Starting /dee2/code/volunteer_pipeline.sh SRR7170209 current disk space = 3051054002176 free memory = 1581795916 SRR7170209 SRAfilesize 0a3d285131019c6c108cf23463f8e24c SRR7170209.sra SRR7170209.sra file validated SRR7170209 is paired end SRR7170209 is conventional basespace SRR7170209 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170209_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35 34.0 33.0 34.0 33.0 34.0 2 33.43 34.0 33.0 34.0 33.0 34.0 3 33.45775 34.0 34.0 34.0 33.0 34.0 4 33.5205 34.0 34.0 34.0 33.0 34.0 5 33.4755 34.0 34.0 34.0 33.0 34.0 6 36.92 38.0 37.0 38.0 35.0 38.0 7 37.2045 38.0 38.0 38.0 36.0 38.0 8 37.311 38.0 38.0 38.0 37.0 38.0 9 37.36725 38.0 38.0 38.0 37.0 38.0 10-14 37.28145 38.0 38.0 38.0 37.0 38.0 15-19 37.327299999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.2752 38.0 38.0 38.0 36.8 38.0 25-29 37.1941 38.0 38.0 38.0 36.2 38.0 30-34 37.137299999999996 38.0 38.0 38.0 36.0 38.0 35-39 37.022549999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.64295 38.0 38.0 38.0 34.2 38.0 45-49 36.3886 38.0 37.2 38.0 33.6 38.0 50-54 36.360499999999995 38.0 37.0 38.0 33.8 38.0 55-59 36.31225 38.0 37.0 38.0 33.6 38.0 60-64 36.15985 38.0 37.0 38.0 33.2 38.0 65-69 36.125 38.0 37.0 38.0 33.0 38.0 70-74 36.01105 38.0 37.0 38.0 32.2 38.0 75-79 35.8929 38.0 37.0 38.0 31.0 38.0 80-84 35.64335 38.0 36.2 38.0 29.8 38.0 85-89 35.51985 38.0 36.0 38.0 29.0 38.0 90-94 35.232049999999994 38.0 36.0 38.0 29.0 38.0 95-99 35.0278 38.0 35.8 38.0 28.4 38.0 100-104 34.909 38.0 35.4 38.0 27.6 38.0 105-109 34.645399999999995 38.0 35.0 38.0 26.6 38.0 110-114 34.392399999999995 38.0 34.0 38.0 25.2 38.0 115-119 33.73335 38.0 34.0 38.0 19.4 38.0 120-124 33.46875 37.8 34.0 38.0 17.8 38.0 125-129 33.198 37.8 33.4 38.0 17.4 38.0 130-134 32.4132 37.0 31.6 38.0 15.0 38.0 135-139 31.7231 36.0 31.0 38.0 14.0 38.0 140-144 31.07685 36.0 30.2 38.0 13.8 38.0 145-149 29.98135 35.6 28.0 38.0 6.4 38.0 150-151 25.521124999999998 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 0.0 14 2.0 15 1.0 16 5.0 17 2.0 18 6.0 19 10.0 20 9.0 21 13.0 22 17.0 23 21.0 24 20.0 25 28.0 26 42.0 27 50.0 28 54.0 29 63.0 30 68.0 31 95.0 32 158.0 33 205.0 34 320.0 35 548.0 36 1058.0 37 1199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.314944834503514 14.192577733199599 12.286860581745236 35.20561685055166 2 20.325 21.425 36.325 21.925 3 18.6 26.775 26.275 28.349999999999998 4 22.225 34.300000000000004 21.975 21.5 5 20.375 36.25 24.375 19.0 6 17.05 35.699999999999996 26.825 20.424999999999997 7 12.825000000000001 23.025000000000002 43.675000000000004 20.474999999999998 8 18.9 22.125 29.725 29.25 9 17.724999999999998 23.425 31.525 27.325 10-14 19.955000000000002 28.895 27.034999999999997 24.115000000000002 15-19 19.85 28.660000000000004 27.474999999999998 24.015 20-24 19.919999999999998 28.51 28.01 23.56 25-29 19.41 29.14 27.71 23.74 30-34 19.919999999999998 28.43 27.145000000000003 24.505 35-39 20.145 28.93 27.310000000000002 23.615 40-44 20.369999999999997 28.65 27.58 23.400000000000002 45-49 20.495 28.215 27.560000000000002 23.73 50-54 20.465 28.52 26.889999999999997 24.125 55-59 19.935 28.515 27.76 23.79 60-64 20.43 28.18 27.505000000000003 23.885 65-69 20.155 28.655 27.284999999999997 23.905 70-74 20.225 28.51 27.96 23.305 75-79 20.505000000000003 28.310000000000002 27.425 23.76 80-84 20.200000000000003 28.43 27.24 24.13 85-89 20.9 28.345 