Starting /dee2/code/volunteer_pipeline.sh SRR7170444 current disk space = 3050856112128 free memory = 1579854044 SRR7170444 SRAfilesize f61d2e034cc9addc72bec7264837566c SRR7170444.sra SRR7170444.sra file validated SRR7170444 is paired end SRR7170444 is conventional basespace SRR7170444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5705 30.0 18.0 33.0 18.0 34.0 2 30.0885 31.0 29.0 33.0 25.0 33.0 3 32.11425 33.0 31.0 33.0 29.0 34.0 4 32.64675 33.0 33.0 33.0 31.0 34.0 5 33.15475 33.0 33.0 34.0 33.0 34.0 6 37.22925 38.0 38.0 38.0 36.0 38.0 7 37.509 38.0 38.0 38.0 37.0 38.0 8 37.59225 38.0 38.0 38.0 38.0 38.0 9 37.6225 38.0 38.0 38.0 38.0 38.0 10-14 37.65645 38.0 38.0 38.0 38.0 38.0 15-19 37.6242 38.0 38.0 38.0 38.0 38.0 20-24 37.469550000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.17695 38.0 38.0 38.0 36.6 38.0 30-34 37.473650000000006 38.0 38.0 38.0 37.6 38.0 35-39 37.51505 38.0 38.0 38.0 38.0 38.0 40-44 36.99465 38.0 38.0 38.0 35.8 38.0 45-49 34.941449999999996 37.8 34.8 38.0 27.8 38.0 50-54 37.170550000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.37579999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.23635 38.0 38.0 38.0 36.4 38.0 65-69 37.1506 38.0 38.0 38.0 36.0 38.0 70-74 37.09785 38.0 38.0 38.0 36.0 38.0 75-79 37.0734 38.0 38.0 38.0 36.0 38.0 80-84 36.949349999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.71725 38.0 38.0 38.0 34.8 38.0 90-94 36.47965 38.0 38.0 38.0 34.0 38.0 95-99 36.69539999999999 38.0 38.0 38.0 34.8 38.0 100-104 36.58675000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.50735 38.0 38.0 38.0 34.0 38.0 110-114 36.0329 38.0 37.2 38.0 33.0 38.0 115-119 35.6303 38.0 36.4 38.0 31.2 38.0 120-124 35.6155 38.0 36.4 38.0 31.0 38.0 125-129 35.4885 38.0 36.0 38.0 31.0 38.0 130-134 35.20895 38.0 36.0 38.0 29.4 38.0 135-139 34.42004999999999 38.0 34.2 38.0 26.2 38.0 140-144 29.0216 33.4 23.4 37.0 16.6 38.0 145-149 26.633300000000002 32.8 15.6 37.6 4.2 38.0 150-151 16.36225 7.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 5.0 21 5.0 22 5.0 23 7.0 24 11.0 25 17.0 26 15.0 27 22.0 28 35.0 29 36.0 30 56.0 31 69.0 32 106.0 33 166.0 34 320.0 35 616.0 36 1451.0 37 1051.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.514052120592744 11.573837506387328 9.070005109862034 36.84210526315789 2 22.166624968726545 14.686014510883163 34.52589442081561 28.621466099574683 3 20.150000000000002 20.25 25.650000000000002 33.95 4 23.375 29.5 21.825 25.3 5 21.775 33.225 24.85 20.150000000000002 6 18.425 35.575 26.3 19.7 7 13.775 24.975 43.4 17.849999999999998 8 17.525 25.1 32.225 25.15 9 17.05 24.325 35.35 23.275000000000002 10-14 19.435 30.345 27.455000000000002 22.765 15-19 19.615 28.42 28.23 23.735 20-24 20.21 28.705000000000002 27.93 23.155 25-29 20.16 28.975 27.650000000000002 23.215 30-34 19.805 29.065 27.42 23.71 35-39 19.67 28.560000000000002 27.765 24.005000000000003 40-44 20.11 28.68 27.750000000000004 23.46 45-49 19.994999999999997 28.549999999999997 27.744999999999997 23.71 50-54 20.369999999999997 28.134999999999998 27.92 23.575 55-59 19.645000000000003 28.810000000000002 27.295 24.25 60-64 19.869999999999997 28.54 27.415 24.175 65-69 20.3 27.99 27.915 23.794999999999998 70-74 20.308046206931042 28.654298144721707 27.604140621093165 23.43351502725409 75-79 20.3 28.035 28.07 23.595 80-84 20.095 29.185 27.12 23.599999999999998 85-89 20.544999999999998 28.275 27.41 23.77 90-94 20.4801200300075 29.08227056764191 27.176794198549636 23.26081520380095 95-99 20.42204220422042 28.72787278727873 27.47274727472747 23.377337733773377 100-104 20.71 28.634999999999998 27.439999999999998 23.215 105-109 20.235 28.84 27.235 23.69 110-114 20.535 28.43 