Starting /dee2/code/volunteer_pipeline.sh SRR7170441 current disk space = 3051020947456 free memory = 1539224452 SRR7170441 SRAfilesize 0f727142607d80c2ecf20be73c5ce950 SRR7170441.sra SRR7170441.sra file validated SRR7170441 is paired end SRR7170441 is conventional basespace SRR7170441 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.4725 28.0 18.0 33.0 18.0 33.0 2 30.29625 31.0 29.0 33.0 27.0 33.0 3 31.5915 33.0 31.0 33.0 29.0 33.0 4 31.601 33.0 31.0 33.0 29.0 33.0 5 32.456 33.0 33.0 33.0 31.0 34.0 6 36.747 38.0 37.0 38.0 34.0 38.0 7 37.297 38.0 38.0 38.0 36.0 38.0 8 37.55925 38.0 38.0 38.0 37.0 38.0 9 37.56575 38.0 38.0 38.0 38.0 38.0 10-14 37.5609 38.0 38.0 38.0 37.6 38.0 15-19 37.6031 38.0 38.0 38.0 38.0 38.0 20-24 37.5467 38.0 38.0 38.0 38.0 38.0 25-29 37.4387 38.0 38.0 38.0 37.0 38.0 30-34 37.46865 38.0 38.0 38.0 37.8 38.0 35-39 37.48025 38.0 38.0 38.0 37.6 38.0 40-44 36.63875 38.0 37.0 38.0 32.8 38.0 45-49 36.075849999999996 38.0 36.8 38.0 29.2 38.0 50-54 37.1463 38.0 38.0 38.0 36.0 38.0 55-59 37.239349999999995 38.0 38.0 38.0 36.6 38.0 60-64 37.21210000000001 38.0 38.0 38.0 36.4 38.0 65-69 37.16965 38.0 38.0 38.0 36.2 38.0 70-74 36.993249999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.953450000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.87775 38.0 38.0 38.0 35.4 38.0 85-89 36.61015 38.0 37.8 38.0 34.4 38.0 90-94 36.33885 38.0 37.6 38.0 33.8 38.0 95-99 36.38555 38.0 38.0 38.0 34.0 38.0 100-104 36.365950000000005 38.0 37.4 38.0 33.8 38.0 105-109 36.35915 38.0 37.6 38.0 34.0 38.0 110-114 36.03585 38.0 37.0 38.0 32.6 38.0 115-119 35.609700000000004 38.0 36.4 38.0 30.0 38.0 120-124 35.7247 38.0 36.6 38.0 31.0 38.0 125-129 35.41495 38.0 36.0 38.0 30.4 38.0 130-134 35.0798 38.0 35.4 38.0 28.6 38.0 135-139 34.74150000000001 38.0 35.0 38.0 27.6 38.0 140-144 33.9947 38.0 33.8 38.0 23.8 38.0 145-149 33.318599999999996 38.0 33.0 38.0 20.4 38.0 150-151 28.763375 35.5 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 4.0 18 1.0 19 3.0 20 5.0 21 2.0 22 6.0 23 8.0 24 14.0 25 7.0 26 16.0 27 12.0 28 16.0 29 34.0 30 38.0 31 71.0 32 96.0 33 120.0 34 197.0 35 374.0 36 939.0 37 2034.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.59178367134685 12.038481539261571 8.008320332813312 35.36141445657826 2 21.885942971485743 14.932466233116559 33.2416208104052 29.939969984992498 3 20.349999999999998 20.025000000000002 26.525 33.1 4 23.075000000000003 28.849999999999998 22.7 25.374999999999996 5 22.025 33.5 24.175 20.3 6 18.3 36.275 25.224999999999998 20.200000000000003 7 14.224999999999998 26.325 42.425000000000004 17.025000000000002 8 17.4 25.874999999999996 31.225 25.5 9 18.099999999999998 23.225 35.0 23.674999999999997 10-14 19.39 30.12 27.284999999999997 23.205000000000002 15-19 19.785 29.165000000000003 27.96 23.09 20-24 19.665 29.060000000000002 27.93 23.345 25-29 19.93 29.459999999999997 27.67 22.939999999999998 30-34 20.225 28.21 28.12 23.445 35-39 20.025000000000002 28.275 27.735 23.965 40-44 20.273040956143422 28.32924938740811 28.334250137520627 23.06345951892784 45-49 20.064999999999998 28.865000000000002 27.805000000000003 23.265 50-54 19.71 29.225 27.235 23.830000000000002 55-59 19.215 29.385 28.23 23.169999999999998 60-64 19.29 29.535 27.639999999999997 23.535 65-69 20.015 29.345 27.41 23.23 70-74 19.86 29.044999999999998 27.54 23.555 75-79 19.905 29.07 27.32 23.705000000000002 80-84 19.965 28.515 27.505000000000003 24.015 85-89 20.095 28.52 27.485 23.9 90-94 20.108016202430363 29.369405410811623 26.914037105565836 23.60854128119218 95-99 20.385 28.915000000000003 27.315 23.385 100-104 19.99 29.270000000000003 27.560000000000002 23.18 105-109 19.919999999999998 28.24 27.650000000000002 