26.985 23.77 90-94 20.885 27.93 27.74 23.445 95-99 20.150000000000002 28.645 27.54 23.665 100-104 20.605 28.835 26.935 23.625 105-109 20.45 28.79 26.985 23.775 110-114 20.64 28.645 27.189999999999998 23.525 115-119 20.47 28.645 26.740000000000002 24.145 120-124 20.77 28.910000000000004 26.935 23.385 125-129 20.64 28.349999999999998 27.155 23.855 130-134 21.38 28.27 27.005000000000003 23.345 135-139 20.865000000000002 28.68 26.615 23.84 140-144 21.15 28.67 26.525 23.655 145-149 20.97 29.054999999999996 26.26 23.715 150-151 20.8125 28.487499999999997 26.7625 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.0 23 1.0 24 1.5 25 4.0 26 7.0 27 9.0 28 11.0 29 15.5 30 21.0 31 22.0 32 28.0 33 50.0 34 63.0 35 69.0 36 90.0 37 102.0 38 138.0 39 164.0 40 169.0 41 202.0 42 230.5 43 258.0 44 272.0 45 266.5 46 253.0 47 235.0 48 223.0 49 217.0 50 193.5 51 150.0 52 115.5 53 95.5 54 82.5 55 66.0 56 50.5 57 33.5 58 19.0 59 18.5 60 15.0 61 8.0 62 4.0 63 3.5 64 5.0 65 5.0 66 4.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.525 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.449999999999999 0.0 0.0 0.0 0.0 136-137 6.925 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCGG 10 0.006830828 145.0 7 GCAGATA 10 0.006830828 145.0 8 >>END_MODULE SRR7170209 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170209_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.756 33.0 33.0 34.0 32.0 34.0 2 32.87625 34.0 33.0 34.0 32.0 34.0 3 32.58975 34.0 33.0 34.0 32.0 34.0 4 32.27825 34.0 33.0 34.0 32.0 34.0 5 32.3965 34.0 33.0 34.0 32.0 34.0 6 36.8665 38.0 38.0 38.0 36.0 38.0 7 36.86675 38.0 38.0 38.0 36.0 38.0 8 36.89525 38.0 38.0 38.0 36.0 38.0 9 37.04 38.0 38.0 38.0 37.0 38.0 10-14 36.8483 38.0 38.0 38.0 36.0 38.0 15-19 36.5731 38.0 38.0 38.0 36.0 38.0 20-24 36.746500000000005 38.0 38.0 38.0 35.8 38.0 25-29 36.865449999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.886300000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.6567 38.0 38.0 38.0 35.8 38.0 40-44 36.54835 38.0 38.0 38.0 35.8 38.0 45-49 36.50895 38.0 38.0 38.0 35.2 38.0 50-54 36.668150000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.56855 38.0 38.0 38.0 35.0 38.0 60-64 36.5299 38.0 38.0 38.0 35.0 38.0 65-69 36.4699 38.0 38.0 38.0 34.8 38.0 70-74 36.478049999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.36215 38.0 38.0 38.0 34.0 38.0 80-84 36.2721 38.0 38.0 38.0 34.0 38.0 85-89 35.883500000000005 38.0 38.0 38.0 33.4 38.0 90-94 35.5567 38.0 38.0 38.0 31.0 38.0 95-99 35.83985 38.0 37.6 38.0 32.4 38.0 100-104 35.6731 38.0 37.4 38.0 31.4 38.0 105-109 35.5544 38.0 37.0 38.0 31.0 38.0 110-114 35.426899999999996 38.0 37.0 38.0 30.2 38.0 115-119 35.1398 38.0 36.2 38.0 28.6 38.0 120-124 34.8582 38.0 36.0 38.0 27.2 38.0 125-129 34.439049999999995 38.0 35.8 38.0 24.8 38.0 130-134 33.25335 38.0 34.6 38.0 16.2 38.0 135-139 31.993399999999998 38.0 34.0 38.0 10.8 38.0 140-144 31.40625 38.0 32.6 38.0 2.0 38.0 145-149 30.429650000000002 38.0 31.0 38.0 2.0 38.0 150-151 26.431625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 8.0 4 2.0 5 1.0 6 1.0 7 2.0 8 0.0 9 2.0 10 1.0 11 2.0 12 2.0 13 5.0 14 6.0 15 4.0 16 3.0 17 6.0 18 7.0 19 10.0 20 19.0 21 18.0 22 11.0 23 23.0 24 24.0 25 18.0 26 37.0 27 42.0 28 42.0 29 52.0 30 71.0 31 71.0 32 136.0 33 176.0 34 154.0 35 242.0 36 496.0 37 2296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.679009256942706 17.062797097823367 