Starting /dee2/code/volunteer_pipeline.sh SRR7170445 current disk space = 3050895548416 free memory = 1579858128 SRR7170445 SRAfilesize 05aa8a7a941b47d7b2212fe8dc4453e8 SRR7170445.sra SRR7170445.sra file validated SRR7170445 is paired end SRR7170445 is conventional basespace SRR7170445 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.90925 25.0 18.0 33.0 18.0 33.0 2 24.56925 25.0 18.0 30.0 18.0 33.0 3 27.985 29.0 27.0 31.0 18.0 33.0 4 31.099 31.0 30.0 33.0 29.0 33.0 5 32.4105 33.0 32.0 33.0 32.0 33.0 6 35.77275 37.0 36.0 38.0 32.0 38.0 7 36.3445 38.0 36.0 38.0 34.0 38.0 8 36.99575 38.0 38.0 38.0 35.0 38.0 9 37.34125 38.0 38.0 38.0 36.0 38.0 10-14 37.4328 38.0 38.0 38.0 36.8 38.0 15-19 37.5208 38.0 38.0 38.0 37.0 38.0 20-24 37.5528 38.0 38.0 38.0 37.6 38.0 25-29 37.51535 38.0 38.0 38.0 37.8 38.0 30-34 37.5492 38.0 38.0 38.0 37.8 38.0 35-39 37.514300000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.43765 38.0 38.0 38.0 37.2 38.0 45-49 37.4316 38.0 38.0 38.0 37.0 38.0 50-54 37.3352 38.0 38.0 38.0 37.0 38.0 55-59 37.264599999999994 38.0 38.0 38.0 36.4 38.0 60-64 37.1794 38.0 38.0 38.0 36.0 38.0 65-69 37.15724999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.0202 38.0 38.0 38.0 36.0 38.0 75-79 36.94885 38.0 38.0 38.0 35.4 38.0 80-84 36.8844 38.0 38.0 38.0 35.4 38.0 85-89 36.74085 38.0 38.0 38.0 34.8 38.0 90-94 36.684000000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.47175 38.0 37.2 38.0 34.0 38.0 100-104 36.49255000000001 38.0 37.6 38.0 34.0 38.0 105-109 36.314800000000005 38.0 37.0 38.0 33.8 38.0 110-114 36.11985 38.0 37.0 38.0 33.2 38.0 115-119 35.6767 38.0 36.2 38.0 31.0 38.0 120-124 35.6238 38.0 36.0 38.0 31.0 38.0 125-129 35.35855 38.0 35.6 38.0 29.8 38.0 130-134 32.694 36.6 28.6 38.0 22.2 38.0 135-139 34.1974 38.0 33.4 38.0 25.2 38.0 140-144 30.93605 35.4 26.2 38.0 15.4 38.0 145-149 32.36395 37.4 32.0 38.0 14.0 38.0 150-151 27.841625 34.0 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 0.0 21 4.0 22 4.0 23 6.0 24 9.0 25 16.0 26 4.0 27 21.0 28 23.0 29 32.0 30 57.0 31 58.0 32 81.0 33 137.0 34 248.0 35 520.0 36 1449.0 37 1322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.684934998725467 9.457048177415244 10.349222533775173 48.50879429008412 2 18.638979234425822 13.610207655741807 32.749562171628725 35.001250938203654 3 17.7 19.55 25.724999999999998 37.025000000000006 4 21.5 27.750000000000004 23.7 27.05 5 22.425 30.15 26.0 21.425 6 18.9 34.625 26.25 20.225 7 13.525 24.2 42.65 19.625 8 17.025000000000002 26.3 32.0 24.675 9 17.45 24.85 34.425 23.275000000000002 10-14 18.945 30.23 27.435 23.39 15-19 18.675 28.360000000000003 28.585 24.38 20-24 18.895 28.865000000000002 28.249999999999996 23.990000000000002 25-29 19.39 29.195 27.589999999999996 23.825 30-34 19.46 29.365000000000002 27.515 23.66 35-39 19.85 28.76 28.105000000000004 23.285 40-44 19.805 28.910000000000004 27.33 23.955000000000002 45-49 20.369999999999997 28.585 27.715 