Starting /dee2/code/volunteer_pipeline.sh SRR7170440 current disk space = 3051144683520 free memory = 1459480496 SRR7170440 SRAfilesize d1b3394006d9e54d3cd600fc1850024e SRR7170440.sra SRR7170440.sra file validated SRR7170440 is paired end SRR7170440 is conventional basespace SRR7170440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.79375 18.0 18.0 18.0 18.0 32.0 2 27.377 27.0 27.0 30.0 18.0 31.0 3 29.277 30.0 29.0 31.0 25.0 33.0 4 31.7915 33.0 31.0 33.0 29.0 33.0 5 32.31925 33.0 33.0 33.0 31.0 34.0 6 36.747 38.0 37.0 38.0 34.0 38.0 7 37.2835 38.0 38.0 38.0 36.0 38.0 8 37.46075 38.0 38.0 38.0 37.0 38.0 9 37.584 38.0 38.0 38.0 37.0 38.0 10-14 37.54225 38.0 38.0 38.0 37.4 38.0 15-19 37.5884 38.0 38.0 38.0 38.0 38.0 20-24 37.6001 38.0 38.0 38.0 38.0 38.0 25-29 37.538349999999994 38.0 38.0 38.0 37.8 38.0 30-34 37.55175 38.0 38.0 38.0 38.0 38.0 35-39 37.4932 38.0 38.0 38.0 37.4 38.0 40-44 36.8795 38.0 37.6 38.0 33.0 38.0 45-49 36.43555 38.0 37.2 38.0 31.0 38.0 50-54 37.182249999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.260450000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.24355 38.0 38.0 38.0 36.4 38.0 65-69 37.1776 38.0 38.0 38.0 36.0 38.0 70-74 37.02465 38.0 38.0 38.0 35.8 38.0 75-79 36.902499999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.947649999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.59965 38.0 37.8 38.0 34.4 38.0 90-94 36.412150000000004 38.0 37.6 38.0 34.0 38.0 95-99 36.42215 38.0 38.0 38.0 34.0 38.0 100-104 36.451350000000005 38.0 37.2 38.0 34.0 38.0 105-109 36.3295 38.0 37.0 38.0 33.8 38.0 110-114 36.11555 38.0 37.0 38.0 33.0 38.0 115-119 35.6536 38.0 36.0 38.0 31.0 38.0 120-124 35.667500000000004 38.0 36.0 38.0 30.6 38.0 125-129 35.441 38.0 35.8 38.0 30.4 38.0 130-134 35.10979999999999 38.0 35.2 38.0 28.4 38.0 135-139 34.755250000000004 38.0 34.8 38.0 27.8 38.0 140-144 34.009100000000004 38.0 33.8 38.0 24.0 38.0 145-149 33.19355 38.0 33.0 38.0 20.2 38.0 150-151 27.373375 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 4.0 22 1.0 23 6.0 24 9.0 25 10.0 26 12.0 27 16.0 28 12.0 29 32.0 30 43.0 31 54.0 32 75.0 33 139.0 34 213.0 35 429.0 36 1195.0 37 1739.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.373899533920245 20.041429311237703 7.483169342309684 34.10150181253236 2 22.5 14.374999999999998 34.75 28.375 3 18.775 21.175 27.175 32.875 4 23.825 29.375 23.35 23.45 5 22.6 34.25 23.825 19.325 6 18.224999999999998 35.35 26.125 20.3 7 14.6 25.124999999999996 43.575 16.7 8 17.849999999999998 25.1 31.4 25.650000000000002 9 17.299999999999997 24.5 33.625 24.575 10-14 19.915 30.044999999999998 26.99 23.05 15-19 19.67 28.854999999999997 27.685 23.79 20-24 19.580000000000002 29.304999999999996 27.815 23.3 25-29 20.205000000000002 29.085 27.62 23.09 30-34 20.4 28.38 27.555000000000003 23.665 35-39 19.27 28.525 28.04 24.165 40-44 20.1180177026554 29.00435065259789 27.379106866029908 23.49852477871681 45-49 20.29 29.075 27.045 23.59 50-54 20.150000000000002 29.270000000000003 27.525 23.055 55-59 20.235 28.945 27.37 23.45 60-64 19.650000000000002 29.025000000000002 27.235 24.09 65-69 20.18 28.71 27.925 23.185 70-74 19.98 28.744999999999997 27.77 23.505000000000003 75-79 20.135 28.27 28.035 23.56 80-84 19.62 28.455000000000002 