24.19 110-114 20.080000000000002 28.544999999999998 27.68 23.695 115-119 20.150000000000002 28.54 27.395000000000003 23.915 120-124 20.330000000000002 28.82 26.96 23.89 125-129 20.237023702370237 28.782878287828783 27.30773077307731 23.672367236723673 130-134 20.724999999999998 28.53 27.435 23.31 135-139 21.02105105255263 27.92639631981599 27.536376818840942 23.51617580879044 140-144 20.66 28.305000000000003 27.200000000000003 23.835 145-149 20.495 28.765 27.38 23.36 150-151 20.625 28.599999999999998 27.200000000000003 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 0.5 23 1.5 24 5.0 25 7.0 26 7.5 27 9.5 28 11.0 29 14.0 30 22.5 31 30.0 32 37.0 33 46.5 34 73.0 35 94.0 36 99.5 37 122.5 38 151.5 39 158.0 40 177.0 41 204.5 42 229.5 43 259.0 44 261.0 45 259.5 46 263.5 47 258.5 48 230.5 49 198.0 50 163.5 51 128.5 52 110.0 53 90.5 54 67.0 55 45.0 56 37.0 57 36.5 58 27.5 59 17.5 60 9.5 61 6.5 62 6.5 63 5.0 64 3.0 65 1.0 66 1.0 67 3.5 68 3.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.6625 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGACTG 10 0.0068343505 144.975 4 >>END_MODULE SRR7170441 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2675 33.0 32.0 34.0 28.0 34.0 2 32.70275 33.0 33.0 34.0 32.0 34.0 3 30.0465 33.0 28.0 34.0 18.0 34.0 4 31.868 33.0 32.0 34.0 27.0 34.0 5 32.534 33.0 33.0 34.0 32.0 34.0 6 36.9945 38.0 38.0 38.0 36.0 38.0 7 36.6375 38.0 38.0 38.0 35.0 38.0 8 36.95275 38.0 38.0 38.0 36.0 38.0 9 37.09025 38.0 38.0 38.0 36.0 38.0 10-14 36.99855 38.0 38.0 38.0 36.2 38.0 15-19 36.9724 38.0 38.0 38.0 36.4 38.0 20-24 36.75 38.0 38.0 38.0 35.4 38.0 25-29 36.583549999999995 38.0 38.0 38.0 34.8 38.0 30-34 36.77955 38.0 38.0 38.0 36.0 38.0 35-39 36.87245 38.0 38.0 38.0 36.0 38.0 40-44 35.920100000000005 38.0 37.0 38.0 30.2 38.0 45-49 36.84275000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.8549 38.0 38.0 38.0 36.0 38.0 55-59 35.5009 38.0 35.6 38.0 29.4 38.0 60-64 36.25665 38.0 38.0 38.0 33.4 38.0 65-69 36.077000000000005 38.0 37.6 38.0 32.2 38.0 70-74 35.7545 38.0 37.0 38.0 31.2 38.0 75-79 36.446850000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.43835 38.0 38.0 38.0 34.6 38.0 85-89 36.309000000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.435 38.0 38.0 38.0 34.0 38.0 95-99 36.184900000000006 38.0 38.0 38.0 33.8 38.0 100-104 35.99465 38.0 37.6 38.0 33.2 38.0 105-109 35.77735 38.0 37.0 38.0 32.2 38.0 110-114 35.6083 38.0 37.0 38.0 31.4 38.0 115-119 35.31250000000001 38.0 36.4 38.0 29.6 38.0 120-124 35.1109 38.0 36.0 38.0 28.6 38.0 125-129 34.478300000000004 38.0 34.8 38.0 25.4 38.0 130-134 34.3386 38.0 33.8 38.0 25.2 38.0 135-139 33.7856 38.0 33.0 38.0 22.0 38.0 140-144 32.95765 38.0 33.0 38.0 18.0 38.0 145-149 32.15255 38.0 32.6 38.0 10.8 38.0 150-151 26.281125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 0.0 5 2.0 6 2.0 7 2.0 8 1.0 9 3.0 10 7.0 11 1.0 12 2.0 13 2.0 14 3.0 15 3.0 16 9.0 17 2.0 18 3.0 19 5.0 20 8.0 21 10.0 22 12.0 23 13.0 24 24.0 25 18.0 26 17.0 27 33.0 28 34.0 29 46.0 30 65.0 31 67.0 32 105.0 33 125.0 34 200.0 35 362.0 36 835.0 37 1971.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.95 20.974999999999998 12.15 23.925 2 27.025 27.200000000000003 29.599999999999998 16.175 3 20.7 27.575 33.675 18.05 4 25.224999999999998 33.975 22.625 18.175 5 25.55 34.949999999999996 22.35 17.150000000000002 6 19.950000000000003 38.15 24.425 17.474999999999998 7 20.724999999999998 21.8 37.9 19.575 8 21.175 27.575 26.650000000000002 24.6 9 21.275 25.45 30.15 23.125 10-14 23.07 29.24 26.884999999999998 20.805 15-19 23.13 27.800000000000004 28.655 20.415 20-24 23.044999999999998 28.605000000000004 28.215 20.135 25-29 23.22 28.685 27.694999999999997 20.4 