1.58 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.555 130-134 3.305 135-139 5.675 140-144 6.7 145-149 2.415 150-151 0.7374999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9249999999999999 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834212 spots for SRR7170207.sra Written 834212 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra Read 834208 spots for SRR7170207.sra Written 834208 spots for SRR7170207.sra SRR ids: ['SRR7170207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_js7v1s3z SRR7170207.sra spots: 16684164 blocks: [[1, 834208], [834209, 1668416], [1668417, 2502624], [2502625, 3336832], [3336833, 4171040], [4171041, 5005248], [5005249, 5839456], [5839457, 6673664], [6673665, 7507872], [7507873, 8342080], [8342081, 9176288], [9176289, 10010496], [10010497, 10844704], [10844705, 11678912], [11678913, 12513120], [12513121, 13347328], [13347329, 14181536], [14181537, 15015744], [15015745, 15849952], [15849953, 16684164]] SRR7170207 file size 5632015 SRR7170207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170207 SRR7170207_1.fastq SRR7170207_2.fastq Input file: SRR7170207_1.fastq Paired file: SRR7170207_2.fastq trimmed: SRR7170207-trimmed-pair1.fastq, SRR7170207-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:22:51 2025 >> started Wed Feb 12 19:23:10 2025 >> done (19.406s) 16684164 read pairs processed; of these: 25227 ( 0.15%) short read pairs filtered out after trimming by size control 23439 ( 0.14%) empty read pairs filtered out after trimming by size control 16635498 (99.71%) read pairs available; of these: 9667921 (58.12%) trimmed read pairs available after processing 6967577 (41.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 7 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 8 0.00% 27 12 0.00% 28 10 0.00% 29 11 0.00% 30 11 0.00% 31 9 0.00% 32 10 0.00% 33 10 0.00% 34 16 0.00% 35 18 0.00% 36 15 0.00% 37 19 0.00% 38 20 0.00% 39 15 0.00% 40 25 0.00% 41 22 0.00% 42 24 0.00% 43 38 0.00% 44 32 0.00% 45 47 0.00% 46 49 0.00% 47 51 0.00% 48 60 0.00% 49 89 0.00% 50 79 0.00% 51 122 0.00% 52 108 0.00% 53 116 0.00% 54 127 0.00% 55 151 0.00% 56 164 0.00% 57 216 0.00% 58 248 0.00% 59 273 0.00% 60 321 0.00% 61 354 0.00% 62 421 0.00% 63 477 0.00% 64 480 0.00% 65 584 0.00% 66 665 0.00% 67 752 0.00% 68 890 0.01% 69 1017 0.01% 70 1235 0.01% 71 1224 0.01% 72 1434 0.01% 73 1626 0.01% 74 1808 0.01% 75 1964 0.01% 76 2251 0.01% 77 2442 0.01% 78 2803 0.02% 79 3272 0.02% 80 3570 0.02% 81 4100 0.02% 82 4500 0.03% 83 5330 0.03% 84 6528 0.04% 85 7366 0.04% 86 7763 0.05% 87 8290 0.05% 88 8892 0.05% 89 9563 0.06% 90 10137 0.06% 91 11206 0.07% 92 12167 0.07% 93 13369 0.08% 94 13795 0.08% 95 14862 0.09% 96 15750 0.09% 97 16302 0.10% 98 17345 0.10% 99 18541 0.11% 100 19641 0.12% 101 20744 0.12% 102 22204 0.13% 103 23387 0.14% 104 24791 0.15% 105 26830 0.16% 106 27371 0.16% 107 28508 0.17% 108 29821 0.18% 109 30468 0.18% 110 32057 0.19% 111 33540 0.20% 112 35478 0.21% 113 37422 0.22% 114 39504 0.24% 115 40997 0.25% 116 42718 0.26% 117 43977 0.26% 118 44936 0.27% 119 46439 0.28% 120 48630 0.29% 121 51051 0.31% 122 53558 0.32% 123 56590 0.34% 124 59593 0.36% 125 61649 0.37% 126 64122 0.39% 127 66400 0.40% 128 68489 0.41% 129 71399 0.43% 130 75038 0.45% 131 77999 0.47% 132 82658 0.50% 133 86854 0.52% 134 92252 0.55% 135 97274 0.58% 136 103577 0.62% 137 108901 0.65% 138 117513 0.71% 139 125824 0.76% 140 136391 0.82% 141 148228 0.89% 142 161360 0.97% 143 178779 1.07% 144 204075 1.23% 145 238511 1.43% 146 289126 1.74% 147 379441 2.28% 148 558252 3.36% 149 1034672 6.22% 150 3881230 23.33% 151 6967577 41.88% 16635498 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=3.0 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=274.68 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=32 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=219.78 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.5 sequence=GAAGAAGAAGAAA SRR7170207 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:23:54 Started mapping on | Feb 12 19:23:55 Finished on | Feb 12 19:25:27 Mapping speed, Million of reads per hour | 650.95 Number of input reads | 16635498 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15723409 Uniquely mapped reads % | 94.52% Average mapped length | 290.39 Number of splices: Total | 14547735 Number of splices: Annotated (sjdb) | 14300955 Number of splices: GT/AG | 14322607 Number of splices: GC/AG | 176800 Number of splices: AT/AC | 12413 Number of splices: Non-canonical | 35915 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288903 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 18106 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642615 642615 642615 N_multimapping 288903 288903 288903 N_noFeature 434319 15560328 513220 N_ambiguous 147524 981 62740 UnstrandedReadsAssigned:15141566 PositiveStrandReadsAssigned:162100 NegativeStrandReadsAssigned:15147449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170207 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170207-trimmed-pair1.fastq SRR7170207-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,635,498 reads, 15,038,761 reads pseudoaligned [quant] estimated average fragment length: 227.416 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7170207.ke.tsv 34699 SRR7170207.se.tsv 87100 total ==> SRR7170207.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.58 243 9.44436 Potri.005G024800.1.v4.1 1035 808.584 27 2.3251 Potri.004G059700.1.v4.1 961 734.668 3 0.284337 Potri.007G009000.2.v4.1 1416 1189.58 0 0 Potri.003G141000.2.v4.1 2943 2716.58 300.035 7.69046 Potri.016G087400.1.v4.1 270 89.3361 1091.99 851.131 Potri.015G069301.1.v4.1 564 343.055 0 0 Potri.010G195200.1.v4.1 1773 1546.58 69 3.10656 Potri.012G127500.1.v4.1 977 750.612 7185 666.522 ==> SRR7170207.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1517 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170207 completed mapping pipeline successfully