28.03 23.895 85-89 20.599999999999998 28.37 27.345000000000002 23.685000000000002 90-94 20.77207720772077 29.022902290229023 26.972697269726975 23.232323232323232 95-99 20.44 29.404999999999998 27.04 23.115 100-104 20.419999999999998 28.715000000000003 27.68 23.185 105-109 20.785 28.415000000000003 27.375 23.425 110-114 20.419999999999998 28.835 27.405 23.34 115-119 20.505000000000003 28.615000000000002 27.255000000000003 23.625 120-124 20.380000000000003 28.689999999999998 27.26 23.669999999999998 125-129 20.575 28.365000000000002 27.650000000000002 23.41 130-134 20.544999999999998 28.115000000000002 27.950000000000003 23.39 135-139 20.605 28.110000000000003 27.275 24.01 140-144 21.095 28.87 26.955000000000002 23.080000000000002 145-149 20.885 29.044999999999998 27.005000000000003 23.064999999999998 150-151 21.2625 28.325 27.1 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 3.5 26 5.5 27 9.0 28 11.0 29 16.5 30 23.0 31 26.0 32 31.0 33 52.0 34 66.5 35 74.0 36 95.0 37 112.5 38 145.5 39 166.0 40 172.0 41 206.5 42 241.0 43 267.5 44 269.5 45 274.0 46 257.0 47 236.5 48 239.0 49 210.5 50 181.5 51 141.5 52 108.0 53 88.5 54 71.0 55 55.5 56 41.5 57 32.0 58 21.0 59 14.5 60 10.5 61 5.5 62 3.5 63 2.0 64 0.0 65 0.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0125 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0125 0.0 0.0 0.025 0.0 70-71 0.037500000000000006 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.0625 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.0875 0.0 0.0 0.025 0.0 80-81 0.1125 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.1875 0.0 0.0 0.025 0.0 86-87 0.225 0.0 0.0 0.025 0.0 88-89 0.2625 0.0 0.0 0.025 0.0 90-91 0.3375 0.0 0.0 0.025 0.0 92-93 0.45 0.0 0.0 0.025 0.0 94-95 0.525 0.0 0.0 0.025 0.0 96-97 0.6875 0.0 0.0 0.025 0.0 98-99 0.8374999999999999 0.0 0.0 0.025 0.0 100-101 0.975 0.0 0.0 0.025 0.0 102-103 1.0 0.0 0.0 0.025 0.0 104-105 1.1125 0.0 0.0 0.025 0.0 106-107 1.375 0.0 0.0 0.025 0.0 108-109 1.675 0.0 0.0 0.025 0.0 110-111 1.7875 0.0 0.0 0.025 0.0 112-113 1.9375 0.0 0.0 0.025 0.0 114-115 2.1625 0.0 0.0 0.025 0.0 116-117 2.375 0.0 0.0 0.025 0.0 118-119 2.4124999999999996 0.0 0.0 0.025 0.0 120-121 2.55 0.0 0.0 0.025 0.0 122-123 2.7875 0.0 0.0 0.025 0.0 124-125 3.0375 0.0 0.0 0.025 0.0 126-127 3.1625 0.0 0.0 0.025 0.0 128-129 3.325 0.0 0.0 0.025 0.0 130-131 3.5250000000000004 0.0 0.0 0.025 0.0 132-133 3.725 0.0 0.0 0.025 0.0 134-135 4.0375 0.0 0.0 0.025 0.0 136-137 4.3125 0.0 0.0 0.025 0.0 138-139 4.6 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGCG 10 0.0068343505 144.975 5 GATTGGC 10 0.0068343505 144.975 4 >>END_MODULE SRR7170440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.517 33.0 33.0 34.0 32.0 34.0 2 32.94825 33.0 33.0 34.0 32.0 34.0 3 30.74525 33.0 31.0 34.0 18.0 34.0 4 32.2295 33.0 32.0 34.0 28.0 34.0 5 32.74025 33.0 33.0 34.0 32.0 34.0 6 37.194 38.0 38.0 38.0 37.0 38.0 7 36.991 38.0 38.0 38.0 36.0 38.0 8 37.25625 38.0 38.0 38.0 37.0 38.0 9 37.283 38.0 38.0 38.0 37.0 38.0 10-14 37.21775 38.0 38.0 38.0 37.0 38.0 15-19 37.25169999999999 38.0 38.0 38.0 37.0 38.0 20-24 36.989549999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.885149999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.025850000000005 