Starting /dee2/code/volunteer_pipeline.sh SRR7170443 current disk space = 3050922254336 free memory = 1579559208 SRR7170443 SRAfilesize d4fa0cb7b4c402c4ce8d5380b0659b54 SRR7170443.sra SRR7170443.sra file validated SRR7170443 is paired end SRR7170443 is conventional basespace SRR7170443 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.98625 18.0 18.0 18.0 18.0 31.0 2 26.08 27.0 25.0 29.0 18.0 31.0 3 27.50075 29.0 25.0 31.0 18.0 33.0 4 30.605 31.0 29.0 33.0 27.0 33.0 5 31.80925 33.0 32.0 33.0 31.0 33.0 6 35.87375 37.0 36.0 38.0 33.0 38.0 7 36.998 38.0 37.0 38.0 35.0 38.0 8 37.41725 38.0 38.0 38.0 37.0 38.0 9 37.5745 38.0 38.0 38.0 37.0 38.0 10-14 37.579249999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.6161 38.0 38.0 38.0 37.6 38.0 20-24 37.7016 38.0 38.0 38.0 38.0 38.0 25-29 37.68365 38.0 38.0 38.0 38.0 38.0 30-34 37.6202 38.0 38.0 38.0 38.0 38.0 35-39 37.581 38.0 38.0 38.0 38.0 38.0 40-44 37.5878 38.0 38.0 38.0 37.8 38.0 45-49 37.56505 38.0 38.0 38.0 38.0 38.0 50-54 37.4014 38.0 38.0 38.0 37.0 38.0 55-59 37.319950000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.2818 38.0 38.0 38.0 36.0 38.0 65-69 37.2263 38.0 38.0 38.0 36.0 38.0 70-74 37.1436 38.0 38.0 38.0 36.0 38.0 75-79 37.02325 38.0 38.0 38.0 36.0 38.0 80-84 36.931599999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.8448 38.0 38.0 38.0 35.0 38.0 90-94 36.805899999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.609899999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.38590000000001 38.0 37.4 38.0 33.8 38.0 105-109 36.31315 38.0 37.0 38.0 33.8 38.0 110-114 36.06015 38.0 37.0 38.0 33.0 38.0 115-119 35.84715 38.0 36.6 38.0 31.8 38.0 120-124 35.537099999999995 38.0 36.0 38.0 30.6 38.0 125-129 35.268899999999995 38.0 36.0 38.0 29.4 38.0 130-134 35.0557 38.0 35.4 38.0 28.4 38.0 135-139 34.62825 38.0 33.8 38.0 27.4 38.0 140-144 33.8679 38.0 33.0 38.0 24.0 38.0 145-149 32.650999999999996 38.0 33.0 38.0 17.8 38.0 150-151 26.542875000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 1.0 19 3.0 20 1.0 21 2.0 22 3.0 23 2.0 24 5.0 25 4.0 26 8.0 27 12.0 28 21.0 29 23.0 30 31.0 31 54.0 32 80.0 33 132.0 34 229.0 35 484.0 36 1292.0 37 1606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.782723202528313 26.099552278114302 9.981564392941795 39.13616012641559 2 20.75 14.95 37.75 26.55 3 19.475 20.424999999999997 26.325 33.775 4 22.325 27.975 22.675 27.025 5 22.400000000000002 33.550000000000004 24.125 19.925 6 18.925 36.6 24.6 19.875 7 14.149999999999999 26.650000000000002 42.35 16.85 8 17.95 26.025 31.6 24.425 9 17.125 23.95 34.325 24.6 10-14 18.970000000000002 30.495 27.55 22.985 15-19 19.29 29.15 28.28 23.28 20-24 19.425 28.89 28.02 23.665 25-29 19.365 29.14 27.63 23.865 30-34 19.35693569356936 29.127912791279126 28.07780778077808 23.437343734373435 35-39 19.77098854942747 28.7964398219911 28.0114005700285 23.42117105855293 40-44 19.28 29.43 27.575 23.715 45-49 19.59 28.825 27.88 23.705000000000002 50-54 19.3 29.160000000000004 27.750000000000004 23.79 55-59 19.37 28.720000000000002 28.105000000000004 23.805 60-64 19.495 28.365000000000002 28.525 23.615 65-69 19.515 28.83 28.18 23.474999999999998 70-74 19.564999999999998 28.415000000000003 28.205000000000002 23.815 75-79 19.368873774754952 28.545709141828368 28.335667133426686 23.749749949989997 80-84 19.702955443316498 28.99934990248537 27.284092613892085 24.013602040306044 85-89 19.985 28.23 28.585 23.200000000000003 