Starting /dee2/code/volunteer_pipeline.sh SRR7170439 current disk space = 3051012001792 free memory = 1539944976 SRR7170439 SRAfilesize 44a72e113d8daf07e1f7fdac0c3615a4 SRR7170439.sra SRR7170439.sra file validated SRR7170439 is paired end SRR7170439 is conventional basespace SRR7170439 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.3645 18.0 18.0 18.0 18.0 32.0 2 27.5115 27.0 27.0 29.0 25.0 30.0 3 29.218 29.0 29.0 31.0 27.0 33.0 4 31.7545 33.0 31.0 33.0 29.0 33.0 5 32.51175 33.0 33.0 33.0 32.0 33.0 6 36.586 38.0 37.0 38.0 34.0 38.0 7 37.175 38.0 38.0 38.0 36.0 38.0 8 37.43825 38.0 38.0 38.0 37.0 38.0 9 37.505 38.0 38.0 38.0 37.0 38.0 10-14 37.5957 38.0 38.0 38.0 37.8 38.0 15-19 37.60095 38.0 38.0 38.0 37.8 38.0 20-24 37.452 38.0 38.0 38.0 37.4 38.0 25-29 37.0928 38.0 38.0 38.0 36.0 38.0 30-34 37.49075 38.0 38.0 38.0 37.2 38.0 35-39 37.560649999999995 38.0 38.0 38.0 37.6 38.0 40-44 36.91685 38.0 37.8 38.0 34.8 38.0 45-49 34.762299999999996 37.8 34.4 38.0 25.4 38.0 50-54 37.20505 38.0 37.8 38.0 36.4 38.0 55-59 37.3367 38.0 38.0 38.0 36.8 38.0 60-64 37.2014 38.0 38.0 38.0 36.2 38.0 65-69 37.1689 38.0 38.0 38.0 36.0 38.0 70-74 37.08875 38.0 38.0 38.0 36.0 38.0 75-79 36.964600000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.8573 38.0 38.0 38.0 35.2 38.0 85-89 36.6454 38.0 38.0 38.0 34.4 38.0 90-94 36.448699999999995 38.0 37.6 38.0 34.0 38.0 95-99 36.556400000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.488299999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.393600000000006 38.0 37.4 38.0 34.0 38.0 110-114 35.90644999999999 38.0 36.8 38.0 32.2 38.0 115-119 35.55395 38.0 36.4 38.0 30.6 38.0 120-124 35.494299999999996 38.0 36.0 38.0 30.6 38.0 125-129 35.332499999999996 38.0 36.0 38.0 30.2 38.0 130-134 35.0509 38.0 35.2 38.0 29.2 38.0 135-139 34.2922 38.0 33.8 38.0 25.6 38.0 140-144 28.860599999999998 33.4 23.4 37.0 13.2 38.0 145-149 26.0851 32.4 13.4 37.6 2.0 38.0 150-151 16.020125 7.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 6.0 20 4.0 21 2.0 22 1.0 23 4.0 24 5.0 25 13.0 26 21.0 27 15.0 28 22.0 29 40.0 30 58.0 31 78.0 32 115.0 33 218.0 34 385.0 35 785.0 36 1599.0 37 618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.300459887583035 42.71844660194174 8.58456821665815 32.39652529381707 2 21.7 15.049999999999999 34.1 29.15 3 19.475 19.75 25.374999999999996 35.4 4 23.150000000000002 26.900000000000002 23.125 26.825 5 22.6 32.0 24.55 20.849999999999998 6 18.525 36.225 24.75 20.5 7 14.725 25.474999999999998 42.35 17.45 8 17.375 25.674999999999997 31.974999999999998 24.975 9 18.025 24.6 33.300000000000004 24.075 10-14 19.8 30.15 27.36 22.689999999999998 15-19 20.135 28.175 27.655 24.035 20-24 19.99 29.375 27.165 23.47 25-29 20.44 29.04 27.04 23.48 30-34 19.655 28.73 27.884999999999998 23.73 35-39 20.349999999999998 28.68 27.35 23.62 40-44 20.724999999999998 28.835 26.855 23.585 45-49 20.01 28.375 27.54 24.075 50-54 19.81 29.015 27.22 23.955000000000002 55-59 20.669999999999998 28.525 27.150000000000002 23.655 60-64 20.005 28.845 27.13 24.02 65-69 20.330000000000002 28.439999999999998 27.889999999999997 23.34 70-74 20.266013300665033 27.92139606980349 27.60638031901595 24.206210310515523 75-79 20.03 28.560000000000002 27.63 23.78 80-84 20.51 27.939999999999998 27.639999999999997 23.91 85-89 20.87 27.884999999999998 27.235 24.01 90-94 20.67706770677068 27.787778777877786 27.807780778077806 23.72737273727373 95-99 20.29101455072754 27.92139606980349 27.681384069203457 24.106205310265512 100-104 20.775 27.79 27.634999999999998 23.799999999999997 105-109 21.395 28.15 27.029999999999998 23.425 110-114 21.39 27.82 27.275 23.515 115-119 20.95 27.785 27.18 