Starting /dee2/code/volunteer_pipeline.sh SRR7170438 current disk space = 3051187535872 free memory = 986759348 SRR7170438 SRAfilesize 9a41b42621b6367be8a0934796e5d2ab SRR7170438.sra SRR7170438.sra file validated SRR7170438 is paired end SRR7170438 is conventional basespace SRR7170438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.11225 18.0 18.0 18.0 18.0 30.0 2 25.986 27.0 25.0 29.0 18.0 30.0 3 27.779 29.0 27.0 31.0 25.0 31.0 4 30.97125 31.0 30.0 33.0 29.0 33.0 5 32.26975 33.0 32.0 33.0 32.0 33.0 6 36.274 38.0 36.0 38.0 33.0 38.0 7 36.88925 38.0 37.0 38.0 35.0 38.0 8 37.2585 38.0 38.0 38.0 36.0 38.0 9 37.44775 38.0 38.0 38.0 37.0 38.0 10-14 37.5368 38.0 38.0 38.0 37.0 38.0 15-19 37.55555 38.0 38.0 38.0 37.2 38.0 20-24 37.656850000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.617 38.0 38.0 38.0 38.0 38.0 30-34 37.56695 38.0 38.0 38.0 38.0 38.0 35-39 37.541999999999994 38.0 38.0 38.0 37.6 38.0 40-44 37.4942 38.0 38.0 38.0 37.2 38.0 45-49 37.45285 38.0 38.0 38.0 37.0 38.0 50-54 37.27835 38.0 38.0 38.0 36.4 38.0 55-59 37.10545 38.0 38.0 38.0 36.0 38.0 60-64 37.0478 38.0 38.0 38.0 35.8 38.0 65-69 36.89135 38.0 38.0 38.0 35.2 38.0 70-74 36.8037 38.0 38.0 38.0 34.8 38.0 75-79 36.7669 38.0 38.0 38.0 34.8 38.0 80-84 36.5 38.0 37.8 38.0 34.0 38.0 85-89 36.3666 38.0 37.2 38.0 34.0 38.0 90-94 36.231399999999994 38.0 37.0 38.0 33.4 38.0 95-99 36.07665 38.0 37.0 38.0 32.6 38.0 100-104 35.4343 38.0 36.0 38.0 29.8 38.0 105-109 35.595600000000005 38.0 36.0 38.0 30.6 38.0 110-114 35.34035 38.0 35.8 38.0 29.8 38.0 115-119 34.93385 38.0 35.0 38.0 27.8 38.0 120-124 34.50775 38.0 34.8 38.0 26.2 38.0 125-129 34.18575 38.0 34.2 38.0 24.2 38.0 130-134 34.0892 38.0 34.2 38.0 24.0 38.0 135-139 33.173199999999994 37.8 32.8 38.0 18.6 38.0 140-144 32.439099999999996 36.4 31.6 38.0 14.4 38.0 145-149 30.5409 36.0 30.0 38.0 8.6 38.0 150-151 26.053375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.0 19 3.0 20 4.0 21 3.0 22 6.0 23 6.0 24 12.0 25 11.0 26 9.0 27 27.0 28 30.0 29 38.0 30 57.0 31 81.0 32 110.0 33 159.0 34 301.0 35 632.0 36 1441.0 37 1058.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.38632832729156 19.730709476954946 8.59658208182289 37.286380113930605 2 23.400000000000002 14.7 34.699999999999996 27.200000000000003 3 19.654913728432106 21.45536384096024 25.681420355088775 33.20830207551888 4 22.75 29.025000000000002 22.375 25.85 5 21.55 34.225 23.925 20.3 6 19.8 36.35 25.624999999999996 18.224999999999998 7 14.825 25.775 41.425 17.974999999999998 8 17.875 25.424999999999997 31.65 25.05 9 16.625 25.124999999999996 34.5 23.75 10-14 19.395 30.485 26.900000000000002 23.22 15-19 19.29 28.925 27.935 23.849999999999998 20-24 19.775000000000002 28.775000000000002 28.01 23.44 25-29 20.01 29.15 27.400000000000002 23.44 30-34 19.685 29.195 27.62 23.5 35-39 19.945 29.07 27.455000000000002 23.53 40-44 20.11 28.73 27.665 23.494999999999997 45-49 20.015 28.84 27.465 23.68 50-54 20.135 29.24 27.615000000000002 23.01 55-59 20.26 29.17 27.38 23.189999999999998 60-64 19.68 29.18 28.03 23.11 65-69 20.544999999999998 27.865000000000002 28.144999999999996 23.445 70-74 20.06 28.494999999999997 28.09 23.355 75-79 19.665983299164957 28.691434571728585 27.811390569528477 23.83119155957798 80-84 