16.56242181636227 27.695771828871653 2 23.367525644233176 24.718538904178132 34.676007005253936 17.237928446334752 3 20.944921677614957 27.84234461849419 29.055078322385043 22.157655381505812 4 24.980920885270923 34.74942762655813 21.648435512592215 18.621215975578735 5 22.63384927683329 36.665820857650345 22.735346358792185 17.96498350672418 6 19.125 35.4 24.925 20.549999999999997 7 18.675 18.125 41.675000000000004 21.525 8 22.275 21.7 26.924999999999997 29.099999999999998 9 22.425 24.0 29.225 24.349999999999998 10-14 23.084626940410615 28.047070605908864 26.84026039058588 22.02804206309464 15-19 23.30429528173624 26.884535978649478 28.45561206505866 21.35555667455562 20-24 23.244624868440837 27.960707663008066 27.434471006866133 21.36019646168496 25-29 23.380000000000003 28.249999999999996 27.405 20.965 30-34 23.080000000000002 28.12 27.775 21.025 35-39 23.559815335206743 27.835206744279407 27.177840224809312 21.427137695704538 40-44 23.170670292592032 28.39804602910812 27.748401067633583 20.682882610666265 45-49 23.68222702376765 27.661926536354958 27.73227476006231 20.923571679815083 50-54 23.864545818327333 28.441376550620245 26.90076030412165 20.793317326930772 55-59 23.64864864864865 27.71271271271271 27.90790790790791 20.73073073073073 60-64 22.86443476955412 27.663513986888855 28.609317920232197 20.862733323324825 65-69 22.768214571657325 27.68714971977582 27.94735788630905 21.59727782225781 70-74 23.78 27.889999999999997 27.665 20.665 75-79 23.11 27.52 28.275 21.095 80-84 24.035 27.055 28.275 20.635 85-89 23.491118288251915 27.503027856277757 28.34578118691966 20.660072668550665 90-94 23.375570197668523 27.546882919412063 28.139888494678157 20.937658388241257 95-99 23.825 27.47 27.465 21.240000000000002 100-104 23.14 27.465 28.384999999999998 21.01 105-109 23.71 27.41 28.215 20.665 110-114 23.630000000000003 27.534999999999997 27.505000000000003 21.33 115-119 24.415 28.185 27.639999999999997 19.759999999999998 120-124 23.525 27.544999999999998 28.315 20.615 125-129 24.625966462496233 27.899387488703688 26.965558791043275 20.509087257756804 130-134 25.276990466374645 27.76603968049472 26.848750322081937 20.1082195310487 135-139 24.706752615449645 27.702631300855966 27.369755891366378 20.220860192328015 140-144 25.298762270593254 28.222364489970126 26.53649167733675 19.94238156209987 145-149 25.09966268015946 27.639783297556985 26.79648369620771 20.464070326075845 150-151 25.63812397837294 26.78234628442097 27.499056959637873 20.080472777568215 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.0 23 1.0 24 0.0 25 2.0 26 4.5 27 6.0 28 6.5 29 8.0 30 11.5 31 19.0 32 26.0 33 36.5 34 49.0 35 60.0 36 75.5 37 88.0 38 117.5 39 156.0 40 178.0 41 220.0 42 259.5 43 270.5 44 277.5 45 276.0 46 272.0 47 274.0 48 252.0 49 202.5 50 162.5 51 150.5 52 132.5 53 100.0 54 76.0 55 54.0 56 45.0 57 40.0 58 27.5 59 15.0 60 10.0 61 7.5 62 4.5 63 3.0 64 2.5 65 4.0 66 3.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.075 3 1.05 4 1.725 5 1.4749999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.15 15-19 0.705 20-24 0.23500000000000001 25-29 0.0 30-34 0.0 35-39 0.36 40-44 0.715 45-49 0.49500000000000005 50-54 0.04 55-59 0.1 60-64 0.08499999999999999 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.9199999999999999 90-94 1.35 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.41000000000000003 130-134 2.9749999999999996 135-139 5.37 140-144 6.279999999999999 145-149 2.17 150-151 0.