Starting /dee2/code/volunteer_pipeline.sh SRR7170208 current disk space = 3051135430656 free memory = 1581792564 SRR7170208 SRAfilesize 9acd7e7cb7654a55460e2ace3622e8df SRR7170208.sra SRR7170208.sra file validated SRR7170208 is paired end SRR7170208 is conventional basespace SRR7170208 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3755 34.0 33.0 34.0 33.0 34.0 2 33.4945 34.0 34.0 34.0 33.0 34.0 3 33.551 34.0 34.0 34.0 33.0 34.0 4 33.552 34.0 34.0 34.0 33.0 34.0 5 33.5065 34.0 34.0 34.0 33.0 34.0 6 36.9455 38.0 37.0 38.0 35.0 38.0 7 37.35075 38.0 38.0 38.0 36.0 38.0 8 37.42375 38.0 38.0 38.0 37.0 38.0 9 37.42225 38.0 38.0 38.0 37.0 38.0 10-14 37.44075 38.0 38.0 38.0 37.0 38.0 15-19 37.411249999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.338350000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.24655 38.0 38.0 38.0 36.8 38.0 30-34 37.2754 38.0 38.0 38.0 36.4 38.0 35-39 37.1514 38.0 38.0 38.0 36.2 38.0 40-44 36.68175 38.0 38.0 38.0 34.4 38.0 45-49 36.542449999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.36395 38.0 37.0 38.0 34.0 38.0 55-59 36.29305000000001 38.0 37.0 38.0 33.0 38.0 60-64 36.2761 38.0 37.0 38.0 33.6 38.0 65-69 36.2073 38.0 37.0 38.0 33.0 38.0 70-74 36.05615 38.0 37.0 38.0 32.6 38.0 75-79 35.93005 38.0 36.8 38.0 31.6 38.0 80-84 35.717949999999995 38.0 36.4 38.0 30.6 38.0 85-89 35.645500000000006 38.0 36.0 38.0 29.6 38.0 90-94 35.5223 38.0 36.0 38.0 29.8 38.0 95-99 35.18685000000001 38.0 36.0 38.0 28.6 38.0 100-104 35.01115 38.0 35.8 38.0 28.2 38.0 105-109 34.66695 38.0 35.0 38.0 26.8 38.0 110-114 34.45365 38.0 34.6 38.0 25.8 38.0 115-119 34.0107 38.0 34.0 38.0 23.0 38.0 120-124 33.66475 38.0 34.0 38.0 19.8 38.0 125-129 33.155449999999995 37.8 33.4 38.0 15.0 38.0 130-134 32.59595 37.0 32.8 38.0 15.0 38.0 135-139 31.7292 36.0 31.0 38.0 14.2 38.0 140-144 31.2498 36.0 31.0 38.0 13.8 38.0 145-149 30.0151 35.4 28.6 38.0 6.4 38.0 150-151 25.219625 33.0 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 0.0 14 2.0 15 2.0 16 4.0 17 3.0 18 6.0 19 6.0 20 8.0 21 16.0 22 11.0 23 19.0 24 18.0 25 31.0 26 37.0 27 29.0 28 53.0 29 61.0 30 77.0 31 92.0 32 127.0 33 219.0 34 310.0 35 589.0 36 1113.0 37 1161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.04417670682731 14.48293172690763 14.78413654618474 34.68875502008032 2 21.224999999999998 21.7 35.225 21.85 3 20.075000000000003 28.575 25.35 26.0 4 23.200000000000003 36.525 20.0 20.275000000000002 5 21.5 36.225 23.175 19.1 6 18.3 35.425000000000004 25.25 21.025 7 13.4 22.425 45.574999999999996 18.6 8 19.2 22.400000000000002 28.925 29.475 9 19.525000000000002 22.7 31.125000000000004 26.650000000000002 10-14 19.919999999999998 30.154999999999998 26.025 23.9 15-19 19.830000000000002 28.65 27.495000000000005 24.025 20-24 19.74 29.375 27.185 23.7 25-29 19.755 29.59 27.61 23.044999999999998 30-34 20.105 29.104999999999997 26.985 23.805 35-39 19.785 29.575000000000003 26.655 23.985 40-44 20.265 28.444999999999997 27.445000000000004 23.845 45-49 19.96 28.599999999999998 27.125 24.315 50-54 20.119999999999997 28.655 27.13 24.095 55-59 20.11 28.765 27.685 23.44 60-64 19.97 29.160000000000004 27.095000000000002 23.775 65-69 20.255000000000003 28.249999999999996 27.955000000000002 23.54 70-74 20.915 28.549999999999997 26.815 23.72 75-79 21.02 28.23 27.105 23.645 80-84 20.215 28.82 27.084999999999997 23.880000000000003 85-89 20.544999999999998 