28.4 22.634999999999998 115-119 21.015 28.38 27.425 23.18 120-124 20.630000000000003 28.435 27.16 23.775 125-129 20.495 28.27 27.500000000000004 23.735 130-134 20.54 28.84 27.279999999999998 23.34 135-139 20.73 27.93 27.46 23.880000000000003 140-144 20.785 28.84 27.395000000000003 22.98 145-149 20.48 28.13 27.51 23.880000000000003 150-151 19.950000000000003 29.2 27.125 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 3.0 25 4.0 26 3.5 27 5.0 28 6.5 29 11.0 30 21.0 31 29.5 32 31.5 33 39.5 34 58.0 35 82.0 36 103.0 37 116.5 38 140.5 39 161.5 40 175.5 41 202.5 42 243.5 43 256.0 44 256.0 45 271.0 46 255.5 47 234.5 48 229.5 49 221.5 50 186.0 51 150.0 52 127.5 53 94.0 54 66.0 55 52.0 56 44.5 57 33.5 58 26.5 59 21.0 60 14.5 61 6.5 62 3.0 63 3.0 64 0.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.112500000000001 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 4.925000000000001 0.0 0.0 0.0 0.0 138-139 5.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGCA 10 0.006830828 145.0 3 AAAAAAA 30 0.0014437955 24.166668 55-59 >>END_MODULE SRR7170444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99075 33.0 33.0 34.0 32.0 34.0 2 33.02425 34.0 33.0 34.0 32.0 34.0 3 32.99625 34.0 33.0 34.0 32.0 34.0 4 32.923 34.0 33.0 34.0 32.0 34.0 5 32.98275 34.0 33.0 34.0 32.0 34.0 6 37.04225 38.0 38.0 38.0 37.0 38.0 7 37.21225 38.0 38.0 38.0 37.0 38.0 8 37.2265 38.0 38.0 38.0 37.0 38.0 9 37.2015 38.0 38.0 38.0 37.0 38.0 10-14 36.225199999999994 38.0 36.2 38.0 32.8 38.0 15-19 36.697950000000006 38.0 37.4 38.0 34.6 38.0 20-24 36.67 38.0 38.0 38.0 35.0 38.0 25-29 36.691649999999996 38.0 38.0 38.0 35.2 38.0 30-34 36.96855000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.97545 38.0 38.0 38.0 36.2 38.0 40-44 37.0196 38.0 38.0 38.0 36.6 38.0 45-49 35.862300000000005 38.0 35.8 38.0 30.8 38.0 50-54 35.931900000000006 38.0 36.4 38.0 30.2 38.0 55-59 36.9442 38.0 38.0 38.0 36.0 38.0 60-64 36.7545 38.0 38.0 38.0 35.4 38.0 65-69 36.609300000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.62135 38.0 38.0 38.0 34.8 38.0 75-79 36.643800000000006 38.0 38.0 38.0 34.8 38.0 80-84 36.594 38.0 38.0 38.0 34.8 38.0 85-89 36.49175 38.0 38.0 38.0 34.6 38.0 90-94 36.50515 38.0 38.0 38.0 34.0 38.0 95-99 36.3129 38.0 38.0 38.0 34.0 38.0 100-104 36.08535 38.0 37.6 38.0 33.0 38.0 105-109 35.80595 38.0 37.0 38.0 32.2 38.0 110-114 35.91085 38.0 37.0 38.0 33.0 38.0 115-119 35.64425 38.0 37.0 38.0 31.0 38.0 120-124 35.063300000000005 38.0 35.8 38.0 28.0 38.0 125-129 34.451 38.0 34.8 38.0 25.0 38.0 130-134 34.43195000000001 38.0 34.8 38.0 25.8 38.0 135-139 33.6557 38.0 33.0 38.0 21.6 38.0 140-144 32.83765 38.0 33.0 38.0 16.8 38.0 145-149 31.97935 38.0 33.0 38.0 10.6 38.0 150-151 26.0735 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 0.0 6 1.0 7 3.0 8 2.0 9 1.0 10 3.0 11 0.0 12 0.0 13 4.0 14 2.0 15 0.0 16 1.0 17 4.0 18 8.0 19 6.0 20 13.0 21 8.0 22 8.0 23 9.0 24 22.0 25 19.0 26 23.0 27 30.0 28 33.0 29 47.0 30 43.0 31 74.0 32 82.0 33 143.0 34 206.0 35 337.0 36 828.0 37 2031.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 20.625 13.825000000000001 27.875 2 27.025 26.200000000000003 30.725 16.05 3 19.575 29.799999999999997 31.275 19.35 4 22.725 34.35 23.225 19.7 5 24.75 37.675 21.6 15.975 6 21.3 37.974999999999994 23.0 17.724999999999998 7 19.575 21.3 38.95 20.175 8 22.625 26.125 26.700000000000003 24.55 9 22.5 25.224999999999998 29.175 23.1 10-14 23.685000000000002 29.220000000000002 26.634999999999998 20.46 15-19 22.955000000000002 28.1 27.965 20.979999999999997 20-24 22.89 28.24 27.465 21.404999999999998 25-29 22.759999999999998 28.425 27.839999999999996 20.974999999999998 30-34 22.16 28.470000000000002 