Starting /dee2/code/volunteer_pipeline.sh SRR7170437 current disk space = 3050901323776 free memory = 1580181020 SRR7170437 SRAfilesize a4f66ea7b7e8ba3cd41ec89fb1160050 SRR7170437.sra SRR7170437.sra file validated SRR7170437 is paired end SRR7170437 is conventional basespace SRR7170437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.36125 18.0 18.0 18.0 18.0 32.0 2 26.191 27.0 25.0 29.0 18.0 30.0 3 27.84475 29.0 27.0 31.0 18.0 33.0 4 31.0145 31.0 30.0 33.0 29.0 33.0 5 32.38175 33.0 32.0 33.0 32.0 33.0 6 36.321 38.0 36.0 38.0 33.0 38.0 7 37.0405 38.0 37.0 38.0 35.0 38.0 8 37.2615 38.0 38.0 38.0 36.0 38.0 9 37.5165 38.0 38.0 38.0 37.0 38.0 10-14 37.55565 38.0 38.0 38.0 37.2 38.0 15-19 37.570550000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.676249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.66435 38.0 38.0 38.0 38.0 38.0 30-34 37.6242 38.0 38.0 38.0 38.0 38.0 35-39 37.5548 38.0 38.0 38.0 37.6 38.0 40-44 37.5064 38.0 38.0 38.0 37.0 38.0 45-49 37.4983 38.0 38.0 38.0 37.2 38.0 50-54 37.3295 38.0 38.0 38.0 36.8 38.0 55-59 37.110200000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.0955 38.0 38.0 38.0 36.0 38.0 65-69 36.9721 38.0 38.0 38.0 35.6 38.0 70-74 36.90885000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.75845 38.0 38.0 38.0 34.4 38.0 80-84 36.57430000000001 38.0 37.8 38.0 34.0 38.0 85-89 36.49715 38.0 37.0 38.0 34.0 38.0 90-94 36.3291 38.0 37.0 38.0 33.6 38.0 95-99 36.2521 38.0 37.0 38.0 33.6 38.0 100-104 35.574200000000005 38.0 36.2 38.0 30.0 38.0 105-109 35.7076 38.0 36.0 38.0 31.0 38.0 110-114 35.39245 38.0 35.8 38.0 29.2 38.0 115-119 35.06185000000001 38.0 35.2 38.0 28.2 38.0 120-124 34.5952 38.0 34.8 38.0 26.6 38.0 125-129 34.3023 38.0 34.6 38.0 24.4 38.0 130-134 34.10045 38.0 34.2 38.0 23.6 38.0 135-139 33.3754 38.0 33.0 38.0 18.8 38.0 140-144 32.6435 37.0 32.2 38.0 17.0 38.0 145-149 30.702700000000004 36.0 30.4 38.0 10.8 38.0 150-151 26.159750000000003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 2.0 19 4.0 20 4.0 21 5.0 22 3.0 23 7.0 24 7.0 25 13.0 26 13.0 27 17.0 28 24.0 29 43.0 30 51.0 31 77.0 32 105.0 33 155.0 34 316.0 35 610.0 36 1428.0 37 1110.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.35408560311284 20.907911802853437 8.119325551232166 33.61867704280156 2 21.725 14.099999999999998 36.425000000000004 27.750000000000004 3 19.3 20.849999999999998 27.025 32.824999999999996 4 22.2 30.4 23.400000000000002 24.0 5 21.9 33.875 24.65 19.575 6 18.2 36.3 25.3 20.200000000000003 7 13.750000000000002 25.650000000000002 43.5 17.1 8 18.0 24.9 31.6 25.5 9 16.425 24.525 35.725 23.325000000000003 10-14 19.675 30.195 26.729999999999997 23.400000000000002 15-19 19.765 28.865000000000002 28.18 23.189999999999998 20-24 19.79 29.445 26.995 23.77 25-29 19.595000000000002 29.635 27.405 23.365 30-34 19.73 28.985 28.04 23.244999999999997 35-39 19.54 28.939999999999998 27.675 23.845 40-44 19.775000000000002 29.825000000000003 27.315 23.085 45-49 20.075000000000003 28.565 27.500000000000004 23.86 50-54 20.125 29.235 27.779999999999998 22.86 55-59 19.84 28.965000000000003 28.27 22.925 60-64 20.105 28.444999999999997 27.97 23.48 65-69 20.165 29.189999999999998 27.839999999999996 