28.544999999999998 27.48 23.43 90-94 20.61 28.470000000000002 27.165 23.755000000000003 95-99 20.988395358143258 28.026210484193676 27.385954381752704 23.599439775910362 100-104 20.635 28.439999999999998 27.425 23.5 105-109 20.73 28.83 26.834999999999997 23.605 110-114 21.175 28.37 26.795 23.66 115-119 20.5030754613192 28.364254638195728 27.344101615242288 23.788568285242786 120-124 21.34713471347135 28.682868286828683 26.752675267526755 23.217321732173218 125-129 20.785 27.810000000000002 27.284999999999997 24.12 130-134 20.51 29.134999999999998 27.1 23.255 135-139 20.71 28.599999999999998 26.825 23.865 140-144 21.14605730286514 28.206410320516024 27.11635581779089 23.53117655882794 145-149 20.88604430221511 28.48642432121606 26.93134656732837 23.69618480924046 150-151 21.167791947987 28.369592398099524 26.994248562140534 23.468367091772944 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 2.0 22 1.5 23 1.5 24 5.5 25 5.0 26 3.5 27 5.0 28 9.5 29 16.5 30 22.5 31 29.0 32 36.0 33 42.5 34 52.0 35 71.0 36 103.0 37 114.0 38 123.0 39 159.5 40 191.5 41 204.0 42 225.0 43 250.5 44 261.5 45 258.5 46 262.5 47 261.0 48 228.5 49 208.0 50 174.5 51 136.5 52 117.5 53 103.5 54 86.5 55 58.5 56 46.0 57 34.0 58 19.5 59 16.5 60 12.0 61 11.0 62 7.0 63 3.0 64 5.0 65 5.0 66 3.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170208 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170208_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.828 33.0 33.0 34.0 32.0 34.0 2 32.9625 34.0 33.0 34.0 32.0 34.0 3 32.718 34.0 33.0 34.0 32.0 34.0 4 32.4185 34.0 33.0 34.0 32.0 34.0 5 32.41825 34.0 33.0 34.0 32.0 34.0 6 36.812 38.0 38.0 38.0 36.0 38.0 7 36.8735 38.0 38.0 38.0 37.0 38.0 8 36.893 38.0 38.0 38.0 37.0 38.0 9 36.88075 38.0 38.0 38.0 37.0 38.0 10-14 36.7242 38.0 38.0 38.0 37.0 38.0 15-19 36.49485 38.0 38.0 38.0 36.2 38.0 20-24 36.536950000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.6524 38.0 38.0 38.0 36.4 38.0 30-34 36.6713 38.0 38.0 38.0 36.8 38.0 35-39 36.49015 38.0 38.0 38.0 36.0 38.0 40-44 36.35035 38.0 38.0 38.0 36.0 38.0 45-49 36.2243 38.0 38.0 38.0 35.4 38.0 50-54 36.5248 38.0 38.0 38.0 36.0 38.0 55-59 36.47095 38.0 38.0 38.0 36.0 38.0 60-64 36.46225 38.0 38.0 38.0 35.8 38.0 65-69 36.396100000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.418 38.0 38.0 38.0 35.0 38.0 75-79 36.252750000000006 38.0 38.0 38.0 34.2 38.0 80-84 36.26645 38.0 38.0 38.0 34.2 38.0 85-89 35.76174999999999 38.0 38.0 38.0 33.6 38.0 90-94 35.28085 38.0 38.0 38.0 30.4 38.0 95-99 35.7887 38.0 38.0 38.0 32.6 38.0 100-104 35.7467 38.0 38.0 38.0 32.8 38.0 105-109 35.64640000000001 38.0 37.8 38.0 32.6 38.0 110-114 35.355399999999996 38.0 37.2 38.0 30.6 38.0 115-119 35.276 38.0 37.0 38.0 31.0 38.0 120-124 34.962599999999995 38.0 36.6 38.0 28.4 38.0 125-129 34.43875 38.0 36.0 38.0 25.2 38.0 130-134 33.07525 38.0 35.0 38.0 15.4 38.0 135-139 31.731900000000003 38.0 33.8 38.0 2.0 38.0 140-144 30.9552 38.0 32.8 38.0 2.0 38.0 145-149 30.593049999999998 38.0 31.6 38.0 2.0 38.0 150-151 26.9635 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 8.0 4 5.0 5 2.0 6 0.