28.189999999999998 21.18 35-39 22.39 28.310000000000002 28.12 21.18 40-44 22.93 28.055000000000003 27.694999999999997 21.32 45-49 22.205 28.194999999999997 28.33 21.27 50-54 22.895 27.67 28.765 20.669999999999998 55-59 23.05 26.900000000000002 28.595 21.455 60-64 22.63 27.560000000000002 28.43 21.38 65-69 23.064999999999998 27.744999999999997 27.965 21.224999999999998 70-74 23.21 27.334999999999997 28.139999999999997 21.315 75-79 23.0 28.185 27.98 20.835 80-84 23.150000000000002 28.005000000000003 27.834999999999997 21.01 85-89 22.88 28.060000000000002 27.894999999999996 21.165 90-94 23.335 28.08 27.855 20.73 95-99 23.255 28.22 27.800000000000004 20.724999999999998 100-104 23.515 27.894999999999996 27.73 20.86 105-109 23.485 27.750000000000004 28.139999999999997 20.625 110-114 23.400000000000002 28.28 27.49 20.830000000000002 115-119 23.875 27.71 27.605 20.810000000000002 120-124 23.830000000000002 27.52 27.800000000000004 20.849999999999998 125-129 24.05 28.335 27.625 19.99 130-134 23.605 28.08 27.884999999999998 20.43 135-139 24.305 27.82 27.685 20.19 140-144 24.175 27.975 27.815 20.035 145-149 24.245 27.61 27.785 20.36 150-151 25.162499999999998 27.537499999999998 27.712500000000002 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 3.5 25 4.5 26 5.0 27 6.5 28 9.0 29 10.5 30 14.5 31 22.0 32 32.0 33 42.5 34 52.0 35 64.0 36 82.5 37 116.0 38 149.5 39 164.5 40 186.5 41 223.5 42 255.5 43 273.0 44 277.5 45 255.0 46 252.5 47 259.5 48 226.5 49 195.5 50 173.5 51 133.5 52 97.0 53 89.0 54 83.0 55 64.5 56 46.0 57 34.0 58 24.0 59 19.5 60 15.5 61 11.0 62 7.5 63 5.0 64 3.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATCT 10 0.006830828 145.0 7 TTTTCAT 10 0.006830828 145.0 5 >>END_MODULE Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923629 spots for SRR7170444.sra Written 923629 spots for SRR7170444.sra Read 923644 spots for SRR7170444.sra Written 923644 spots for SRR7170444.sra SRR ids: ['SRR7170444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ozvs_uw5 SRR7170444.sra spots: 18472595 blocks: [[1, 923629], [923630, 1847258], [1847259, 2770887], [2770888, 3694516], [3694517, 4618145], [4618146, 5541774], [5541775, 6465403], [6465404, 7389032], [7389033, 8312661], [8312662, 9236290], [9236291, 10159919], [10159920, 11083548], [11083549, 12007177], [12007178, 12930806], [12930807, 13854435], [13854436, 14778064], [14778065, 15701693], [15701694, 16625322], [16625323, 17548951], [17548952, 18472595]] SRR7170444 file size 6238055 SRR7170444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170444 SRR7170444_1.fastq SRR7170444_2.fastq Input file: SRR7170444_1.fastq Paired file: SRR7170444_2.fastq trimmed: SRR7170444-trimmed-pair1.fastq, SRR7170444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:39:52 2025 >> started Wed Feb 12 20:40:13 2025 >> done (21.427s) 18472595 read pairs processed; of these: 13468 ( 0.07%) short read pairs filtered out after trimming by size control 13434 ( 0.07%) empty read pairs filtered out after trimming by size control 18445693 (99.85%) read pairs available; of these: 10285103 (55.76%) trimmed read pairs available after processing 8160590 (44.