90-94 20.005 28.485 28.22 23.29 95-99 20.305 28.665000000000003 27.85 23.18 100-104 19.900000000000002 28.335 28.560000000000002 23.205000000000002 105-109 19.755 28.77 27.744999999999997 23.73 110-114 20.369999999999997 28.244999999999997 28.084999999999997 23.3 115-119 20.18 29.025000000000002 28.055000000000003 22.74 120-124 20.705000000000002 28.12 27.805000000000003 23.369999999999997 125-129 19.72 28.37 27.915 23.995 130-134 20.11 29.110000000000003 27.67 23.11 135-139 19.805 29.25 27.015 23.93 140-144 20.135 29.075 27.35 23.44 145-149 19.955000000000002 28.725 27.16 24.16 150-151 19.9125 28.462500000000002 28.075 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 2.5 21 3.5 22 3.5 23 3.5 24 2.5 25 5.0 26 8.5 27 7.5 28 7.5 29 15.5 30 28.0 31 41.0 32 45.5 33 44.5 34 59.5 35 84.5 36 103.0 37 128.5 38 171.5 39 178.0 40 195.5 41 220.0 42 231.5 43 263.0 44 269.5 45 276.5 46 259.5 47 240.5 48 227.5 49 184.5 50 156.0 51 129.0 52 95.5 53 77.0 54 60.0 55 50.0 56 39.5 57 21.0 58 15.0 59 13.0 60 6.0 61 4.5 62 6.5 63 5.5 64 3.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.22601707684580613 0.44999999999999996 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.7999999999999998 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGGG 10 0.0068378756 144.95 145 >>END_MODULE SRR7170443 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.896 33.0 33.0 34.0 32.0 34.0 2 33.0815 34.0 33.0 34.0 32.0 34.0 3 33.1335 34.0 33.0 34.0 33.0 34.0 4 33.085 34.0 33.0 34.0 33.0 34.0 5 33.126 34.0 33.0 34.0 33.0 34.0 6 37.37275 38.0 38.0 38.0 37.0 38.0 7 37.43675 38.0 38.0 38.0 38.0 38.0 8 37.335 38.0 38.0 38.0 37.0 38.0 9 37.32925 38.0 38.0 38.0 37.0 38.0 10-14 37.3223 38.0 38.0 38.0 37.0 38.0 15-19 37.33540000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.32675 38.0 38.0 38.0 37.0 38.0 25-29 37.2436 38.0 38.0 38.0 37.0 38.0 30-34 37.16779999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.20270000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.183550000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.164 38.0 38.0 38.0 37.0 38.0 50-54 37.08285 38.0 38.0 38.0 36.8 38.0 55-59 37.068799999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.004 38.0 38.0 38.0 36.2 38.0 65-69 36.9469 38.0 38.0 38.0 36.0 38.0 70-74 36.8945 38.0 38.0 38.0 36.0 38.0 75-79 36.831399999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.76135 38.0 38.0 38.0 35.6 38.0 85-89 36.66850000000001 38.0 38.0 38.0 35.0 38.0 90-94 36.50165 38.0 38.0 38.0 34.2 38.0 95-99 36.4464 38.0 38.0 38.0 34.2 38.0 100-104 36.2635 38.0 37.6 38.0 33.8 38.0 105-109 36.0966 38.0 37.6 38.0 33.6 38.0 110-114 35.973400000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.78575 38.0 37.0 38.0 31.6 38.0 120-124 35.42905 38.0 36.6 38.0 30.6 38.0 125-129 34.96915 38.0 36.0 38.0 28.8 38.0 130-134 34.382 38.0 34.2 38.0 26.0 38.0 135-139 33.772000000000006 38.0 33.0 38.0 23.0 38.0 140-144 33.03165 38.0 33.0 38.0 18.6 38.0 145-149 31.989500000000003 38.0 33.0 38.0 10.8 38.0 150-151 25.81625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 3.0 5 3.0 6 1.0 7 3.