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 4.0 15 5.0 16 6.0 17 6.0 18 8.0 19 7.0 20 15.0 21 11.0 22 11.0 23 13.0 24 21.0 25 25.0 26 19.0 27 22.0 28 48.0 29 57.0 30 66.0 31 84.0 32 120.0 33 142.0 34 136.0 35 227.0 36 539.0 37 2342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.11670423240671 15.351865765088906 17.405459554219885 29.125970448284498 2 25.845229151014276 23.541197094916104 33.1580265464563 17.45554720761332 3 21.345472938796156 27.9969650986343 29.438543247344462 21.219018715225086 4 23.751274209989806 34.913353720693166 22.50254841997961 18.83282364933741 5 23.771952150674473 36.446933061847794 21.354034105370324 18.427080682107405 6 18.346774193548388 37.72681451612903 24.420362903225808 19.506048387096776 7 19.44792973651192 16.787954830614808 43.312421580928486 20.451693851944793 8 22.383939774153074 21.656210790464243 27.051442910915934 28.908406524466752 9 21.502394756743133 23.59465591126796 29.442903957650618 25.460045374338293 10-14 22.739934160546973 27.845024056723222 27.176500379843 22.238541402886806 15-19 23.17004934126863 27.45816165623887 28.05839564576021 21.313393356732284 20-24 23.21247721288232 27.668624670852743 27.785092161231518 21.333805955033423 25-29 23.75384305226551 27.685096517312637 27.72037699712716 20.840683433294693 30-34 22.314300151591713 27.943405760485096 28.044466902476 21.697827185447196 35-39 23.158535966292707 27.427788212599623 28.179095385552564 21.234580435555102 40-44 23.10241117398175 28.123566294540446 27.700463883366467 21.07355864811133 45-49 22.310005606809725 27.92191243182629 28.30929201284469 21.458789948519293 50-54 23.464702023515162 28.031488116263816 28.081949841045567 20.421860019175455 55-59 22.94725118963248 27.81715095676825 27.93358307178293 21.302014781816343 60-64 23.34681496461072 27.082912032355917 28.301314459049543 21.26895854398382 65-69 23.302585815817327 27.662684611119516 28.050809012551035 20.98392056051212 70-74 23.169815102470313 27.659467855890163 28.360976098612017 20.80974094302751 75-79 22.74342928660826 27.078848560700873 28.97622027534418 21.201501877346686 80-84 23.45567134873886 27.79539847958516 27.951467552736244 20.79746261893974 85-89 23.652387784382046 27.859192457470794 27.74646443943431 20.74195531871285 90-94 23.333849568943265 27.618605131381962 27.892210004646124 21.155335295028653 95-99 23.347596274855274 28.024163100931286 28.150012584948403 20.47822803926504 100-104 23.48892126815053 27.75460985781038 27.538562025825254 21.21790684821384 105-109 23.861401119685276 26.978362838553487 28.01735007817622 21.14288596358501 110-114 23.397710655035045 27.71418486208462 28.45544854016439 20.43265594271595 115-119 24.54166457381084 27.414737053593853 27.731176854688833 20.312421517906472 120-124 24.005411363864116 27.68313458262351 27.983765908407655 20.32768814510472 125-129 23.870836924012774 27.81973944340244 27.99209205657221 20.31733157601257 130-134 24.177449168207023 27.689463955637706 27.763401109057302 20.369685767097966 135-139 24.975567379737214 27.80975133022044 27.163644261048976 20.051037028993377 140-144 24.209540597113584 27.17307480445081 28.36840365759612 20.248980940839484 145-149 25.102773585887494 27.366394338346257 28.01686007181142 19.513972003954834 150-151 25.390972663699934 27.55244755244755 27.209154481881754 19.847425301970755 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 1.5 5 2.5 6 1.5 7 2.5 8 4.0 9 3.0 10 1.5 11 1.5 12 4.5 13 4.0 14 1.5 15 3.0 16 3.5 17 1.5 18 1.0 19 1.5 20 0.5 21 1.0 22 1.5 23 2.0 24 3.5 25 4.0 26 5.5 27 7.0 28 12.5 29 15.0 30 10.5 31 12.5 32 24.0 33 34.5 34 45.5 35 66.0 36 84.0 37 105.5 38 136.0 39 157.5 