Starting /dee2/code/volunteer_pipeline.sh SRR7170442 current disk space = 3051137507328 free memory = 985733684 SRR7170442 SRAfilesize 15abc9a910f584b2fcea7d8c16fbe0eb SRR7170442.sra SRR7170442.sra file validated SRR7170442 is paired end SRR7170442 is conventional basespace SRR7170442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.25125 18.0 18.0 18.0 18.0 32.0 2 24.64575 25.0 18.0 27.0 18.0 30.0 3 25.69975 27.0 25.0 29.0 18.0 31.0 4 28.31975 29.0 27.0 31.0 25.0 33.0 5 29.27375 31.0 29.0 33.0 25.0 33.0 6 35.00875 37.0 34.0 38.0 29.0 38.0 7 36.51375 38.0 37.0 38.0 34.0 38.0 8 36.425 38.0 37.0 38.0 34.0 38.0 9 36.922 38.0 38.0 38.0 35.0 38.0 10-14 36.59085 38.0 37.2 38.0 33.8 38.0 15-19 37.45895 38.0 38.0 38.0 36.8 38.0 20-24 37.4855 38.0 38.0 38.0 37.0 38.0 25-29 36.542449999999995 38.0 37.2 38.0 32.0 38.0 30-34 37.17405000000001 38.0 38.0 38.0 36.0 38.0 35-39 37.3012 38.0 38.0 38.0 36.8 38.0 40-44 37.3769 38.0 38.0 38.0 37.0 38.0 45-49 37.3322 38.0 38.0 38.0 37.0 38.0 50-54 37.301100000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.299600000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.263600000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.10965 38.0 38.0 38.0 36.0 38.0 70-74 36.5143 38.0 37.8 38.0 33.6 38.0 75-79 36.7432 38.0 38.0 38.0 35.6 38.0 80-84 36.59905 38.0 38.0 38.0 35.0 38.0 85-89 36.49155 38.0 38.0 38.0 34.4 38.0 90-94 36.367 38.0 38.0 38.0 34.2 38.0 95-99 36.2855 38.0 38.0 38.0 34.0 38.0 100-104 36.3134 38.0 38.0 38.0 34.0 38.0 105-109 36.20315 38.0 37.8 38.0 34.0 38.0 110-114 36.00555 38.0 37.2 38.0 33.4 38.0 115-119 35.60265 38.0 36.8 38.0 31.6 38.0 120-124 35.520700000000005 38.0 36.0 38.0 31.0 38.0 125-129 35.3952 38.0 36.0 38.0 30.0 38.0 130-134 35.0278 38.0 35.6 38.0 28.2 38.0 135-139 34.4406 38.0 34.8 38.0 25.6 38.0 140-144 34.4082 38.0 35.0 38.0 26.4 38.0 145-149 33.81965 38.0 34.2 38.0 24.0 38.0 150-151 29.92875 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 4.0 18 18.0 19 19.0 20 5.0 21 3.0 22 2.0 23 3.0 24 8.0 25 7.0 26 9.0 27 15.0 28 25.0 29 25.0 30 28.0 31 63.0 32 85.0 33 125.0 34 227.0 35 420.0 36 1208.0 37 1695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.51898402723226 32.62634197433883 10.26446713799424 34.59020686043467 2 25.906476619154787 16.25406351587897 29.9074768692173 27.93198299574894 3 23.825 19.575 24.6 32.0 4 23.549999999999997 26.6 21.725 28.125 5 24.625 31.025000000000002 23.125 21.224999999999998 6 20.875 33.1 24.8 21.224999999999998 7 15.725 25.374999999999996 40.475 18.425 8 19.5 26.525 27.775 26.200000000000003 9 18.875 23.849999999999998 32.65 24.625 10-14 20.195 29.2 26.090000000000003 24.515 15-19 20.415 27.339999999999996 27.21 25.035 20-24 21.09 27.485 27.189999999999998 24.235 25-29 20.775 27.700000000000003 27.04 24.485 30-34 20.585 28.255000000000003 26.525 24.635 35-39 20.445 27.189999999999998 27.639999999999997 24.725 40-44 21.3 28.084999999999997 25.995 24.62 45-49 21.07 27.825 27.084999999999997 24.02 50-54 20.995 27.125 27.41 24.47 55-59 20.985 27.625 26.715 24.675 60-64 20.995 27.205000000000002 27.134999999999998 24.665 65-69 20.865000000000002 28.720000000000002 26.279999999999998 24.135 70-74 21.16 28.665000000000003 26.215 23.96 75-79 20.979999999999997 28.075 26.740000000000002 24.205 80-84 20.979999999999997 28.310000000000002 26.205000000000002 24.505 85-89 20.785 