22.805 70-74 19.705000000000002 29.125 27.715 23.455000000000002 75-79 19.99 28.835 27.74 23.435 80-84 19.865993299664982 28.38641932096605 27.976398819940997 23.771188559427973 85-89 19.634999999999998 28.744999999999997 27.66 23.96 90-94 19.685 28.92 27.639999999999997 23.755000000000003 95-99 20.315 28.335 27.985 23.365 100-104 19.925 28.475 28.310000000000002 23.29 105-109 19.78 29.465000000000003 27.66 23.095 110-114 20.49 28.395 27.779999999999998 23.335 115-119 20.31 28.575 27.345000000000002 23.77 120-124 21.07 28.215 27.400000000000002 23.315 125-129 19.77 28.560000000000002 27.725 23.945 130-134 20.07 28.310000000000002 27.655 23.965 135-139 20.19 28.555000000000003 27.6 23.655 140-144 20.885 28.634999999999998 27.07 23.41 145-149 20.755000000000003 28.470000000000002 27.455000000000002 23.32 150-151 20.1375 28.425 29.037499999999998 22.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 3.5 24 3.5 25 2.5 26 5.0 27 11.5 28 13.0 29 17.0 30 27.0 31 30.0 32 40.5 33 58.5 34 65.5 35 78.0 36 103.0 37 119.5 38 143.0 39 177.5 40 194.0 41 218.5 42 248.0 43 263.5 44 266.5 45 268.5 46 261.0 47 241.5 48 226.0 49 194.0 50 162.0 51 138.0 52 105.5 53 74.5 54 57.5 55 48.5 56 39.0 57 24.5 58 17.0 59 18.5 60 14.0 61 7.0 62 4.0 63 2.0 64 1.0 65 0.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.9000000000000004 0.0 0.0 0.0 0.0 132-133 4.2 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 4.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.112 33.0 33.0 34.0 32.0 34.0 2 33.20575 34.0 33.0 34.0 33.0 34.0 3 33.2275 34.0 33.0 34.0 33.0 34.0 4 33.19325 34.0 33.0 34.0 33.0 34.0 5 33.1805 34.0 33.0 34.0 33.0 34.0 6 37.451 38.0 38.0 38.0 38.0 38.0 7 37.507 38.0 38.0 38.0 38.0 38.0 8 37.453 38.0 38.0 38.0 38.0 38.0 9 37.51575 38.0 38.0 38.0 38.0 38.0 10-14 37.435649999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.4099 38.0 38.0 38.0 37.6 38.0 20-24 37.4024 38.0 38.0 38.0 37.8 38.0 25-29 37.3417 38.0 38.0 38.0 37.4 38.0 30-34 37.30604999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.30465 38.0 38.0 38.0 37.4 38.0 40-44 37.3033 38.0 38.0 38.0 37.0 38.0 45-49 37.2659 38.0 38.0 38.0 37.2 38.0 50-54 37.203649999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.186499999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1904 38.0 38.0 38.0 37.0 38.0 65-69 37.115550000000006 38.0 38.0 38.0 36.8 38.0 70-74 37.0798 38.0 38.0 38.0 36.6 38.0 75-79 36.973299999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.8521 38.0 38.0 38.0 36.0 38.0 85-89 36.64205 38.0 38.0 38.0 35.2 38.0 90-94 36.5809 38.0 38.0 38.0 34.8 38.0 95-99 36.4711 38.0 38.0 38.0 34.2 38.0 100-104 36.418099999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.30485 38.0 37.8 38.0 34.0 38.0 110-114 36.101549999999996 38.0 37.4 38.0 33.6 38.0 115-119 35.941050000000004 38.0 37.0 38.0 32.8 38.0 120-124 35.5544 38.0 36.2 38.0 31.0 38.0 125-129 35.194900000000004 38.0 36.0 38.0 30.4 38.0 130-134 34.780350000000006 38.0 35.2 38.0 28.4 38.0 135-139 34.30895 38.0 33.8 38.0 26.2 38.0 140-144 33.58395 38.0 33.0 38.0 22.0 38.0 145-149 32.432100000000005 38.0 33.0 38.0 13.6 38.0 150-151 26.588250000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 5.