40 184.5 41 212.0 42 243.5 43 281.0 44 284.0 45 267.5 46 248.0 47 236.0 48 232.5 49 210.5 50 180.0 51 153.0 52 120.5 53 100.0 54 81.0 55 55.5 56 39.5 57 25.0 58 18.0 59 14.5 60 7.5 61 4.5 62 7.0 63 6.5 64 4.0 65 3.5 66 3.0 67 2.0 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 1.15 4 1.9 5 1.775 6 0.8 7 0.375 8 0.375 9 0.8250000000000001 10-14 1.275 15-19 1.7049999999999998 20-24 1.26 25-29 0.795 30-34 1.05 35-39 1.505 40-44 1.915 45-49 1.905 50-54 0.915 55-59 1.23 60-64 1.0999999999999999 65-69 0.8049999999999999 70-74 0.215 75-79 0.125 80-84 0.685 85-89 2.42 90-94 3.145 95-99 0.675 100-104 0.485 105-109 0.865 110-114 0.845 115-119 0.455 120-124 0.21 125-129 1.365 130-134 5.325 135-139 7.91 140-144 9.229999999999999 145-149 3.9149999999999996 150-151 1.6875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7999999999999998 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.175000000000001 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989286 spots for SRR7170208.sra Written 989286 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra Read 989276 spots for SRR7170208.sra Written 989276 spots for SRR7170208.sra SRR ids: ['SRR7170208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2m9qk5t_ SRR7170208.sra spots: 19785530 blocks: [[1, 989276], [989277, 1978552], [1978553, 2967828], [2967829, 3957104], [3957105, 4946380], [4946381, 5935656], [5935657, 6924932], [6924933, 7914208], [7914209, 8903484], [8903485, 9892760], [9892761, 10882036], [10882037, 11871312], [11871313, 12860588], [12860589, 13849864], [13849865, 14839140], [14839141, 15828416], [15828417, 16817692], [16817693, 17806968], [17806969, 18796244], [18796245, 19785530]] SRR7170208 file size 6682966 SRR7170208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170208 SRR7170208_1.fastq SRR7170208_2.fastq Input file: SRR7170208_1.fastq Paired file: SRR7170208_2.fastq trimmed: SRR7170208-trimmed-pair1.fastq, SRR7170208-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:20:47 2025 >> started Wed Feb 12 19:21:09 2025 >> done (22.109s) 19785530 read pairs processed; of these: 31093 ( 0.16%) short read pairs filtered out after trimming by size control 32056 ( 0.16%) empty read pairs filtered out after trimming by size control 19722381 (99.68%) read pairs available; of these: 11257359 (57.08%) trimmed read pairs available after processing 8465022 (42.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 8 0.00% 27 5 0.00% 28 2 0.00% 29 8 0.00% 30 14 0.00% 31 4 0.00% 32 14 0.00% 33 7 0.00% 34 15 0.00% 35 4 0.00% 36 16 0.00% 37 15 0.00% 38 18 0.00% 39 17 0.00% 40 38 0.00% 41 23 0.00% 42 33 0.00% 43 41 0.00% 44 34 0.00% 45 49 0.00% 46 58 0.00% 47 49 0.00% 48 58 0.00% 49 62 0.00% 50 95 0.00% 51 101 0.00% 52 96 0.00% 53 113 0.00% 54 125 0.00% 55 139 0.00% 56 154 0.00% 57 182 0.00% 58 208 0.00% 59 226 0.00% 60 277 0.00% 61 298 0.00% 62 315 0.00% 63 387 0.00% 64 415 0.00% 65 470 0.00% 66 543 0.00% 67 626 0.00% 68 763 0.00% 69 997 0.01% 70 1109 0.01% 71 1075 0.01% 72 1202 0.01% 73 1388 0.01% 74 1436 0.01% 75 1594 0.01% 76 1816 0.01% 77 1942 0.01% 78 2197 0.01% 79 2515 0.01% 80 2827 0.01% 81 3340 0.02% 82 3896 0.02% 83 4603 0.02% 84 5656 0.03% 85 6681 0.03% 86 6748 0.03% 87 6934 0.04% 88 7488 0.04% 89 7715 0.04% 90 8566 0.04% 91 9135 0.05% 92 9997 0.05% 93 11097 0.06% 94 11753 0.06% 95 12479 0.06% 96 13156 0.07% 97 13762 0.07% 98 14460 