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.30135610246107486 0.6 3 0.07533902561526871 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.35 0.0 0.0 0.025 0.0 92-93 0.5 0.0 0.0 0.025 0.0 94-95 0.6 0.0 0.0 0.025 0.0 96-97 0.7 0.0 0.0 0.025 0.0 98-99 0.825 0.0 0.0 0.025 0.0 100-101 1.025 0.0 0.0 0.025 0.0 102-103 1.1375 0.0 0.0 0.025 0.0 104-105 1.375 0.0 0.0 0.025 0.0 106-107 1.6625 0.0 0.0 0.025 0.0 108-109 1.8375 0.0 0.0 0.025 0.0 110-111 2.0375 0.0 0.0 0.025 0.0 112-113 2.2249999999999996 0.0 0.0 0.025 0.0 114-115 2.625 0.0 0.0 0.025 0.0 116-117 2.9375 0.0 0.0 0.025 0.0 118-119 3.2 0.0 0.0 0.025 0.0 120-121 3.5125 0.0 0.0 0.025 0.0 122-123 3.7875 0.0 0.0 0.025 0.0 124-125 4.15 0.0 0.0 0.025 0.0 126-127 4.612500000000001 0.0 0.0 0.025 0.0 128-129 4.925 0.0 0.0 0.025 0.0 130-131 5.1875 0.0 0.0 0.025 0.0 132-133 5.75 0.0 0.0 0.025 0.0 134-135 6.325 0.0 0.0 0.025 0.0 136-137 6.775 0.0 0.0 0.025 0.0 138-139 7.2 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCTT 10 0.0070963763 143.13924 8 >>END_MODULE Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911422 spots for SRR7170209.sra Written 911422 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra Read 911415 spots for SRR7170209.sra Written 911415 spots for SRR7170209.sra SRR ids: ['SRR7170209.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ff4mits SRR7170209.sra spots: 18228307 blocks: [[1, 911415], [911416, 1822830], [1822831, 2734245], [2734246, 3645660], [3645661, 4557075], [4557076, 5468490], [5468491, 6379905], [6379906, 7291320], [7291321, 8202735], [8202736, 9114150], [9114151, 10025565], [10025566, 10936980], [10936981, 11848395], [11848396, 12759810], [12759811, 13671225], [13671226, 14582640], [14582641, 15494055], [15494056, 16405470], [16405471, 17316885], [17316886, 18228307]] SRR7170209 file size 6155274 SRR7170209 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170209 SRR7170209_1.fastq SRR7170209_2.fastq Input file: SRR7170209_1.fastq Paired file: SRR7170209_2.fastq trimmed: SRR7170209-trimmed-pair1.fastq, SRR7170209-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:25:28 2025 >> started Wed Feb 12 19:25:50 2025 >> done (22.525s) 18228307 read pairs processed; of these: 31260 ( 0.17%) short read pairs filtered out after trimming by size control 29201 ( 0.16%) empty read pairs filtered out after trimming by size control 18167846 (99.67%) read pairs available; of these: 10460153 (57.58%) trimmed read pairs available after processing 7707693 (42.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 7 0.00% 21 10 0.00% 22 4 0.00% 23 4 0.00% 24 9 0.00% 25 6 0.00% 26 13 0.00% 27 15 0.00% 28 15 0.00% 29 410 0.00% 30 14 0.00% 31 11 0.00% 32 20 0.00% 33 10 0.00% 34 10 0.00% 35 26 0.00% 36 26 0.00% 37 19 0.00% 38 31 0.00% 39 33 0.00% 40 47 0.00% 41 36 0.00% 42 40 0.00% 43 44 0.00% 44 50 0.00% 45 67 0.00% 46 65 0.00% 47 69 0.00% 48 88 0.00% 49 92 0.00% 50 114 0.00% 51 131 0.00% 52 147 0.00% 53 161 0.00% 54 180 0.00% 55 190 0.00% 56 189 0.00% 57 230 0.00% 58 283 0.00% 59 303 0.00% 60 340 0.00% 61 381 0.00% 62 428 0.00% 63 499 0.00% 64 558 0.00% 65 668 0.00% 66 685 0.00% 67 812 0.00% 68 1010 0.01% 69 1583 0.01% 70 1841 0.01% 71 1606 0.01% 72 1624 0.01% 73 1733 0.01% 74 1871 0.01% 75 2031 0.01% 76 2083 0.01% 77 2323 0.01% 78 2683 0.01% 79 3030 0.02% 80 3372 0.02% 81 3817 0.02% 82 4645 