23.330000000000002 50-54 19.29 29.580000000000002 26.88 24.25 55-59 19.46 28.655 27.71 24.175 60-64 19.689999999999998 28.225 28.34 23.745 65-69 19.405 28.744999999999997 27.435 24.415 70-74 19.585 28.084999999999997 27.875 24.455 75-79 20.165 28.549999999999997 27.889999999999997 23.395 80-84 20.135 28.155 27.85 23.86 85-89 20.575 28.335 27.195000000000004 23.895 90-94 20.055 27.725 27.98 24.240000000000002 95-99 20.41 27.79 28.03 23.77 100-104 20.330000000000002 28.125 27.54 24.005000000000003 105-109 20.82 27.805000000000003 27.71 23.665 110-114 20.505000000000003 27.775 28.215 23.505000000000003 115-119 20.46 27.71 27.76 24.07 120-124 20.615 28.27 26.91 24.205 125-129 20.755000000000003 27.634999999999998 27.800000000000004 23.810000000000002 130-134 20.285 27.63 27.72 24.365000000000002 135-139 20.645 27.61 27.505000000000003 24.240000000000002 140-144 20.91 27.435 27.875 23.78 145-149 20.43 27.655 27.73 24.185000000000002 150-151 21.0375 27.237499999999997 27.8875 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.0 24 1.0 25 3.0 26 5.5 27 9.0 28 9.5 29 13.5 30 21.5 31 26.5 32 33.5 33 46.0 34 60.5 35 83.0 36 106.0 37 115.0 38 140.5 39 171.0 40 179.5 41 180.0 42 226.5 43 264.0 44 272.0 45 260.0 46 235.5 47 264.0 48 254.0 49 205.0 50 178.5 51 148.0 52 108.5 53 87.0 54 65.5 55 52.0 56 56.5 57 37.0 58 19.5 59 18.5 60 14.5 61 8.5 62 5.0 63 3.5 64 1.5 65 1.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83367139959432 97.45 2 0.9381338742393509 1.8499999999999999 3 0.2028397565922921 0.6 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.0999999999999996 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.6500000000000004 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAACC 10 0.006830828 145.0 145 >>END_MODULE SRR7170445 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0515 33.0 33.0 34.0 32.0 34.0 2 33.13875 34.0 33.0 34.0 33.0 34.0 3 33.151 34.0 33.0 34.0 33.0 34.0 4 33.15075 34.0 33.0 34.0 33.0 34.0 5 33.16775 34.0 33.0 34.0 33.0 34.0 6 37.38925 38.0 38.0 38.0 37.0 38.0 7 37.341 38.0 38.0 38.0 37.0 38.0 8 37.355 38.0 38.0 38.0 37.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.28465 38.0 38.0 38.0 37.2 38.0 15-19 36.6008 38.0 37.8 38.0 33.8 38.0 20-24 37.15925 38.0 38.0 38.0 37.0 38.0 25-29 37.0988 38.0 38.0 38.0 36.8 38.0 30-34 37.2093 38.0 38.0 38.0 37.0 38.0 35-39 37.262299999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.180949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.1331 38.0 38.0 38.0 37.0 38.0 50-54 37.07925 38.0 38.0 38.0 36.4 38.0 55-59 37.11935 38.0 38.0 38.0 36.8 38.0 60-64 37.0106 38.0 38.0 38.0 36.0 38.0 65-69 37.000099999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.93525 38.0 38.0 38.0 36.2 38.0 75-79 36.90214999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.86875 38.0 38.0 38.0 36.0 38.0 85-89 36.18725 38.0 37.4 38.0 31.2 38.0 90-94 34.48934999999999 37.8 34.4 38.0 23.4 38.0 95-99 36.42375 38.0 