24.085 120-124 20.825 27.765 27.425 23.985 125-129 20.580000000000002 27.755000000000003 27.065 24.6 130-134 21.27 27.794999999999998 26.815 24.12 135-139 21.755 27.52 26.71 24.015 140-144 21.224999999999998 27.01 27.04 24.725 145-149 21.145 27.425 27.265 24.165 150-151 21.3 27.950000000000003 26.575 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 4.5 25 4.5 26 3.5 27 4.0 28 6.5 29 10.5 30 16.5 31 28.5 32 38.0 33 42.5 34 53.5 35 82.5 36 108.5 37 119.0 38 130.0 39 154.0 40 184.5 41 215.0 42 228.0 43 250.5 44 263.5 45 248.0 46 268.0 47 262.5 48 226.0 49 205.5 50 181.0 51 140.5 52 123.5 53 110.0 54 75.0 55 59.0 56 49.5 57 30.0 58 18.0 59 20.0 60 14.0 61 5.5 62 2.5 63 2.0 64 2.0 65 2.5 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.0374999999999996 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 4.987500000000001 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170439 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1145 33.0 33.0 34.0 32.0 34.0 2 33.209 34.0 33.0 34.0 33.0 34.0 3 33.22275 34.0 33.0 34.0 33.0 34.0 4 33.1525 34.0 33.0 34.0 33.0 34.0 5 33.19825 34.0 33.0 34.0 33.0 34.0 6 37.34075 38.0 38.0 38.0 37.0 38.0 7 37.4705 38.0 38.0 38.0 37.0 38.0 8 37.4515 38.0 38.0 38.0 37.0 38.0 9 37.5025 38.0 38.0 38.0 38.0 38.0 10-14 36.5835 38.0 36.2 38.0 33.6 38.0 15-19 36.9761 38.0 37.6 38.0 35.4 38.0 20-24 36.9618 38.0 38.0 38.0 36.0 38.0 25-29 37.0215 38.0 38.0 38.0 36.0 38.0 30-34 37.3309 38.0 38.0 38.0 37.0 38.0 35-39 37.3029 38.0 38.0 38.0 37.0 38.0 40-44 37.3554 38.0 38.0 38.0 37.0 38.0 45-49 36.157349999999994 38.0 36.0 38.0 31.4 38.0 50-54 36.25105 38.0 37.2 38.0 30.4 38.0 55-59 37.2685 38.0 38.0 38.0 37.0 38.0 60-64 37.147400000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.023450000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.042649999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.0831 38.0 38.0 38.0 36.0 38.0 80-84 36.918600000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.87155 38.0 38.0 38.0 35.4 38.0 90-94 36.79685 38.0 38.0 38.0 35.2 38.0 95-99 36.6649 38.0 38.0 38.0 34.6 38.0 100-104 36.36445 38.0 37.8 38.0 33.8 38.0 105-109 36.2636 38.0 37.6 38.0 34.0 38.0 110-114 36.26765 38.0 37.8 38.0 34.0 38.0 115-119 36.0141 38.0 37.0 38.0 33.0 38.0 120-124 35.5613 38.0 36.6 38.0 30.4 38.0 125-129 34.99399999999999 38.0 35.8 38.0 28.0 38.0 130-134 34.9486 38.0 35.2 38.0 29.0 38.0 135-139 34.31269999999999 38.0 33.6 38.0 26.2 38.0 140-144 33.4866 38.0 33.0 38.0 22.0 38.0 145-149 32.51865 38.0 33.0 38.0 12.4 38.0 150-151 26.38275 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 2.0 15 2.0 16 0.0 17 3.0 18 5.0 19 9.0 20 6.0 21 5.0 22 9.0 23 9.0 24 9.0 25 7.0 26 13.0 27 17.0 28 26.0 29 33.0 30 42.0 31 64.0 32 81.0 33 133.0 34 168.0 35 369.0 36 889.0 37 2095.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.949999999999996 20.025000000000002 15.1 29.925 2 26.325 26.450000000000003 29.349999999999998 17.875 3 20.875 29.65 30.099999999999998 19.375 4 23.825 35.05 22.0 19.125 5 24.25 35.425000000000004 22.475 17.849999999999998 6 21.675 37.85 22.8 17.675 7 20.175 21.7 37.875 20.25 8 21.099999999999998 25.45 27.800000000000004 25.650000000000002 9 20.724999999999998 25.474999999999998 29.45 24.349999999999998 10-14 23.865 29.145 25.285000000000004 21.705 15-19 23.59 28.33 26.779999999999998 21.3 20-24 23.415 28.15 27.529999999999998 20.905 25-29 24.15 28.505000000000003 26.779999999999998 20.565 30-34 23.485 28.255000000000003 27.015 21.245 35-39 22.735 27.650000000000002 27.93 21.685 40-44 23.05 28.265 27.6 21.085 45-49 23.615 27.52 27.565 21.3 50-54 23.225 28.115000000000002 27.345000000000002 21.315 55-59 23.674999999999997 