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 4.0 13 0.0 14 4.0 15 4.0 16 3.0 17 4.0 18 4.0 19 3.0 20 2.0 21 3.0 22 2.0 23 5.0 24 14.0 25 10.0 26 14.0 27 16.0 28 23.0 29 28.0 30 26.0 31 41.0 32 63.0 33 95.0 34 141.0 35 306.0 36 841.0 37 2326.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.234558639659916 21.180295073768445 14.128532133033259 26.456614153538382 2 26.131532883220803 26.831707926981746 30.50762690672668 16.52913228307077 3 20.4801200300075 29.75743935983996 30.807701925481368 18.95473868467117 4 23.330832708177045 35.08377094273568 24.131032758189548 17.454363590897724 5 24.131032758189548 37.08427106776694 22.88072018004501 15.9039759939985 6 21.45 38.0 22.875 17.675 7 19.7 21.0 40.025 19.275000000000002 8 21.05 25.424999999999997 28.825 24.7 9 21.05 26.525 31.0 21.425 10-14 22.79 29.285 27.025 20.9 15-19 23.31 28.694999999999997 27.800000000000004 20.195 20-24 22.573386007901185 29.7194579186878 27.40911136670501 20.298044706706005 25-29 23.328499274891236 28.594289143371505 27.819172875931393 20.25803870580587 30-34 22.46173852155647 28.73362008602581 27.928378513554065 20.876262878863656 35-39 22.975743935983996 28.157039259814955 28.177044261065266 20.690172543135784 40-44 23.207320732073207 28.132813281328133 28.05780578057806 20.602060206020603 45-49 23.184636927385476 28.100620124024804 28.000600120024004 20.714142828565713 50-54 22.73841076161424 28.594289143371505 27.889183377506626 20.778116717507626 55-59 22.993449017352603 28.094214132119816 27.889183377506626 21.023153473020955 60-64 22.867286728672866 28.182818281828183 28.07780778077808 20.87208720872087 65-69 23.43085771442861 27.786946736684172 27.866966741685424 20.9152288072018 70-74 23.131939581874562 27.843353005901772 28.33850155046514 20.686205861758527 75-79 23.191957587276182 27.80334100230069 28.188456536961088 20.81624487346204 80-84 22.854141656662666 27.941176470588236 27.63605442176871 21.568627450980394 85-89 23.677758318739052 28.416312234175635 27.32549412059044 20.58043532649487 90-94 23.54530444789113 28.0182118376945 27.823085005253418 20.613398709160954 95-99 23.299659931986398 28.155631126225245 27.865573114622926 20.67913582716543 100-104 24.0748149629926 27.600520104020802 28.040608121624327 20.284056811362273 105-109 23.728559283892583 27.644146621993297 28.249237385607838 20.378056708506275 110-114 23.769753950790157 28.510702140428084 27.795559111822364 19.92398479695939 115-119 23.93098274568642 28.577144286071515 27.376844211052763 20.115028757189297 120-124 24.256064016004 28.257064266066518 27.451862965741437 20.035008752188048 125-129 24.21089490270622 27.667450352658697 27.832524636086237 20.289130108548846 130-134 24.29957974784871 28.59715829497699 27.111266760056036 19.99199519711827 135-139 24.505829955462143 27.80863734174048 27.693539508582294 19.991993194215084 140-144 23.97417934347478 27.942353883106485 28.202562049639713 19.88090472377902 145-149 24.39463678206924 27.966780068040826 27.55153091855113 20.087052231338802 150-151 24.759284731774414 28.373139927472803 27.472802300862824 19.39477303988996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.5 16 1.