30-34 22.994999999999997 27.98 28.71 20.315 35-39 22.495 28.4 28.044999999999998 21.060000000000002 40-44 22.770000000000003 28.349999999999998 28.63 20.25 45-49 22.97 28.01 28.27 20.75 50-54 23.365 28.335 28.13 20.169999999999998 55-59 23.445 28.27 27.88 20.405 60-64 22.25 28.255000000000003 28.299999999999997 21.195 65-69 23.685000000000002 27.68 28.415000000000003 20.22 70-74 22.869999999999997 28.075 27.994999999999997 21.060000000000002 75-79 23.49 27.900000000000002 27.99 20.62 80-84 23.380000000000003 27.91 27.33 21.38 85-89 24.055 27.765 27.68 20.5 90-94 23.555 27.935 28.15 20.36 95-99 23.935000000000002 27.685 28.12 20.26 100-104 23.78 27.68 27.700000000000003 20.84 105-109 23.86 27.675 28.425 20.04 110-114 24.18 28.205000000000002 27.505000000000003 20.11 115-119 23.830000000000002 27.66 28.345 20.165 120-124 24.38 28.084999999999997 27.455000000000002 20.080000000000002 125-129 24.465 27.485 27.66 20.39 130-134 24.16 28.125 27.74 19.975 135-139 24.3 27.47 27.83 20.4 140-144 24.39 28.16 27.22 20.23 145-149 24.685000000000002 28.03 27.529999999999998 19.755 150-151 24.6625 28.499999999999996 27.6125 19.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 5.0 27 5.0 28 6.0 29 10.5 30 17.0 31 20.5 32 30.0 33 44.5 34 57.5 35 74.5 36 82.5 37 97.0 38 135.0 39 167.0 40 191.0 41 233.0 42 272.5 43 290.5 44 277.0 45 277.5 46 282.5 47 250.0 48 224.0 49 194.5 50 167.5 51 142.0 52 110.5 53 86.5 54 66.5 55 50.0 56 34.0 57 21.5 58 13.5 59 13.5 60 12.0 61 8.0 62 5.5 63 3.5 64 2.5 65 1.0 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69841668760995 99.175 2 0.15079165619502388 0.3 3 0.07539582809751194 0.22499999999999998 4 0.07539582809751194 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.8 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTC 10 0.006830828 145.0 5 >>END_MODULE Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827459 spots for SRR7170441.sra Written 827459 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra Read 827451 spots for SRR7170441.sra Written 827451 spots for SRR7170441.sra SRR ids: ['SRR7170441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rarbjza SRR7170441.sra spots: 16549028 blocks: [[1, 827451], [827452, 1654902], [1654903, 2482353], [2482354, 3309804], [3309805, 4137255], [4137256, 4964706], [4964707, 5792157], [5792158, 6619608], [6619609, 7447059], [7447060, 8274510], [8274511, 9101961], [9101962, 9929412], [9929413, 10756863], [10756864, 11584314], [11584315, 12411765], [12411766, 13239216], [13239217, 14066667], [14066668, 14894118], [14894119, 15721569], [15721570, 16549028]] SRR7170441 file size 5586222 SRR7170441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170441 SRR7170441_1.fastq SRR7170441_2.fastq Input file: SRR7170441_1.fastq Paired file: SRR7170441_2.fastq trimmed: SRR7170441-trimmed-pair1.fastq, SRR7170441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:33:07 2025 >> started Wed Feb 12 19:33:24 2025 >> done (17.449s) 16549028 read pairs processed; of these: 18995 ( 0.11%) short read pairs filtered out after trimming by size control 27052 ( 0.16%) empty read pairs filtered out after trimming by size control 16502981 (99.72%) read pairs available; of these: 8935992 (54.15%) trimmed read pairs available after processing 7566989 (45.