27.66 27.145000000000003 21.52 60-64 23.34 26.950000000000003 27.939999999999998 21.77 65-69 23.330000000000002 27.339999999999996 27.435 21.895 70-74 24.08 27.700000000000003 27.005000000000003 21.215 75-79 23.285 27.685 27.425 21.605 80-84 23.455000000000002 27.905 27.084999999999997 21.555 85-89 23.445 27.98 27.015 21.560000000000002 90-94 24.01 27.87 26.345000000000002 21.775 95-99 23.69 28.155 27.384999999999998 20.77 100-104 24.21 27.37 27.26 21.16 105-109 23.94 27.884999999999998 26.974999999999998 21.2 110-114 23.845 28.035 27.474999999999998 20.645 115-119 24.0 27.71 27.295 20.995 120-124 24.375 28.095 26.965 20.565 125-129 24.605 27.994999999999997 27.245 20.155 130-134 24.58 27.525 26.935 20.96 135-139 24.38 27.46 26.595000000000002 21.565 140-144 24.615000000000002 27.345000000000002 27.375 20.665 145-149 24.995 27.185 27.235 20.585 150-151 25.387500000000003 27.775 26.875 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 2.5 26 3.0 27 1.0 28 3.0 29 7.5 30 10.0 31 15.0 32 18.5 33 27.5 34 38.0 35 46.0 36 69.0 37 96.5 38 126.0 39 146.5 40 167.0 41 202.5 42 242.0 43 262.0 44 261.5 45 274.0 46 279.5 47 266.5 48 237.0 49 222.5 50 206.0 51 166.5 52 137.5 53 110.5 54 96.0 55 74.5 56 49.0 57 41.0 58 28.5 59 15.0 60 11.5 61 9.5 62 10.5 63 8.0 64 2.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7330637007077857 1.4500000000000002 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.4124999999999996 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.137499999999999 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTCT 10 0.006830828 145.0 4 >>END_MODULE Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804574 spots for SRR7170439.sra Written 804574 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra Read 804560 spots for SRR7170439.sra Written 804560 spots for SRR7170439.sra SRR ids: ['SRR7170439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ekhxqnm6 SRR7170439.sra spots: 16091214 blocks: [[1, 804560], [804561, 1609120], [1609121, 2413680], [2413681, 3218240], [3218241, 4022800], [4022801, 4827360], [4827361, 5631920], [5631921, 6436480], [6436481, 7241040], [7241041, 8045600], [8045601, 8850160], [8850161, 9654720], [9654721, 10459280], [10459281, 11263840], [11263841, 12068400], [12068401, 12872960], [12872961, 13677520], [13677521, 14482080], [14482081, 15286640], [15286641, 16091214]] SRR7170439 file size 5431084 SRR7170439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170439 SRR7170439_1.fastq SRR7170439_2.fastq Input file: SRR7170439_1.fastq Paired file: SRR7170439_2.fastq trimmed: SRR7170439-trimmed-pair1.fastq, SRR7170439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:38:22 2025 >> started Wed Feb 12 19:38:47 2025 >> done (25.515s) 16091214 read pairs processed; of these: 10890 ( 0.07%) short read pairs filtered out after trimming by size control 15079 ( 0.09%) empty read pairs filtered out after trimming by size control 16065245 (99.84%) read pairs available; of these: 8968240 (55.82%) trimmed read pairs available after processing 7097005 (44.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 7 0.00% 21 6 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 5 0.00% 26 4 0.00% 27 7 0.00% 28 1 0.00% 29 2 0.00% 30 9 0.00% 31 10 0.00% 32 5 0.00% 33 6 0.00% 34 5 0.00% 35 10 0.00% 36 9 0.00% 37 13 0.00% 38 7 0.00% 39 14 0.00% 40 19 0.00% 41 24 0.00% 42 31 0.00% 43 42 0.00% 44 42 0.00% 45 39 0.00% 46 42 0.00% 47 44 0.00% 48 40 0.00% 49 72 0.00% 50 101 0.00% 51 118 0.00% 52 112 0.00% 53 130 0.00% 54 127 0.00% 55 159 0.00% 56 169 0.00% 57 183 0.00% 58 201 0.00% 59 262 0.00% 60 353 0.00% 61 368 0.00% 62 438 0.00% 63 457 0.00% 64 543 