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 9 0.00% 21 3 0.00% 22 7 0.00% 23 8 0.00% 24 11 0.00% 25 5 0.00% 26 7 0.00% 27 9 0.00% 28 7 0.00% 29 5 0.00% 30 12 0.00% 31 7 0.00% 32 11 0.00% 33 9 0.00% 34 12 0.00% 35 18 0.00% 36 18 0.00% 37 25 0.00% 38 31 0.00% 39 28 0.00% 40 38 0.00% 41 41 0.00% 42 53 0.00% 43 54 0.00% 44 43 0.00% 45 68 0.00% 46 74 0.00% 47 75 0.00% 48 93 0.00% 49 135 0.00% 50 123 0.00% 51 157 0.00% 52 196 0.00% 53 215 0.00% 54 209 0.00% 55 243 0.00% 56 265 0.00% 57 312 0.00% 58 368 0.00% 59 403 0.00% 60 455 0.00% 61 559 0.00% 62 629 0.00% 63 708 0.00% 64 804 0.00% 65 859 0.00% 66 927 0.01% 67 1000 0.01% 68 1111 0.01% 69 1276 0.01% 70 1444 0.01% 71 1625 0.01% 72 1905 0.01% 73 2204 0.01% 74 2251 0.01% 75 2656 0.01% 76 3005 0.02% 77 3275 0.02% 78 3361 0.02% 79 3657 0.02% 80 4015 0.02% 81 4444 0.02% 82 5148 0.03% 83 5622 0.03% 84 6570 0.04% 85 7343 0.04% 86 7679 0.04% 87 8001 0.04% 88 8417 0.05% 89 8833 0.05% 90 9532 0.05% 91 10206 0.06% 92 10801 0.06% 93 11759 0.06% 94 12585 0.07% 95 13292 0.07% 96 13679 0.07% 97 14026 0.08% 98 14378 0.08% 99 14554 0.08% 100 15909 0.09% 101 16083 0.09% 102 17192 0.09% 103 17903 0.10% 104 18649 0.10% 105 19461 0.11% 106 19597 0.11% 107 20399 0.11% 108 20711 0.11% 109 21127 0.11% 110 21393 0.12% 111 22071 0.12% 112 23120 0.13% 113 23957 0.13% 114 24862 0.13% 115 25802 0.14% 116 26435 0.14% 117 27459 0.15% 118 27880 0.15% 119 28538 0.15% 120 29474 0.16% 121 30148 0.16% 122 31523 0.17% 123 33043 0.18% 124 34754 0.19% 125 36021 0.20% 126 37802 0.20% 127 39431 0.21% 128 40857 0.22% 129 42992 0.23% 130 44976 0.24% 131 47641 0.26% 132 50699 0.27% 133 54218 0.29% 134 57913 0.31% 135 62262 0.34% 136 67652 0.37% 137 73789 0.40% 138 81347 0.44% 139 89513 0.49% 140 100405 0.54% 141 113626 0.62% 142 130867 0.71% 143 153191 0.83% 144 185992 1.01% 145 230524 1.25% 146 296874 1.61% 147 411305 2.23% 148 642477 3.48% 149 1273778 6.91% 150 5093451 27.61% 151 8160590 44.24% 18445693 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=29.43 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=23.78 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=5.3 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170444 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:22 Started mapping on | Feb 12 20:41:23 Finished on | Feb 12 20:43:20 Mapping speed, Million of reads per hour | 567.56 Number of input reads | 18445693 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17355048 Uniquely mapped reads % | 94.09% Average mapped length | 293.59 Number of splices: Total | 16708987 Number of splices: Annotated (sjdb) | 16322841 Number of splices: GT/AG | 16381848 Number of splices: GC/AG | 270404 Number of splices: AT/AC | 10179 Number of splices: Non-canonical | 46556 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466174 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 17781 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638171 638171 638171 N_multimapping 466174 466174 466174 N_noFeature 615474 17124319 708490 N_ambiguous 271403 1211 132990 UnstrandedReadsAssigned:16468171 PositiveStrandReadsAssigned:229518 NegativeStrandReadsAssigned:16513568 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170444-trimmed-pair1.fastq SRR7170444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,445,693 reads, 16,450,432 reads pseudoaligned [quant] estimated average fragment length: 280.759 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7170444.ke.tsv 34699 SRR7170444.se.tsv 87100 total ==> SRR7170444.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.24 617 22.6776 Potri.005G024800.1.v4.1 1035 755.241 259 21.9097 Potri.004G059700.1.v4.1 961 681.289 19 1.78174 Potri.007G009000.2.v4.1 1416 1136.24 0 0 Potri.003G141000.2.v4.1 2943 2663.24 746.384 17.905 Potri.016G087400.1.v4.1 270 77.2277 868 718.072 Potri.015G069301.1.v4.1 564 291.656 0 0 Potri.010G195200.1.v4.1 1773 1493.24 19 0.812915 Potri.012G127500.1.v4.1 977 697.257 271 24.8312 ==> SRR7170444.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 305 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 89 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170444 completed mapping pipeline successfully