38.0 38.0 38.0 36.4 38.0 35-39 37.036699999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.3575 38.0 37.4 38.0 31.6 38.0 45-49 37.053399999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.04105 38.0 38.0 38.0 36.4 38.0 55-59 35.9114 38.0 36.8 38.0 30.0 38.0 60-64 36.29815000000001 38.0 37.6 38.0 33.2 38.0 65-69 36.16135 38.0 37.4 38.0 31.6 38.0 70-74 35.8519 38.0 37.0 38.0 31.2 38.0 75-79 36.58925 38.0 38.0 38.0 35.0 38.0 80-84 36.6877 38.0 38.0 38.0 35.0 38.0 85-89 36.5759 38.0 38.0 38.0 35.0 38.0 90-94 36.55335 38.0 38.0 38.0 35.0 38.0 95-99 36.4153 38.0 38.0 38.0 34.0 38.0 100-104 36.17935 38.0 37.8 38.0 33.6 38.0 105-109 35.97525 38.0 37.0 38.0 32.8 38.0 110-114 35.8595 38.0 37.0 38.0 32.8 38.0 115-119 35.578950000000006 38.0 36.4 38.0 31.2 38.0 120-124 35.390499999999996 38.0 36.2 38.0 30.0 38.0 125-129 34.78085 38.0 35.4 38.0 27.2 38.0 130-134 34.682249999999996 38.0 34.8 38.0 27.6 38.0 135-139 33.9765 38.0 33.0 38.0 23.6 38.0 140-144 33.143899999999995 38.0 33.0 38.0 20.2 38.0 145-149 32.34505 38.0 33.0 38.0 13.0 38.0 150-151 26.371000000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 0.0 5 3.0 6 1.0 7 2.0 8 1.0 9 3.0 10 1.0 11 2.0 12 1.0 13 1.0 14 2.0 15 2.0 16 5.0 17 2.0 18 3.0 19 6.0 20 5.0 21 4.0 22 5.0 23 7.0 24 8.0 25 17.0 26 22.0 27 15.0 28 26.0 29 36.0 30 42.0 31 61.0 32 88.0 33 129.0 34 216.0 35 420.0 36 943.0 37 1907.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.449999999999996 21.8 12.125 24.625 2 26.1 25.924999999999997 31.8 16.175 3 20.4 27.224999999999998 34.825 17.549999999999997 4 23.849999999999998 34.849999999999994 23.05 18.25 5 24.125 36.449999999999996 22.625 16.8 6 20.424999999999997 36.725 24.325 18.525 7 19.400000000000002 20.8 40.925 18.875 8 20.599999999999998 27.075 28.025 24.3 9 21.575 25.474999999999998 28.975 23.974999999999998 10-14 22.58 29.544999999999998 26.86 21.015 15-19 22.314999999999998 28.15 28.395 21.14 20-24 22.175 27.98 28.685 21.16 25-29 23.189999999999998 28.46 28.110000000000003 20.24 30-34 22.314999999999998 28.605000000000004 28.535 20.544999999999998 35-39 22.545 28.804999999999996 27.694999999999997 20.955 40-44 22.685 27.884999999999998 28.225 21.205 45-49 22.475 28.53 27.955000000000002 21.04 50-54 22.28 28.835 27.82 21.065 55-59 22.585 27.985 28.29 21.14 60-64 22.71 28.189999999999998 28.185 20.915 65-69 23.07 27.975 27.955000000000002 21.0 70-74 23.175 28.405 27.735 20.685000000000002 75-79 22.314999999999998 28.57 28.04 21.075 80-84 22.845 27.900000000000002 27.700000000000003 21.555 85-89 23.64 27.735 27.57 21.055 90-94 22.975 28.165000000000003 28.105000000000004 20.755000000000003 95-99 23.375 28.499999999999996 27.384999999999998 20.74 100-104 23.830000000000002 27.72 27.74 20.71 105-109 22.985 27.644999999999996 28.194999999999997 21.175 110-114 23.13 28.349999999999998 28.050000000000004 20.47 115-119 23.974999999999998 27.925 27.810000000000002 20.29 120-124 23.49 27.99 27.61 20.91 125-129 23.335 27.865000000000002 27.834999999999997 20.965 130-134 23.755000000000003 29.07 27.325 19.85 135-139 23.435 27.034999999999997 28.754999999999995 20.775 140-144 23.87 27.63 27.925 20.575 145-149 23.97 27.650000000000002 27.950000000000003 20.43 150-151 24.349999999999998 