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 4.0 15 3.0 16 2.0 17 1.0 18 5.0 19 9.0 20 4.0 21 6.0 22 11.0 23 6.0 24 7.0 25 5.0 26 19.0 27 24.0 28 26.0 29 30.0 30 39.0 31 63.0 32 61.0 33 106.0 34 179.0 35 337.0 36 845.0 37 2188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.906906906906908 20.595595595595594 16.99199199199199 30.505505505505504 2 25.825825825825827 25.275275275275277 32.80780780780781 16.09109109109109 3 19.244244244244243 27.602602602602605 33.50850850850851 19.644644644644647 4 22.07207207207207 34.25925925925926 24.5995995995996 19.06906906906907 5 24.93116395494368 34.69336670838548 23.479349186483102 16.896120150187734 6 18.625 38.925 24.425 18.025 7 19.0 20.775 40.225 20.0 8 21.45 25.074999999999996 28.499999999999996 24.975 9 21.5 25.074999999999996 31.4 22.025 10-14 23.09 29.57 26.810000000000002 20.53 15-19 22.384476895379077 28.075615123024605 28.305661132226444 21.23424684936987 20-24 22.732049036777582 28.486364773580185 28.501376032024016 20.280210157618214 25-29 22.67540786708037 28.330497447702935 28.500650585526976 20.49344409968972 30-34 22.468592021622705 28.71515090845388 28.13454126833175 20.681715801591672 35-39 22.848991441013062 28.294709444917167 28.39981981080134 20.45647930326843 40-44 22.867867867867865 28.64864864864865 27.902902902902905 20.58058058058058 45-49 22.854426262322974 28.559275384076464 28.053845768903567 20.53245258469699 50-54 22.499124255617275 28.709402992543666 28.203973377370765 20.587499374468297 55-59 22.466850137603203 28.32124093069802 28.75656742556918 20.4553415061296 60-64 22.523018414731784 27.587069655724576 29.133306645316253 20.75660528422738 65-69 22.74115232517395 27.671822595985386 28.407668819142014 21.179356259698654 70-74 22.50538226605918 28.203074150102637 28.243128223101188 21.048415360736993 75-79 23.02723813338674 27.989184858802325 28.359703585019027 20.62387342279191 80-84 22.944828276759786 28.572143786923 27.761089416241113 20.7219385200761 85-89 23.073456511942318 28.06569525812428 28.396174452956785 20.464673776976618 90-94 23.00375469336671 28.53566958698373 27.574468085106385 20.88610763454318 95-99 23.00530583642006 28.13594954449895 28.080888977875663 20.777855641205324 100-104 23.885079333299966 28.074478202112218 27.92432053656339 20.116121928024423 105-109 23.138138138138135 28.423423423423422 28.553553553553552 19.884884884884883 110-114 23.77496371189749 28.209620101106157 28.039441413484155 19.97597477351219 115-119 23.833600320384463 28.12875450540649 27.848418101722068 20.189227072486986 120-124 23.745618427641464 28.39759639459189 28.28743114672008 19.569354031046572 125-129 24.104772875244155 28.431912655882208 27.830921019682474 19.632393449191166 130-134 24.32121029956918 27.89800621180242 27.89800621180242 19.88277727682597 135-139 23.87678437265214 27.783621337340346 28.149261207112446 20.190333082895066 140-144 23.36589030803907 28.484848484848484 27.933884297520663 20.215376909591786 145-149 24.53302619059542 28.03845961239922 27.427512644599126 20.00100155240623 150-151 24.718397997496872 28.16020025031289 27.684605757196497 19.43679599499374 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 2.5 23 4.0 24 5.0 25 3.5 26 6.5 27 8.5 28 10.5 29 13.5 30 19.5 31 28.0 32 35.5 33 44.5 34 62.0 35 80.0 36 87.5 37 118.0 38 154.0 39 179.0 40 220.0 41 246.5 42 266.5 43 276.5 44 283.0 45 288.0 46 252.0 47 233.5 48 208.5 49 174.5 50 140.0 51 114.5 52 101.5 53 72.0 54 56.0 55 51.5 56 43.0 57 28.0 58 19.0 59 14.0 60 14.0 61 10.5 62 8.5 63 6.