19.567935190278543 28.8593288993349 28.10921638245737 23.46351952792919 85-89 20.169999999999998 28.785 27.91 23.135 90-94 20.535 28.605000000000004 27.215 23.645 95-99 20.18 28.505000000000003 27.49 23.825 100-104 20.14 28.365000000000002 27.994999999999997 23.5 105-109 20.46 28.76 27.775 23.005 110-114 20.43 28.384999999999998 28.015 23.169999999999998 115-119 20.919999999999998 29.080000000000002 27.284999999999997 22.715 120-124 20.745 28.744999999999997 27.025 23.485 125-129 20.285 28.804999999999996 26.955000000000002 23.955000000000002 130-134 20.3 28.48 27.474999999999998 23.745 135-139 20.455000000000002 28.58 27.54 23.425 140-144 20.244999999999997 28.17 27.860000000000003 23.724999999999998 145-149 20.495 27.615000000000002 27.750000000000004 24.14 150-151 20.275000000000002 29.1875 27.3375 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 2.0 24 5.0 25 8.5 26 6.5 27 6.0 28 11.5 29 11.0 30 14.0 31 22.5 32 38.0 33 54.0 34 61.5 35 69.5 36 86.0 37 123.5 38 138.5 39 155.0 40 197.0 41 225.5 42 254.5 43 288.0 44 293.0 45 272.5 46 250.5 47 239.5 48 220.5 49 191.0 50 173.5 51 141.5 52 105.0 53 91.0 54 75.5 55 49.0 56 32.0 57 23.0 58 18.5 59 14.0 60 9.0 61 6.5 62 4.0 63 2.0 64 1.0 65 2.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.7125 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.175 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCTT 10 0.0068378756 144.95 6 CGAATCC 10 0.0068378756 144.95 3 >>END_MODULE SRR7170438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06225 33.0 33.0 34.0 32.0 34.0 2 33.19625 34.0 33.0 34.0 33.0 34.0 3 33.21325 34.0 33.0 34.0 33.0 34.0 4 33.2115 34.0 33.0 34.0 33.0 34.0 5 33.20825 34.0 33.0 34.0 33.0 34.0 6 37.349 38.0 38.0 38.0 38.0 38.0 7 37.36375 38.0 38.0 38.0 38.0 38.0 8 37.4075 38.0 38.0 38.0 38.0 38.0 9 37.411 38.0 38.0 38.0 38.0 38.0 10-14 37.355599999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.351749999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.33785 38.0 38.0 38.0 37.2 38.0 25-29 37.2733 38.0 38.0 38.0 37.0 38.0 30-34 37.21825 38.0 38.0 38.0 37.0 38.0 35-39 37.231100000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.2505 38.0 38.0 38.0 37.0 38.0 45-49 37.21525 38.0 38.0 38.0 37.0 38.0 50-54 37.12839999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.14829999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.11965 38.0 38.0 38.0 36.8 38.0 65-69 37.01845 38.0 38.0 38.0 36.2 38.0 70-74 36.96725 38.0 38.0 38.0 36.0 38.0 75-79 36.89545 38.0 38.0 38.0 36.0 38.0 80-84 36.7782 38.0 38.0 38.0 35.6 38.0 85-89 36.53805 38.0 38.0 38.0 35.0 38.0 90-94 36.429700000000004 38.0 37.8 38.0 34.2 38.0 95-99 36.2849 38.0 37.8 38.0 34.0 38.0 100-104 36.1671 38.0 37.8 38.0 33.6 38.0 105-109 36.08965 38.0 37.2 38.0 33.4 38.0 110-114 35.830349999999996 38.0 37.0 38.0 32.6 38.0 115-119 35.6129 38.0 36.6 38.0 31.4 38.0 120-124 35.3316 38.0 36.0 38.0 30.2 38.0 125-129 34.938900000000004 38.0 35.8 38.0 28.6 38.0 130-134 34.47760000000001 38.0 34.0 38.0 27.0 38.0 135-139 33.9567 38.0 33.0 38.0 24.2 38.0 140-144 33.157500000000006 38.0 33.0 38.0 20.2 38.0 145-149 32.01595 38.0 32.6 38.0 11.0 38.0 150-151 25.989125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 2.0 9 2.0 10 3.0 11 1.0 12 2.0 13 2.0 14 4.0 15 4.0 16 2.0 17 5.0 18 1.0 19 4.0 20 4.0 21 3.0 22 6.0 23 10.0 24 11.0 25 8.0 26 9.0 27 20.0 28 20.0 29 38.0 30 51.0 31 50.0 32 66.0 33 86.0 34 157.0 35 355.0 36 909.0 37 2152.