0.00% 65 587 0.00% 66 609 0.00% 67 658 0.00% 68 834 0.01% 69 865 0.01% 70 1030 0.01% 71 1186 0.01% 72 1395 0.01% 73 1584 0.01% 74 1727 0.01% 75 2049 0.01% 76 2514 0.02% 77 2566 0.02% 78 2453 0.02% 79 2758 0.02% 80 3167 0.02% 81 3533 0.02% 82 3882 0.02% 83 4438 0.03% 84 5148 0.03% 85 6005 0.04% 86 6327 0.04% 87 6550 0.04% 88 7184 0.04% 89 7446 0.05% 90 7940 0.05% 91 8665 0.05% 92 9086 0.06% 93 9829 0.06% 94 10580 0.07% 95 11279 0.07% 96 11905 0.07% 97 12194 0.08% 98 12631 0.08% 99 12737 0.08% 100 13818 0.09% 101 14150 0.09% 102 14799 0.09% 103 15575 0.10% 104 16479 0.10% 105 16982 0.11% 106 17663 0.11% 107 18315 0.11% 108 18539 0.12% 109 19345 0.12% 110 19546 0.12% 111 20138 0.13% 112 20559 0.13% 113 21547 0.13% 114 21847 0.14% 115 23044 0.14% 116 23733 0.15% 117 24603 0.15% 118 24813 0.15% 119 25298 0.16% 120 25920 0.16% 121 26352 0.16% 122 27434 0.17% 123 28546 0.18% 124 29786 0.19% 125 30646 0.19% 126 32426 0.20% 127 34256 0.21% 128 35273 0.22% 129 36352 0.23% 130 38286 0.24% 131 39954 0.25% 132 42300 0.26% 133 44723 0.28% 134 47893 0.30% 135 51628 0.32% 136 55488 0.35% 137 60972 0.38% 138 66286 0.41% 139 73410 0.46% 140 81617 0.51% 141 92621 0.58% 142 106515 0.66% 143 125758 0.78% 144 154142 0.96% 145 193129 1.20% 146 252484 1.57% 147 358508 2.23% 148 572935 3.57% 149 1148150 7.15% 150 4476069 27.86% 151 7097005 44.18% 16065245 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=26 prefix-density=0.93 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=63.71 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=29 prefix-density=0.75 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=47.55 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR7170439 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:39:28 Started mapping on | Feb 12 19:39:28 Finished on | Feb 12 19:40:59 Mapping speed, Million of reads per hour | 635.55 Number of input reads | 16065245 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15231179 Uniquely mapped reads % | 94.81% Average mapped length | 293.90 Number of splices: Total | 14653698 Number of splices: Annotated (sjdb) | 14358711 Number of splices: GT/AG | 14351506 Number of splices: GC/AG | 259982 Number of splices: AT/AC | 8538 Number of splices: Non-canonical | 33672 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446722 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 37641 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397013 397013 397013 N_multimapping 446722 446722 446722 N_noFeature 362826 14998248 438323 N_ambiguous 278587 1103 120473 UnstrandedReadsAssigned:14589766 PositiveStrandReadsAssigned:231828 NegativeStrandReadsAssigned:14672383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170439-trimmed-pair1.fastq SRR7170439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,065,245 reads, 14,745,699 reads pseudoaligned [quant] estimated average fragment length: 271.758 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7170439.ke.tsv 34699 SRR7170439.se.tsv 87100 total ==> SRR7170439.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.24 303 10.5728 Potri.005G024800.1.v4.1 1035 764.242 183 14.5989 Potri.004G059700.1.v4.1 961 690.262 11 0.971583 Potri.007G009000.2.v4.1 1416 1145.24 0 0 Potri.003G141000.2.v4.1 2943 2672.24 314 7.16399 Potri.016G087400.1.v4.1 270 76.3791 577 460.578 Potri.015G069301.1.v4.1 564 298.914 0 0 Potri.010G195200.1.v4.1 1773 1502.24 2 0.0811692 Potri.012G127500.1.v4.1 977 706.252 333 28.7466 ==> SRR7170439.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 295 Potri.001G212900.v4.1 63 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170439 completed mapping pipeline successfully