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.075 25-29 0.09 30-34 0.105 35-39 0.105 40-44 0.1 45-49 0.08499999999999999 50-54 0.08499999999999999 55-59 0.075 60-64 0.08 65-69 0.11499999999999999 70-74 0.135 75-79 0.13999999999999999 80-84 0.13 85-89 0.145 90-94 0.125 95-99 0.11 100-104 0.105 105-109 0.1 110-114 0.105 115-119 0.12 120-124 0.15 125-129 0.165 130-134 0.19 135-139 0.17500000000000002 140-144 0.17500000000000002 145-149 0.155 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49482192472847 98.475 2 0.35362465269007326 0.7000000000000001 3 0.025258903763576663 0.075 4 0.0 0.0 5 0.050517807527153326 0.25 6 0.050517807527153326 0.3 7 0.0 0.0 8 0.025258903763576663 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit ATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTG 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.625 0.0 0.0 0.0 0.0 136-137 4.9125 0.0 0.0 0.0 0.0 138-139 5.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762217 spots for SRR7170443.sra Written 762217 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra Read 762199 spots for SRR7170443.sra Written 762199 spots for SRR7170443.sra SRR ids: ['SRR7170443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yqz_lw3f SRR7170443.sra spots: 15243998 blocks: [[1, 762199], [762200, 1524398], [1524399, 2286597], [2286598, 3048796], [3048797, 3810995], [3810996, 4573194], [4573195, 5335393], [5335394, 6097592], [6097593, 6859791], [6859792, 7621990], [7621991, 8384189], [8384190, 9146388], [9146389, 9908587], [9908588, 10670786], [10670787, 11432985], [11432986, 12195184], [12195185, 12957383], [12957384, 13719582], [13719583, 14481781], [14481782, 15243998]] SRR7170443 file size 5143990 SRR7170443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170443 SRR7170443_1.fastq SRR7170443_2.fastq Input file: SRR7170443_1.fastq Paired file: SRR7170443_2.fastq trimmed: SRR7170443-trimmed-pair1.fastq, SRR7170443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:52:33 2025 >> started Wed Feb 12 19:52:49 2025 >> done (15.759s) 15243998 read pairs processed; of these: 13598 ( 0.09%) short read pairs filtered out after trimming by size control 17800 ( 0.12%) empty read pairs filtered out after trimming by size control 15212600 (99.79%) read pairs available; of these: 9599689 (63.10%) trimmed read pairs available after processing 5612911 (36.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 10 0.00% 31 5 0.00% 32 8 0.00% 33 7 0.00% 34 9 0.00% 35 12 0.00% 36 7 0.00% 37 4 0.00% 38 7 0.00% 39 13 0.00% 40 14 0.00% 41 23 0.00% 42 23 0.00% 43 21 0.00% 44 17 0.00% 45 29 0.00% 46 34 0.00% 47 38 0.00% 48 48 0.00% 49 49 0.00% 50 52 0.00% 51 64 0.00% 52 82 0.00% 53 82 0.00% 54 93 0.00% 55 114 0.00% 56 139 0.00% 57 139 0.00% 58 159 0.00% 59 201 0.00% 60 219 0.00% 61 273 0.00% 62 278 0.00% 63 316 0.00% 64 393 0.00% 65 413 0.00% 66 449 0.00% 67 526 0.00% 68 556 0.00% 69 671 0.00% 70 776 0.01% 71 891 0.01% 72 1022 0.01% 73 1194 0.01% 74 1373 0.01% 75 1478 0.01% 76 1679 0.01% 77 1828 0.01% 78 1954 0.01% 79 2206 0.01% 80 2408 0.02% 81 2871 0.02% 82 3374 0.02% 83 3859 0.03% 84 4652 0.03% 85 5090 0.03% 86 5153 0.03% 87 5428 0.04% 88 5472 0.04% 89 5944 0.04% 90 6205 0.04% 91 6940 0.05% 92 7455 0.05% 93 8521 0.06% 94 8835 0.06% 95 9505 0.06% 96 10064 0.07% 97 10636 0.07% 98 10947 0.07% 99 11223 0.07% 100 12118 0.08% 101 12550 0.08% 102 13209 0.09% 103 14054 0.09% 104 14867 0.10% 105 15667 0.10% 106 16779 0.11% 107 17298 0.11% 108 17323 0.11% 109 17921 0.12% 110 18241 0.12% 111 19122 0.13% 112 19614 0.13% 113 20627 0.14% 114 21553 0.14% 115 22659 0.15% 116 23472 0.15% 117 24095 0.16% 118 25069 0.16% 119 25397 0.17% 120 26299 0.17% 