28.18 26.400000000000002 24.635 90-94 21.535 27.139999999999997 27.0 24.325 95-99 21.285 27.639999999999997 26.669999999999998 24.404999999999998 100-104 20.735 28.189999999999998 26.205000000000002 24.87 105-109 21.385 27.694999999999997 26.540000000000003 24.38 110-114 21.41 27.529999999999998 27.08 23.98 115-119 21.29 27.675 26.75 24.285 120-124 21.495 27.48 26.35 24.675 125-129 20.919999999999998 27.229999999999997 26.790000000000003 25.06 130-134 21.23 27.075 27.655 24.04 135-139 22.17 27.325 26.565 23.94 140-144 21.295 27.625 26.19 24.89 145-149 21.38 27.66 26.69 24.27 150-151 21.512500000000003 28.175 25.937500000000004 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.0 25 1.0 26 3.0 27 6.0 28 11.5 29 14.5 30 12.0 31 14.5 32 22.5 33 33.5 34 49.0 35 67.5 36 82.5 37 101.5 38 117.0 39 129.5 40 149.5 41 181.5 42 203.5 43 208.0 44 224.0 45 239.0 46 233.0 47 235.0 48 231.5 49 227.5 50 203.0 51 171.5 52 159.0 53 126.5 54 107.5 55 86.5 56 74.0 57 65.0 58 47.0 59 38.5 60 31.5 61 24.0 62 17.0 63 11.0 64 7.0 65 4.5 66 4.5 67 5.5 68 4.0 69 2.0 70 1.5 71 1.0 72 0.5 73 1.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5249999999999995 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13727480334941 97.675 2 0.6851053032225324 1.35 3 0.12687135244861708 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025374270489723422 0.2 9 0.0 0.0 >10 0.025374270489723422 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 16 0.4 TruSeq Adapter, Index 27 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 8 0.2 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4500000000000002 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 3.725 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACGT 10 0.0068343505 144.975 4 CAAGCCA 10 0.0068343505 144.975 4 CAAAACG 10 0.0068343505 144.975 3 >>END_MODULE SRR7170442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73325 33.0 33.0 34.0 32.0 34.0 2 32.83775 33.0 33.0 34.0 32.0 34.0 3 32.77825 34.0 33.0 34.0 32.0 34.0 4 32.768 34.0 33.0 34.0 32.0 34.0 5 32.79925 34.0 33.0 34.0 32.0 34.0 6 36.95825 38.0 38.0 38.0 36.0 38.0 7 37.0055 38.0 38.0 38.0 36.0 38.0 8 36.97675 38.0 38.0 38.0 36.0 38.0 9 36.97675 38.0 38.0 38.0 36.0 38.0 10-14 36.84695 38.0 38.0 38.0 35.8 38.0 15-19 36.833 38.0 38.0 38.0 36.0 38.0 20-24 36.665000000000006 38.0 38.0 38.0 35.4 38.0 25-29 36.64835000000001 38.0 38.0 38.0 35.6 38.0 30-34 36.78419999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.760749999999994 38.0 38.0 38.0 35.8 38.0 40-44 36.6788 38.0 38.0 38.0 35.4 38.0 45-49 36.591750000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.36455 38.0 38.0 38.0 33.8 38.0 55-59 36.47375 38.0 38.0 38.0 34.4 38.0 60-64 35.8611 38.0 37.2 38.0 29.4 38.0 65-69 36.33284999999999 38.0 38.0 38.0 34.0 38.0 70-74 35.83434999999999 38.0 37.2 38.0 31.8 38.0 75-79 36.09015 38.0 37.6 38.0 33.6 38.0 80-84 35.13185 38.0 36.2 38.0 28.6 38.0 85-89 34.39415 38.0 34.8 38.0 24.4 38.0 90-94 35.59815 38.0 37.2 38.0 31.8 38.0 95-99 35.48544999999999 38.0 37.0 38.0 31.0 38.0 100-104 35.133500000000005 38.0 36.4 38.0 28.6 38.0 105-109 34.64445 38.0 35.6 38.0 25.8 38.0 110-114 34.457499999999996 38.0 35.6 38.0 25.2 38.0 115-119 34.7648 38.0 36.0 38.0 27.4 38.0 120-124 34.487199999999994 38.0 35.2 38.0 25.0 38.0 125-129 34.057750000000006 38.0 34.6 38.0 21.8 38.0 130-134 33.3903 38.0 33.2 38.0 19.4 38.0 135-139 33.2278 38.0 33.0 38.0 19.8 38.0 140-144 32.377300000000005 38.0 32.4 38.0 14.0 38.0 145-149 31.267000000000003 38.0 31.8 38.0 7.8 38.0 150-151 25.87325 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 2.0 5 4.0 6 0.0 7 2.0 8 2.0 9 5.0 10 3.0 11 1.0 12 2.0 13 1.0 14 3.0 15 2.0 16 3.0 17 7.0 18 13.0 19 19.0 20 16.0 21 7.0 22 13.0 23 13.0 24 15.0 25 16.0 26 25.0 27 35.0 28 46.0 29 37.0 30 81.0 31 95.0 32 110.0 33 158.0 34 212.0 35 360.0 36 885.0 37 1785.