27.750000000000004 27.8625 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 1.5 23 2.0 24 3.5 25 2.0 26 4.5 27 7.5 28 7.5 29 12.5 30 16.5 31 21.0 32 30.5 33 38.0 34 54.0 35 77.0 36 88.5 37 106.5 38 134.0 39 173.5 40 219.5 41 236.0 42 250.5 43 273.5 44 289.5 45 294.0 46 264.0 47 245.5 48 225.0 49 184.5 50 166.0 51 144.0 52 105.0 53 78.5 54 70.0 55 53.0 56 35.0 57 21.5 58 15.5 59 14.0 60 8.5 61 5.5 62 3.5 63 3.0 64 3.5 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.45305814246161585 0.8999999999999999 3 0.0 0.0 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025169896803423106 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4124999999999996 0.0 0.0 0.0 0.0 118-119 2.4625000000000004 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.35 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTGAA 10 0.006830828 145.0 4 >>END_MODULE Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651879 spots for SRR7170440.sra Written 651879 spots for SRR7170440.sra Read 651888 spots for SRR7170440.sra Written 651888 spots for SRR7170440.sra SRR ids: ['SRR7170440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o300t_3l SRR7170440.sra spots: 13037589 blocks: [[1, 651879], [651880, 1303758], [1303759, 1955637], [1955638, 2607516], [2607517, 3259395], [3259396, 3911274], [3911275, 4563153], [4563154, 5215032], [5215033, 5866911], [5866912, 6518790], [6518791, 7170669], [7170670, 7822548], [7822549, 8474427], [8474428, 9126306], [9126307, 9778185], [9778186, 10430064], [10430065, 11081943], [11081944, 11733822], [11733823, 12385701], [12385702, 13037589]] SRR7170440 file size 4396310 SRR7170440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170440 SRR7170440_1.fastq SRR7170440_2.fastq Input file: SRR7170440_1.fastq Paired file: SRR7170440_2.fastq trimmed: SRR7170440-trimmed-pair1.fastq, SRR7170440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:18:43 2025 >> started Wed Feb 12 19:18:57 2025 >> done (14.868s) 13037589 read pairs processed; of these: 11647 ( 0.09%) short read pairs filtered out after trimming by size control 10458 ( 0.08%) empty read pairs filtered out after trimming by size control 13015484 (99.83%) read pairs available; of these: 7029096 (54.01%) trimmed read pairs available after processing 5986388 (45.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 8 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 10 0.00% 25 11 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 3 0.00% 31 4 0.00% 32 4 0.00% 33 7 0.00% 34 10 0.00% 35 10 0.00% 36 11 0.00% 37 11 0.00% 38 16 0.00% 39 14 0.00% 40 23 0.00% 41 19 0.00% 42 13 0.00% 43 21 0.00% 44 31 0.00% 45 30 0.00% 46 29 0.00% 47 43 0.00% 48 43 0.00% 49 65 0.00% 50 67 0.00% 51 86 0.00% 52 98 0.00% 53 100 0.00% 54 93 0.00% 55 123 0.00% 56 132 0.00% 57 130 0.00% 58 170 0.00% 59 202 0.00% 60 239 0.00% 61 301 0.00% 62 334 0.00% 63 329 0.00% 64 395 0.00% 65 415 0.00% 66 490 0.00% 67 549 0.00% 68 606 0.00% 69 684 0.01% 70 847 0.01% 71 916 0.01% 72 1111 0.01% 73 1246 0.01% 74 1354 0.01% 75 1506 0.01% 76 1776 0.01% 77 1921 0.01% 78 2032 0.02% 79 2099 0.02% 80 2452 0.02% 81 2672 0.02% 82 3028 0.02% 83 3387 0.03% 84 4189 0.03% 85 4713 0.04% 86 4901 0.04% 87 5197 0.04% 88 5442 0.04% 89 5872 0.05% 90 6131 0.05% 