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.98398398398398 19.16916916916917 16.666666666666664 30.180180180180184 2 25.95095095095095 25.650650650650654 31.73173173173173 16.666666666666664 3 19.61961961961962 27.852852852852855 30.98098098098098 21.546546546546548 4 22.503128911138923 33.29161451814768 24.130162703379224 20.075093867334168 5 24.705882352941178 35.794743429286605 21.777221526908637 17.72215269086358 6 19.289467100325243 37.90342757067801 24.0180135101326 18.789091818864147 7 19.4048512128032 20.80520130032508 40.060015003750934 19.72993248312078 8 21.935967983991997 24.937468734367183 28.53926963481741 24.58729364682341 9 22.71135567783892 24.662331165582792 29.71485742871436 22.911455727863935 10-14 23.105018261870217 29.143943563316157 26.39715815279932 21.35388002201431 15-19 22.276707530647986 27.995996997748314 28.516387290467847 21.210908181135853 20-24 22.863290632506008 28.18755004003203 27.692153722978386 21.257005604483588 25-29 23.15083575217696 27.995195676108498 27.865078570713642 20.9888900010009 30-34 22.083187346714052 28.484909154612343 28.264677911807397 21.16722558686621 35-39 22.37072633528558 28.582870300845975 27.721880162186512 21.324523201681934 40-44 22.774358204473803 28.34909673222239 27.608467197117548 21.268077866186257 45-49 22.842131598699027 27.76582436827621 28.401300975731797 20.99074305729297 50-54 22.293949857378774 27.65350547965771 28.33408397137567 21.71846069158785 55-59 22.87215411558669 27.50562922191644 28.416312234175635 21.20590442832124 60-64 22.747060295221416 27.800850637978485 28.261195896922693 21.19089316987741 65-69 23.472298683749564 27.120764726490165 28.18677743856664 21.220159151193634 70-74 23.010311342476726 28.326158774652114 27.60536590249274 21.058163980378417 75-79 22.911348050257796 27.371477198778592 28.898232967913103 20.81894178305051 80-84 22.534294582957845 27.896265144688094 28.366876940022028 21.20256333233203 85-89 23.33149752165423 28.40334451509538 27.12662093826666 21.138537024983727 90-94 23.425453089015722 28.28176629618504 27.520777010113147 20.77200360468609 95-99 23.32832832832833 28.02802802802803 28.193193193193196 20.45045045045045 100-104 23.6986986986987 28.263263263263262 27.13213213213213 20.905905905905904 105-109 23.401060954859375 28.16534881393254 28.19037133420078 20.243218897007306 110-114 24.07027378747685 28.364783022173285 27.17353220881926 20.39141098153061 115-119 23.895089844336553 27.55393162820962 28.23464637869763 20.316332148756196 120-124 24.030037546933666 27.739674593241553 27.579474342928663 20.650813516896118 125-129 24.15139681586062 28.15159707619906 27.1252628416942 20.57174326624612 130-134 24.367896660491663 27.64231712812297 27.867621288739798 20.12216492264557 135-139 23.84838774283998 27.95914279991989 27.19807730823152 20.99439214900861 140-144 23.71201121514044 27.82756721574125 28.052871376358084 20.407550192760226 145-149 23.961149494342646 27.826174026234103 27.8361870431561 20.376489436267146 150-151 23.16066066066066 28.428428428428425 27.3023023023023 21.10860860860861 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 1.0 22 2.0 23 3.0 24 3.0 25 1.5 26 3.5 27 6.5 28 10.0 29 12.0 30 12.5 31 13.5 32 22.0 33 37.0 34 47.5 35 66.0 36 85.5 37 117.0 38 145.0 39 170.5 40 210.0 41 227.5 42 244.0 43 272.0 44 290.5 45 272.0 46 244.5 47 244.5 48 229.5 49 199.0 50 166.5 51 137.5 52 119.0 53 90.0 54 80.0 55 65.0 56 40.5 57 31.0 58 16.5 59 14.5 60 13.0 61 6.5 62 5.5 63 5.0 64 3.