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.574999999999996 21.099999999999998 17.9 29.425 2 27.1 26.474999999999998 28.925 17.5 3 22.05 27.750000000000004 30.4 19.8 4 23.1 31.525 23.9 21.475 5 26.150000000000002 34.125 21.325 18.4 6 22.15 35.675000000000004 22.725 19.45 7 20.8 21.25 37.15 20.8 8 22.75 26.174999999999997 25.900000000000002 25.174999999999997 9 22.275 24.9 29.349999999999998 23.474999999999998 10-14 23.525 28.904999999999998 25.53 22.040000000000003 15-19 23.66 27.455000000000002 26.674999999999997 22.21 20-24 23.400000000000002 28.07 26.384999999999998 22.145 25-29 23.121156057802892 28.24641232061603 26.55132756637832 22.08110405520276 30-34 23.111155557777888 27.146357317865892 27.701385069253465 22.041102055102755 35-39 23.321166058302914 26.916345817290864 26.736336816840844 23.026151307565378 40-44 23.615 27.045 26.82 22.52 45-49 23.231161558077904 27.251362568128407 27.346367318365917 22.17110855542777 50-54 23.14 27.015 27.38 22.465 55-59 23.535 26.55 27.785 22.13 60-64 23.36116805840292 26.061303065153258 27.801390069503473 22.776138806940345 65-69 23.565 26.424999999999997 27.67 22.34 70-74 23.657365736573656 27.49274927492749 26.427642764276428 22.422242224222423 75-79 23.163474521178177 27.89418412761914 26.638995849377405 22.303345501825273 80-84 23.27732773277328 28.17781778177818 26.07760776077608 22.467246724672467 85-89 24.515 26.815 26.375 22.295 90-94 23.771188559427973 26.986349317465873 27.031351567578376 22.211110555527778 95-99 23.97 26.985 26.69 22.355 100-104 24.07620381019051 26.89134456722836 27.171358567928394 21.861093054652734 105-109 24.560000000000002 27.025 26.685 21.73 110-114 24.381219060953047 27.05635281764088 26.561328066403323 22.001100055002752 115-119 24.187418741874186 27.807780778077806 26.2976297629763 21.70717071707171 120-124 24.18620931046552 27.061353067653382 26.451322566128304 22.30111505575279 125-129 24.02980596119224 27.425485097019404 26.580316063212646 21.964392878575715 130-134 24.62246224622462 26.807680768076807 26.48264826482648 22.087208720872088 135-139 24.601230061503074 26.75133756687834 26.961348067403367 21.68608430421521 140-144 25.12625631281564 26.93134656732837 26.681334066703332 21.261063053152657 145-149 25.132513251325133 27.037703770377036 26.422642264226422 21.407140714071407 150-151 24.128016002000248 26.62832854106763 27.665958244780597 21.57769721215152 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 2.5 25 2.0 26 0.5 27 4.0 28 7.5 29 8.5 30 11.0 31 17.5 32 25.0 33 29.5 34 34.5 35 46.5 36 64.5 37 82.5 38 107.5 39 134.5 40 155.5 41 172.5 42 196.0 43 236.0 44 254.5 45 247.0 46 258.5 47 243.5 48 209.0 49 198.5 50 198.0 51 177.0 52 142.5 53 130.5 54 124.0 55 108.5 56 93.5 57 77.0 58 49.5 59 35.5 60 27.5 61 21.0 62 16.0 63 10.0 64 7.0 65 4.0 66 2.0 67 2.0 68 2.0 69 0.0 70 2.0 71 2.5 72 1.0 73 2.0 74 3.0 75 1.5 76 1.