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 5 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 10 0.00% 29 11 0.00% 30 15 0.00% 31 18 0.00% 32 9 0.00% 33 17 0.00% 34 20 0.00% 35 24 0.00% 36 38 0.00% 37 38 0.00% 38 35 0.00% 39 38 0.00% 40 42 0.00% 41 56 0.00% 42 51 0.00% 43 64 0.00% 44 76 0.00% 45 93 0.00% 46 97 0.00% 47 108 0.00% 48 121 0.00% 49 174 0.00% 50 199 0.00% 51 197 0.00% 52 256 0.00% 53 253 0.00% 54 252 0.00% 55 258 0.00% 56 330 0.00% 57 385 0.00% 58 413 0.00% 59 507 0.00% 60 594 0.00% 61 649 0.00% 62 755 0.00% 63 776 0.00% 64 868 0.01% 65 947 0.01% 66 1054 0.01% 67 1155 0.01% 68 1291 0.01% 69 1492 0.01% 70 1695 0.01% 71 1836 0.01% 72 2202 0.01% 73 2391 0.01% 74 2742 0.02% 75 3060 0.02% 76 3921 0.02% 77 4105 0.02% 78 3782 0.02% 79 4087 0.02% 80 4304 0.03% 81 4966 0.03% 82 5536 0.03% 83 6074 0.04% 84 7452 0.05% 85 8240 0.05% 86 8607 0.05% 87 8815 0.05% 88 9356 0.06% 89 9996 0.06% 90 10489 0.06% 91 10942 0.07% 92 11584 0.07% 93 12724 0.08% 94 13436 0.08% 95 14322 0.09% 96 14702 0.09% 97 14952 0.09% 98 14996 0.09% 99 15817 0.10% 100 16253 0.10% 101 16796 0.10% 102 17872 0.11% 103 18363 0.11% 104 19288 0.12% 105 20198 0.12% 106 20873 0.13% 107 21113 0.13% 108 21245 0.13% 109 22027 0.13% 110 21967 0.13% 111 23114 0.14% 112 23688 0.14% 113 24658 0.15% 114 25637 0.16% 115 26439 0.16% 116 26960 0.16% 117 27472 0.17% 118 28108 0.17% 119 28290 0.17% 120 29649 0.18% 121 30529 0.18% 122 31325 0.19% 123 32309 0.20% 124 33812 0.20% 125 34833 0.21% 126 36322 0.22% 127 37613 0.23% 128 39369 0.24% 129 40793 0.25% 130 43172 0.26% 131 44521 0.27% 132 47676 0.29% 133 49942 0.30% 134 53570 0.32% 135 57808 0.35% 136 62418 0.38% 137 67274 0.41% 138 72411 0.44% 139 79786 0.48% 140 88106 0.53% 141 99567 0.60% 142 114225 0.69% 143 133821 0.81% 144 160841 0.97% 145 198117 1.20% 146 254603 1.54% 147 349977 2.12% 148 536831 3.25% 149 1047625 6.35% 150 4325815 26.21% 151 7566989 45.85% 16502981 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=24.49 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.91 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=29.68 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170441 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:34:07 Started mapping on | Feb 12 19:34:07 Finished on | Feb 12 19:35:46 Mapping speed, Million of reads per hour | 600.11 Number of input reads | 16502981 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15382042 Uniquely mapped reads % | 93.21% Average mapped length | 292.76 Number of splices: Total | 14684299 Number of splices: Annotated (sjdb) | 14341696 Number of splices: GT/AG | 14414143 Number of splices: GC/AG | 210221 Number of splices: AT/AC | 9748 Number of splices: Non-canonical | 50187 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465490 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 79939 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671422 671422 671422 N_multimapping 465490 465490 465490 N_noFeature 551406 15087006 646159 N_ambiguous 323007 1351 122084 UnstrandedReadsAssigned:14507629 PositiveStrandReadsAssigned:293685 NegativeStrandReadsAssigned:14613799 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170441-trimmed-pair1.fastq SRR7170441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,502,981 reads, 14,555,309 reads pseudoaligned [quant] estimated average fragment length: 275.996 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR7170441.ke.tsv 34699 SRR7170441.se.tsv 87100 total ==> SRR7170441.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743 892 30.987 Potri.005G024800.1.v4.1 1035 760.004 573 45.6511 Potri.004G059700.1.v4.1 961 686.057 14 1.23561 Potri.007G009000.2.v4.1 1416 1141 0 0 Potri.003G141000.2.v4.1 2943 2668 1095 24.8508 Potri.016G087400.1.v4.1 270 80.033 1148 868.532 Potri.015G069301.1.v4.1 564 295.659 0 0 Potri.010G195200.1.v4.1 1773 1498 249 10.0647 Potri.012G127500.1.v4.1 977 702.047 60 5.17485 ==> SRR7170441.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 660 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170441 completed mapping pipeline successfully