91 6566 0.05% 92 7266 0.06% 93 7469 0.06% 94 8184 0.06% 95 8684 0.07% 96 8856 0.07% 97 9241 0.07% 98 9251 0.07% 99 10058 0.08% 100 10461 0.08% 101 10921 0.08% 102 11458 0.09% 103 12304 0.09% 104 12395 0.10% 105 13159 0.10% 106 13570 0.10% 107 14005 0.11% 108 14399 0.11% 109 14637 0.11% 110 14898 0.11% 111 15623 0.12% 112 16211 0.12% 113 16678 0.13% 114 17398 0.13% 115 17824 0.14% 116 18587 0.14% 117 18893 0.15% 118 19492 0.15% 119 19739 0.15% 120 20442 0.16% 121 21235 0.16% 122 21887 0.17% 123 22939 0.18% 124 24200 0.19% 125 24584 0.19% 126 26297 0.20% 127 26963 0.21% 128 27958 0.21% 129 29415 0.23% 130 30701 0.24% 131 32143 0.25% 132 33795 0.26% 133 36194 0.28% 134 38584 0.30% 135 41739 0.32% 136 45603 0.35% 137 49393 0.38% 138 53830 0.41% 139 59740 0.46% 140 66772 0.51% 141 75069 0.58% 142 86121 0.66% 143 102414 0.79% 144 123824 0.95% 145 155670 1.20% 146 202202 1.55% 147 280812 2.16% 148 438280 3.37% 149 865639 6.65% 150 3517615 27.03% 151 5986388 45.99% 13015484 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=13.24 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.1 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=21 prefix-density=0.47 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=18.64 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170440 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:19:42 Started mapping on | Feb 12 19:19:43 Finished on | Feb 12 19:21:09 Mapping speed, Million of reads per hour | 544.83 Number of input reads | 13015484 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12267845 Uniquely mapped reads % | 94.26% Average mapped length | 293.87 Number of splices: Total | 12100900 Number of splices: Annotated (sjdb) | 11828709 Number of splices: GT/AG | 11880807 Number of splices: GC/AG | 178979 Number of splices: AT/AC | 6808 Number of splices: Non-canonical | 34306 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321542 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 21306 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436772 436772 436772 N_multimapping 321542 321542 321542 N_noFeature 463270 12056974 553787 N_ambiguous 214270 882 93404 UnstrandedReadsAssigned:11590305 PositiveStrandReadsAssigned:209989 NegativeStrandReadsAssigned:11620654 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170440-trimmed-pair1.fastq SRR7170440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,015,484 reads, 11,572,248 reads pseudoaligned [quant] estimated average fragment length: 280.179 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7170440.ke.tsv 34699 SRR7170440.se.tsv 87100 total ==> SRR7170440.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.82 688 33.1445 Potri.005G024800.1.v4.1 1035 755.821 235 26.0451 Potri.004G059700.1.v4.1 961 681.843 17 2.08854 Potri.007G009000.2.v4.1 1416 1136.82 0 0 Potri.003G141000.2.v4.1 2943 2663.82 498 15.6604 Potri.016G087400.1.v4.1 270 76.3024 516 566.486 Potri.015G069301.1.v4.1 564 291.927 0 0 Potri.010G195200.1.v4.1 1773 1493.82 60 3.36458 Potri.012G127500.1.v4.1 977 697.827 80 9.60329 ==> SRR7170440.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 934 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7170440 completed mapping pipeline successfully