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.01 75-79 0.015 80-84 0.01 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.01 120-124 0.005 125-129 0.02 130-134 0.01 135-139 0.005 140-144 0.005 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22027340727367 95.19999999999999 2 1.263863812225948 2.45 3 0.3353108073252515 0.975 4 0.12896569512509673 0.5 5 0.0 0.0 6 0.025793139025019347 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025793139025019347 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 29 0.7250000000000001 Illumina Single End PCR Primer 1 (96% over 32bp) CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.6624999999999996 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.425000000000001 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCCCG 10 0.006830828 145.0 8 CATGCTT 10 0.006830828 145.0 5 >>END_MODULE Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra Read 745140 spots for SRR7170442.sra Written 745140 spots for SRR7170442.sra SRR ids: ['SRR7170442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__3pqbgev SRR7170442.sra spots: 14902800 blocks: [[1, 745140], [745141, 1490280], [1490281, 2235420], [2235421, 2980560], [2980561, 3725700], [3725701, 4470840], [4470841, 5215980], [5215981, 5961120], [5961121, 6706260], [6706261, 7451400], [7451401, 8196540], [8196541, 8941680], [8941681, 9686820], [9686821, 10431960], [10431961, 11177100], [11177101, 11922240], [11922241, 12667380], [12667381, 13412520], [13412521, 14157660], [14157661, 14902800]] SRR7170442 file size 5028369 SRR7170442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170442 SRR7170442_1.fastq SRR7170442_2.fastq Input file: SRR7170442_1.fastq Paired file: SRR7170442_2.fastq trimmed: SRR7170442-trimmed-pair1.fastq, SRR7170442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:19:38 2025 >> started Wed Feb 12 19:19:57 2025 >> done (19.160s) 14902800 read pairs processed; of these: 19811 ( 0.13%) short read pairs filtered out after trimming by size control 153673 ( 1.03%) empty read pairs filtered out after trimming by size control 14729316 (98.84%) read pairs available; of these: 8469640 (57.50%) trimmed read pairs available after processing 6259676 (42.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 16 0.00% 20 12 0.00% 21 13 0.00% 22 5 0.00% 23 5 0.00% 24 17 0.00% 25 11 0.00% 26 16 0.00% 27 13 0.00% 28 11 0.00% 29 23 0.00% 30 27 0.00% 31 28 0.00% 32 25 0.00% 33 36 0.00% 34 28 0.00% 35 49 0.00% 36 56 0.00% 37 69 0.00% 38 101 0.00% 39 105 0.00% 40 117 0.00% 41 107 0.00% 42 122 0.00% 43 129 0.00% 44 127 0.00% 45 156 0.00% 46 182 0.00% 47 205 0.00% 48 267 0.00% 49 290 0.00% 50 322 0.00% 51 390 0.00% 52 406 0.00% 53 437 0.00% 54 449 0.00% 55 452 0.00% 56 477 0.00% 57 556 0.00% 58 617 0.00% 59 824 0.01% 60 867 0.01% 61 979 0.01% 62 1128 0.01% 63 1269 0.01% 64 1192 0.01% 65 1320 0.01% 66 1442 0.01% 67 1492 0.01% 68 1629 0.01% 69 1728 0.01% 70 2149 0.01% 71 2430 0.02% 72 2793 0.02% 73 3226 0.02% 74 3874 0.03% 75 5089 0.03% 76 10772 0.07% 77 9942 0.07% 78 5604 0.04% 79 4947 0.03% 80 5164 0.04% 81 5672 0.04% 82 5916 0.04% 83 6821 0.05% 84 8048 0.05% 85 8751 0.06% 86 8745 0.06% 87 9045 0.06% 88 9378 0.06% 89 9607 0.07% 90 9799 0.07% 91 10360 0.07% 92 11008 0.07% 93 12015 0.08% 94 12111 0.08% 95 12889 0.09% 96 13232 0.09% 97 13045 0.09% 98 13067 