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.125 5 0.125 6 0.075 7 0.025 8 0.05 9 0.05 10-14 0.065 15-19 0.075 20-24 0.08 25-29 0.09 30-34 0.105 35-39 0.11499999999999999 40-44 0.08499999999999999 45-49 0.075 50-54 0.08499999999999999 55-59 0.075 60-64 0.075 65-69 0.095 70-74 0.11 75-79 0.11499999999999999 80-84 0.13 85-89 0.135 90-94 0.13 95-99 0.1 100-104 0.1 105-109 0.09 110-114 0.105 115-119 0.105 120-124 0.125 125-129 0.13 130-134 0.135 135-139 0.13999999999999999 140-144 0.135 145-149 0.13 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra Read 718433 spots for SRR7170438.sra Written 718433 spots for SRR7170438.sra Read 718429 spots for SRR7170438.sra Written 718429 spots for SRR7170438.sra SRR ids: ['SRR7170438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fov5h8ac SRR7170438.sra spots: 14368584 blocks: [[1, 718429], [718430, 1436858], [1436859, 2155287], [2155288, 2873716], [2873717, 3592145], [3592146, 4310574], [4310575, 5029003], [5029004, 5747432], [5747433, 6465861], [6465862, 7184290], [7184291, 7902719], [7902720, 8621148], [8621149, 9339577], [9339578, 10058006], [10058007, 10776435], [10776436, 11494864], [11494865, 12213293], [12213294, 12931722], [12931723, 13650151], [13650152, 14368584]] SRR7170438 file size 4847341 SRR7170438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170438 SRR7170438_1.fastq SRR7170438_2.fastq Input file: SRR7170438_1.fastq Paired file: SRR7170438_2.fastq trimmed: SRR7170438-trimmed-pair1.fastq, SRR7170438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:01:45 2025 >> started Wed Feb 12 19:02:03 2025 >> done (18.543s) 14368584 read pairs processed; of these: 16948 ( 0.12%) short read pairs filtered out after trimming by size control 21863 ( 0.15%) empty read pairs filtered out after trimming by size control 14329773 (99.73%) read pairs available; of these: 9139742 (63.78%) trimmed read pairs available after processing 5190031 (36.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 3 0.00% 21 1 0.00% 22 6 0.00% 23 5 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 2 0.00% 32 9 0.00% 33 4 0.00% 34 10 0.00% 35 12 0.00% 36 6 0.00% 37 16 0.00% 38 16 0.00% 39 23 0.00% 40 19 0.00% 41 20 0.00% 42 28 0.00% 43 22 0.00% 44 30 0.00% 45 40 0.00% 46 51 0.00% 47 49 0.00% 48 51 0.00% 49 84 0.00% 50 65 0.00% 51 116 0.00% 52 137 0.00% 53 121 0.00% 54 156 0.00% 55 129 0.00% 56 187 0.00% 57 186 0.00% 58 225 0.00% 59 249 0.00% 60 328 0.00% 61 369 0.00% 62 377 0.00% 63 503 0.00% 64 454 0.00% 65 536 0.00% 66 530 0.00% 67 677 0.00% 68 756 0.01% 69 809 0.01% 70 947 0.01% 71 1097 0.01% 72 1188 0.01% 73 1446 0.01% 74 1551 0.01% 75 1784 0.01% 76 1996 0.01% 77 2108 0.01% 78 2236 0.02% 79 2427 0.02% 80 2761 0.02% 81 3223 0.02% 82 3668 0.03% 83 4252 0.03% 84 5159 0.04% 85 5633 0.04% 86 5769 0.04% 87 5914 0.04% 88 5998 0.04% 89 6500 