121 27504 0.18% 122 28402 0.19% 123 29546 0.19% 124 31149 0.20% 125 32450 0.21% 126 34265 0.23% 127 36197 0.24% 128 37652 0.25% 129 40100 0.26% 130 42668 0.28% 131 45071 0.30% 132 48736 0.32% 133 52122 0.34% 134 55861 0.37% 135 60767 0.40% 136 65841 0.43% 137 72251 0.47% 138 79494 0.52% 139 88506 0.58% 140 98520 0.65% 141 114505 0.75% 142 130814 0.86% 143 154015 1.01% 144 189265 1.24% 145 235789 1.55% 146 312373 2.05% 147 449525 2.95% 148 698902 4.59% 149 1346060 8.85% 150 4408801 28.98% 151 5612911 36.90% 15212600 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.0 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=66.78 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCAT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.5 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=202.36 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.6 sequence=TTGTTGCTGAGGAGTACGATGAGGAGAAGCAGACCGAAAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGATCAACAAGATATCACCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAGTTCTTATGAGTACCTCAGTCAAGGTCTTCGTACGTACAACCTGGACAACATGATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGATTGTTGTTCACATCTCCAAGAACTTCATGAGCCTGCCTAATATCAAGGTTCCTCTCATCTTGGGTATTTGGGGAGGCAAAGGTCAAGGAAAATCCTTCCAGTGTGAACTGGTCTTTGCCAAGATGGGAATTAGCCCAATCATGATGAGTGCCGGAGAATTGGAAAGTGGAAACGCTGGTGAACCCGCAAAACTTATCAGGCAAAGGTACCGTGAGGCGGCTGATATAATCAAGAAGAAGGGAAAGATGTGCTG SRR7170443 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:53:36 Started mapping on | Feb 12 19:53:36 Finished on | Feb 12 19:55:20 Mapping speed, Million of reads per hour | 526.59 Number of input reads | 15212600 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14318787 Uniquely mapped reads % | 94.12% Average mapped length | 292.73 Number of splices: Total | 14140806 Number of splices: Annotated (sjdb) | 13740996 Number of splices: GT/AG | 13885359 Number of splices: GC/AG | 196161 Number of splices: AT/AC | 8549 Number of splices: Non-canonical | 50737 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442083 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 28931 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 459859 459859 459859 N_multimapping 442083 442083 442083 N_noFeature 638647 14067346 711839 N_ambiguous 327488 1023 148767 UnstrandedReadsAssigned:13352652 PositiveStrandReadsAssigned:250418 NegativeStrandReadsAssigned:13458181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170443-trimmed-pair1.fastq SRR7170443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,212,600 reads, 13,270,040 reads pseudoaligned [quant] estimated average fragment length: 277.355 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7170443.ke.tsv 34699 SRR7170443.se.tsv 87100 total ==> SRR7170443.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.64 1098 42.5132 Potri.005G024800.1.v4.1 1035 758.645 279 24.7997 Potri.004G059700.1.v4.1 961 684.672 4 0.393966 Potri.007G009000.2.v4.1 1416 1139.64 0 0 Potri.003G141000.2.v4.1 2943 2666.64 767.748 19.4149 Potri.016G087400.1.v4.1 270 77.5653 1063 924.16 Potri.015G069301.1.v4.1 564 293.684 0 0 Potri.010G195200.1.v4.1 1773 1496.64 294 13.2468 Potri.012G127500.1.v4.1 977 700.656 154 14.8217 ==> SRR7170443.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 348 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 146 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 SRR7170443 completed mapping pipeline successfully