0.09% 99 12751 0.09% 100 13580 0.09% 101 14092 0.10% 102 14664 0.10% 103 15148 0.10% 104 15841 0.11% 105 16577 0.11% 106 16222 0.11% 107 16639 0.11% 108 16795 0.11% 109 17257 0.12% 110 17208 0.12% 111 17604 0.12% 112 18226 0.12% 113 19230 0.13% 114 19854 0.13% 115 20628 0.14% 116 21251 0.14% 117 21780 0.15% 118 21771 0.15% 119 21830 0.15% 120 22968 0.16% 121 23738 0.16% 122 24656 0.17% 123 26260 0.18% 124 27079 0.18% 125 28729 0.20% 126 30449 0.21% 127 31418 0.21% 128 33222 0.23% 129 34463 0.23% 130 36634 0.25% 131 38755 0.26% 132 41183 0.28% 133 44362 0.30% 134 48377 0.33% 135 52342 0.36% 136 57411 0.39% 137 63211 0.43% 138 68731 0.47% 139 77200 0.52% 140 85573 0.58% 141 97803 0.66% 142 113591 0.77% 143 134893 0.92% 144 163072 1.11% 145 215135 1.46% 146 263080 1.79% 147 372854 2.53% 148 564137 3.83% 149 1064441 7.23% 150 3959070 26.88% 151 6259676 42.50% 14729316 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.81 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=286.93 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=10.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=25 prefix-density=0.91 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=28.48 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.4 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170442 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:20:52 Started mapping on | Feb 12 19:20:53 Finished on | Feb 12 19:24:27 Mapping speed, Million of reads per hour | 247.78 Number of input reads | 14729316 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12621459 Uniquely mapped reads % | 85.69% Average mapped length | 293.12 Number of splices: Total | 12116566 Number of splices: Annotated (sjdb) | 11866979 Number of splices: GT/AG | 11856144 Number of splices: GC/AG | 223634 Number of splices: AT/AC | 6051 Number of splices: Non-canonical | 30737 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 444267 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 490504 % of reads mapped to too many loci | 3.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.13% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1678797 1678797 1678797 N_multimapping 444267 444267 444267 N_noFeature 502081 12376508 559885 N_ambiguous 287983 1345 99892 UnstrandedReadsAssigned:11831395 PositiveStrandReadsAssigned:243606 NegativeStrandReadsAssigned:11961682 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170442-trimmed-pair1.fastq SRR7170442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,729,316 reads, 12,322,418 reads pseudoaligned [quant] estimated average fragment length: 283.241 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7170442.ke.tsv 34699 SRR7170442.se.tsv 87100 total ==> SRR7170442.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.76 289 10.4197 Potri.005G024800.1.v4.1 1035 752.759 129 10.7246 Potri.004G059700.1.v4.1 961 678.792 15 1.38294 Potri.007G009000.2.v4.1 1416 1133.76 0 0 Potri.003G141000.2.v4.1 2943 2660.76 355 8.3497 Potri.016G087400.1.v4.1 270 75.5804 591 489.358 Potri.015G069301.1.v4.1 564 288.385 0 0 Potri.010G195200.1.v4.1 1773 1490.76 5 0.209899 Potri.012G127500.1.v4.1 977 694.775 216 19.4562 ==> SRR7170442.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 83 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170442 completed mapping pipeline successfully