0.07% 99 15271 0.08% 100 15974 0.08% 101 17213 0.09% 102 18617 0.09% 103 20033 0.10% 104 21457 0.11% 105 22663 0.11% 106 23272 0.12% 107 24248 0.12% 108 25657 0.13% 109 25939 0.13% 110 26902 0.14% 111 28672 0.15% 112 30551 0.15% 113 32168 0.16% 114 33926 0.17% 115 36248 0.18% 116 37268 0.19% 117 38331 0.19% 118 39118 0.20% 119 40312 0.20% 120 42356 0.21% 121 44627 0.23% 122 47112 0.24% 123 50319 0.26% 124 52605 0.27% 125 55513 0.28% 126 58042 0.29% 127 61070 0.31% 128 62488 0.32% 129 65915 0.33% 130 69092 0.35% 131 72707 0.37% 132 77974 0.40% 133 82931 0.42% 134 88902 0.45% 135 96377 0.49% 136 103249 0.52% 137 111420 0.56% 138 121126 0.61% 139 132025 0.67% 140 144887 0.73% 141 158801 0.81% 142 179024 0.91% 143 203157 1.03% 144 236366 1.20% 145 289936 1.47% 146 363614 1.84% 147 484320 2.46% 148 731218 3.71% 149 1352923 6.86% 150 4859701 24.64% 151 8465022 42.92% 19722381 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=80.34 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=15.8 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=1 fanout-score=80.34 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=15.8 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=271.14 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=14.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170208 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:22:44 Started mapping on | Feb 12 19:22:44 Finished on | Feb 12 19:24:18 Mapping speed, Million of reads per hour | 755.33 Number of input reads | 19722381 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18771434 Uniquely mapped reads % | 95.18% Average mapped length | 292.71 Number of splices: Total | 17371710 Number of splices: Annotated (sjdb) | 17079723 Number of splices: GT/AG | 17112682 Number of splices: GC/AG | 207634 Number of splices: AT/AC | 14795 Number of splices: Non-canonical | 36599 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339303 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 37760 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 633165 633165 633165 N_multimapping 339303 339303 339303 N_noFeature 469527 18576675 545602 N_ambiguous 199181 1227 79583 UnstrandedReadsAssigned:18102726 PositiveStrandReadsAssigned:193532 NegativeStrandReadsAssigned:18146249 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170208 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170208-trimmed-pair1.fastq SRR7170208-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,722,381 reads, 18,032,759 reads pseudoaligned [quant] estimated average fragment length: 246.72 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7170208.ke.tsv 34699 SRR7170208.se.tsv 87100 total ==> SRR7170208.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.28 347 11.0757 Potri.005G024800.1.v4.1 1035 789.28 68 4.87361 Potri.004G059700.1.v4.1 961 715.327 4 0.316321 Potri.007G009000.2.v4.1 1416 1170.28 0 0 Potri.003G141000.2.v4.1 2943 2697.28 369.203 7.74305 Potri.016G087400.1.v4.1 270 80.1133 1740 1228.62 Potri.015G069301.1.v4.1 564 324.239 0 0 Potri.010G195200.1.v4.1 1773 1527.28 68 2.51862 Potri.012G127500.1.v4.1 977 731.31 8452 653.779 ==> SRR7170208.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2492 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 419 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170208 completed mapping pipeline successfully