0.03% 83 5314 0.03% 84 6698 0.04% 85 7378 0.04% 86 7773 0.04% 87 8024 0.04% 88 8512 0.05% 89 8899 0.05% 90 9654 0.05% 91 10745 0.06% 92 11731 0.06% 93 12833 0.07% 94 13495 0.07% 95 14311 0.08% 96 15059 0.08% 97 15639 0.09% 98 16518 0.09% 99 17357 0.10% 100 18298 0.10% 101 19489 0.11% 102 21065 0.12% 103 22422 0.12% 104 23754 0.13% 105 25686 0.14% 106 26224 0.14% 107 27183 0.15% 108 28120 0.15% 109 28183 0.16% 110 29832 0.16% 111 31818 0.18% 112 33540 0.18% 113 35411 0.19% 114 37108 0.20% 115 39388 0.22% 116 40072 0.22% 117 41773 0.23% 118 42404 0.23% 119 44080 0.24% 120 45548 0.25% 121 47985 0.26% 122 50516 0.28% 123 53658 0.30% 124 56047 0.31% 125 58569 0.32% 126 61110 0.34% 127 63154 0.35% 128 65770 0.36% 129 68838 0.38% 130 71956 0.40% 131 74999 0.41% 132 80176 0.44% 133 85272 0.47% 134 91383 0.50% 135 97115 0.53% 136 104032 0.57% 137 110482 0.61% 138 119804 0.66% 139 129749 0.71% 140 141210 0.78% 141 154010 0.85% 142 171847 0.95% 143 191345 1.05% 144 220200 1.21% 145 262322 1.44% 146 321236 1.77% 147 428808 2.36% 148 636301 3.50% 149 1187391 6.54% 150 4360683 24.00% 151 7707693 42.42% 18167846 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=300.60 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=30.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=304.23 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.6 sequence=AAGAAGAAGAAG SRR7170209 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:26:34 Started mapping on | Feb 12 19:26:34 Finished on | Feb 12 19:28:37 Mapping speed, Million of reads per hour | 531.74 Number of input reads | 18167846 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17128318 Uniquely mapped reads % | 94.28% Average mapped length | 291.56 Number of splices: Total | 16403492 Number of splices: Annotated (sjdb) | 16131985 Number of splices: GT/AG | 16153710 Number of splices: GC/AG | 199952 Number of splices: AT/AC | 13041 Number of splices: Non-canonical | 36789 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341596 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 34856 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 722042 722042 722042 N_multimapping 341596 341596 341596 N_noFeature 389185 16960554 468156 N_ambiguous 157363 1071 67793 UnstrandedReadsAssigned:16581770 PositiveStrandReadsAssigned:166693 NegativeStrandReadsAssigned:16592369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170209 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170209-trimmed-pair1.fastq SRR7170209-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,167,846 reads, 16,490,292 reads pseudoaligned [quant] estimated average fragment length: 237.81 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52401 SRR7170209.ke.tsv 34699 SRR7170209.se.tsv 87100 total ==> SRR7170209.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.19 294 9.72657 Potri.005G024800.1.v4.1 1035 798.19 47 3.46988 Potri.004G059700.1.v4.1 961 724.243 3 0.244095 Potri.007G009000.2.v4.1 1416 1179.19 0 0 Potri.003G141000.2.v4.1 2943 2706.19 312.037 6.7947 Potri.016G087400.1.v4.1 270 83.7955 1744 1226.45 Potri.015G069301.1.v4.1 564 332.608 0 0 Potri.010G195200.1.v4.1 1773 1536.19 65 2.49339 Potri.012G127500.1.v4.1 977 740.224 5364 427.02 ==> SRR7170209.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1125 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170209 completed mapping pipeline successfully