0.05% 90 6735 0.05% 91 7343 0.05% 92 8048 0.06% 93 8683 0.06% 94 9261 0.06% 95 10073 0.07% 96 10322 0.07% 97 10608 0.07% 98 11033 0.08% 99 11450 0.08% 100 12253 0.09% 101 12651 0.09% 102 13468 0.09% 103 14369 0.10% 104 14718 0.10% 105 15466 0.11% 106 16301 0.11% 107 16782 0.12% 108 16913 0.12% 109 17421 0.12% 110 17419 0.12% 111 18017 0.13% 112 18355 0.13% 113 19198 0.13% 114 20255 0.14% 115 20962 0.15% 116 21951 0.15% 117 22435 0.16% 118 22825 0.16% 119 23058 0.16% 120 23944 0.17% 121 24890 0.17% 122 25739 0.18% 123 27102 0.19% 124 28482 0.20% 125 29364 0.20% 126 31135 0.22% 127 32559 0.23% 128 34223 0.24% 129 35894 0.25% 130 37527 0.26% 131 39892 0.28% 132 42669 0.30% 133 46712 0.33% 134 49843 0.35% 135 54726 0.38% 136 60051 0.42% 137 66740 0.47% 138 74205 0.52% 139 83285 0.58% 140 94769 0.66% 141 109500 0.76% 142 127469 0.89% 143 152298 1.06% 144 185717 1.30% 145 237785 1.66% 146 314753 2.20% 147 449724 3.14% 148 706344 4.93% 149 1348653 9.41% 150 4042276 28.21% 151 5190031 36.22% 14329773 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=302.61 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=19 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=40.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170438 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:02:51 Started mapping on | Feb 12 19:02:52 Finished on | Feb 12 19:04:38 Mapping speed, Million of reads per hour | 486.67 Number of input reads | 14329773 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13632110 Uniquely mapped reads % | 95.13% Average mapped length | 292.98 Number of splices: Total | 13581279 Number of splices: Annotated (sjdb) | 13296805 Number of splices: GT/AG | 13327157 Number of splices: GC/AG | 213819 Number of splices: AT/AC | 7596 Number of splices: Non-canonical | 32707 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348528 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 41486 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 359704 359704 359704 N_multimapping 348528 348528 348528 N_noFeature 477521 13406831 545309 N_ambiguous 256751 658 98970 UnstrandedReadsAssigned:12897838 PositiveStrandReadsAssigned:224621 NegativeStrandReadsAssigned:12987831 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170438-trimmed-pair1.fastq SRR7170438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,329,773 reads, 12,920,903 reads pseudoaligned [quant] estimated average fragment length: 277.023 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR7170438.ke.tsv 34699 SRR7170438.se.tsv 87100 total ==> SRR7170438.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.98 506 21.1793 Potri.005G024800.1.v4.1 1035 758.977 107 10.2792 Potri.004G059700.1.v4.1 961 684.977 10 1.06445 Potri.007G009000.2.v4.1 1416 1139.98 0 0 Potri.003G141000.2.v4.1 2943 2666.98 428 11.7011 Potri.016G087400.1.v4.1 270 77.6166 580.136 544.978 Potri.015G069301.1.v4.1 564 293.584 0 0 Potri.010G195200.1.v4.1 1773 1496.98 18 0.87672 Potri.012G127500.1.v4.1 977 700.977 168 17.4747 ==> SRR7170438.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 878 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 45 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR7170438 completed mapping pipeline successfully