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 2.0 23 3.0 24 3.0 25 3.5 26 5.5 27 8.0 28 11.0 29 17.5 30 18.5 31 23.0 32 29.5 33 35.0 34 48.5 35 62.0 36 82.5 37 118.5 38 138.0 39 158.5 40 196.5 41 240.0 42 265.5 43 273.0 44 275.5 45 271.0 46 269.0 47 239.5 48 223.0 49 211.0 50 171.0 51 140.0 52 113.0 53 82.5 54 67.0 55 57.5 56 42.0 57 27.0 58 17.5 59 11.5 60 8.0 61 6.5 62 5.0 63 3.0 64 1.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.015 30-34 0.03 35-39 0.025 40-44 0.01 45-49 0.02 50-54 0.015 55-59 0.015 60-64 0.01 65-69 0.025 70-74 0.03 75-79 0.03 80-84 0.04 85-89 0.075 90-94 0.065 95-99 0.02 100-104 0.02 105-109 0.015 110-114 0.02 115-119 0.025 120-124 0.025 125-129 0.045 130-134 0.06 135-139 0.08499999999999999 140-144 0.08 145-149 0.06 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44570420760897 98.675 2 0.3779289493575208 0.75 3 0.12597631645250693 0.375 4 0.05039052658100278 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra Read 644351 spots for SRR7170437.sra Written 644351 spots for SRR7170437.sra SRR ids: ['SRR7170437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m9t34tqc SRR7170437.sra spots: 12887020 blocks: [[1, 644351], [644352, 1288702], [1288703, 1933053], [1933054, 2577404], [2577405, 3221755], [3221756, 3866106], [3866107, 4510457], [4510458, 5154808], [5154809, 5799159], [5799160, 6443510], [6443511, 7087861], [7087862, 7732212], [7732213, 8376563], [8376564, 9020914], [9020915, 9665265], [9665266, 10309616], [10309617, 10953967], [10953968, 11598318], [11598319, 12242669], [12242670, 12887020]] SRR7170437 file size 4345287 SRR7170437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170437 SRR7170437_1.fastq SRR7170437_2.fastq Input file: SRR7170437_1.fastq Paired file: SRR7170437_2.fastq trimmed: SRR7170437-trimmed-pair1.fastq, SRR7170437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:52:00 2025 >> started Wed Feb 12 19:52:14 2025 >> done (13.746s) 12887020 read pairs processed; of these: 15605 ( 0.12%) short read pairs filtered out after trimming by size control 17546 ( 0.14%) empty read pairs filtered out after trimming by size control 12853869 (99.74%) read pairs available; of these: 8062239 (62.72%) trimmed read pairs available after processing 4791630 (37.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 3 0.00% 26 3 0.00% 27 1 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 4 0.00% 32 4 0.00% 33 5 0.00% 34 1 0.00% 35 10 0.00% 36 9 0.00% 37 12 0.00% 38 15 0.00% 39 21 0.00% 40 15 0.00% 41 15 0.00% 42 24 0.00% 43 31 0.00% 44 26 0.00% 45 37 0.00% 46 28 0.00% 47 52 0.00% 48 39 0.00% 49 51 0.00% 50 68 0.00% 51 68 0.00% 52 91 0.00% 53 93 0.00% 54 93 0.00% 55 118 0.00% 56 115 0.00% 57 143 0.00% 58 143 0.00% 59 186 0.00% 60 215 0.00% 61 244 0.00% 62 266 0.00% 63 318 0.00% 64 368 0.00% 65 401 0.00% 66 421 0.00% 67 416 0.00% 68 512 0.00% 69 590 0.00% 70 674 0.01% 71 748 0.01% 72 939 0.01% 73 1012 0.01% 74 1144 0.01% 75 1275 0.01% 76 1444 0.01% 77 1583 0.01% 78 1622 0.01% 79 1926 0.01% 80 2201 0.02% 81 2456 0.02% 82 2967 0.02% 83 3430 0.03% 84 4111 0.03% 85 4580 0.04% 86 4579 0.04% 87 4702 0.04% 88 4905 0.04% 89 5262 0.04% 90 5505 0.04% 91 6022 0.05% 92 6345 0.05% 93 7076 0.06% 94 7563 0.06% 95 8069 0.06% 96 8426 0.07% 97 8686 0.07% 98 8937 0.07% 99 9130 0.07% 100 9778 0.08% 101 10403 0.08% 102 11075 0.09% 103 11598 0.09% 104 12208 0.09% 105 13016 0.10% 106 13696 0.11% 107 13843 0.11% 108 14250 0.11% 109 14574 0.11% 110 14678 0.11% 111 15317 0.12% 112 15907 0.12% 113 16599 0.13% 114 17292 0.13% 115 18173 0.14% 116 18687 0.15% 117 19081 0.15% 118 19501 0.15% 119 20074 0.16% 120 20783 0.16% 121 21511 0.17% 122 22227 0.17% 123 23585 0.18% 124 24517 0.19% 125 25758 0.20% 126 27277 0.21% 127 28007 0.22% 128 29698 0.23% 129 31092 0.24% 130 32990 0.26% 131 34878 0.27% 132 37613 0.29% 133 40124 0.31% 134 43389 0.34% 135 47264 0.37% 136 52000 0.40% 137 57668 0.45% 138 63391 0.49% 139 71961 0.56% 140 81941 0.64% 141 94224 0.73% 142 109773 0.85% 143 130396 1.01% 144 160550 1.25% 145 204039 1.59% 146 272739 2.12% 147 389299 3.03% 148 613564 4.77% 149 1183176 9.20% 150 3654429 28.43% 151 4791630 37.28% 12853869 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=49.34 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=24 prefix-density=0.89 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=12.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7170437 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:53:10 Started mapping on | Feb 12 19:53:10 Finished on | Feb 12 19:54:42 Mapping speed, Million of reads per hour | 502.98 Number of input reads | 12853869 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12033091 Uniquely mapped reads % | 93.61% Average mapped length | 293.27 Number of splices: Total | 11678972 Number of splices: Annotated (sjdb) | 11391668 Number of splices: GT/AG | 11464238 Number of splices: GC/AG | 172568 Number of splices: AT/AC | 7245 Number of splices: Non-canonical | 34921 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293312 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 15081 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 537860 537860 537860 N_multimapping 293312 293312 293312 N_noFeature 457297 11810232 532649 N_ambiguous 243627 925 95629 UnstrandedReadsAssigned:11332167 PositiveStrandReadsAssigned:221934 NegativeStrandReadsAssigned:11404813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170437-trimmed-pair1.fastq SRR7170437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,853,869 reads, 11,302,462 reads pseudoaligned [quant] estimated average fragment length: 275.994 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR7170437.ke.tsv 34699 SRR7170437.se.tsv 87100 total ==> SRR7170437.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.01 697 31.9915 Potri.005G024800.1.v4.1 1035 760.006 222 23.3688 Potri.004G059700.1.v4.1 961 686.038 12 1.39938 Potri.007G009000.2.v4.1 1416 1141.01 0 0 Potri.003G141000.2.v4.1 2943 2668.01 464.621 13.932 Potri.016G087400.1.v4.1 270 75.585 567.206 600.353 Potri.015G069301.1.v4.1 564 294.427 0 0 Potri.010G195200.1.v4.1 1773 1498.01 31 1.65558 Potri.012G127500.1.v4.1 977 702.033 204 23.2474 ==> SRR7170437.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 684 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170437 completed mapping pipeline successfully