37.8 38.0 34.0 38.0 100-104 36.366200000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.182300000000005 38.0 37.8 38.0 33.8 38.0 110-114 36.130700000000004 38.0 37.2 38.0 33.8 38.0 115-119 35.9073 38.0 37.0 38.0 32.6 38.0 120-124 35.49475 38.0 36.4 38.0 31.0 38.0 125-129 35.163199999999996 38.0 36.0 38.0 30.0 38.0 130-134 34.88145 38.0 35.4 38.0 29.2 38.0 135-139 34.2761 38.0 34.0 38.0 25.8 38.0 140-144 33.44045 38.0 33.0 38.0 21.4 38.0 145-149 32.28135 38.0 33.0 38.0 12.8 38.0 150-151 26.600625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 2.0 13 0.0 14 1.0 15 2.0 16 4.0 17 1.0 18 5.0 19 6.0 20 4.0 21 9.0 22 11.0 23 4.0 24 4.0 25 11.0 26 24.0 27 20.0 28 18.0 29 44.0 30 41.0 31 53.0 32 75.0 33 101.0 34 174.0 35 363.0 36 875.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.9 20.7 15.35 28.050000000000004 2 26.75 26.875 30.025000000000002 16.35 3 20.150000000000002 28.749999999999996 31.15 19.950000000000003 4 23.474999999999998 33.625 23.425 19.475 5 24.725 35.0 22.525000000000002 17.75 6 19.3 37.05 24.8 18.85 7 19.900000000000002 20.25 38.925 20.925 8 22.125 26.1 26.3 25.474999999999998 9 21.425 25.724999999999998 30.5 22.35 10-14 23.5 28.694999999999997 26.745 21.060000000000002 15-19 22.915 28.634999999999998 27.365000000000002 21.085 20-24 23.04 28.994999999999997 27.435 20.53 25-29 23.745 28.355000000000004 27.215 20.685000000000002 30-34 23.294999999999998 28.455000000000002 27.474999999999998 20.775 35-39 23.41 27.839999999999996 27.944999999999997 20.805 40-44 22.79 28.455000000000002 27.265 21.490000000000002 45-49 23.24 27.925 27.275 21.560000000000002 50-54 22.759999999999998 28.754999999999995 26.974999999999998 21.51 55-59 23.54 27.575 27.455000000000002 21.43 60-64 23.095 28.065 28.02 20.82 65-69 23.855 27.839999999999996 26.945000000000004 21.36 70-74 23.36 29.175 26.75 20.715 75-79 23.22 28.12 26.955000000000002 21.705 80-84 23.595 28.384999999999998 26.479999999999997 21.54 85-89 24.02 27.765 27.455000000000002 20.76 90-94 23.21 28.225 27.589999999999996 20.974999999999998 95-99 24.310000000000002 28.065 27.395000000000003 20.23 100-104 24.01 28.375 27.05 20.565 105-109 23.855 28.549999999999997 27.38 20.215 110-114 24.075 28.134999999999998 27.155 20.635 115-119 24.46 28.465 26.58 20.495 120-124 24.29 28.865000000000002 26.625 20.22 125-129 24.345 28.59 26.840000000000003 20.225 130-134 24.92 28.144999999999996 26.935 20.0 135-139 24.07 28.155 27.060000000000002 20.715 140-144 24.44 29.09 26.825 19.645000000000003 145-149 24.97 28.189999999999998 27.21 19.63 150-151 25.174999999999997 27.6 27.900000000000002 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 3.0 28 5.0 29 8.0 30 10.0 31 16.5 32 25.0 33 30.5 34 42.0 35 52.0 36 79.5 37 103.5 38 116.5 39 161.0 40 200.0 41 219.0 42 252.0 43 287.0 44 296.5 45 272.5 46 254.0 47 250.0 48 239.0 49 224.5 50 182.0 51 139.0 52 118.0 53 99.0 54 89.0 55 72.5 56 46.0 57 29.5 58 20.0 59 15.0 60 13.0 61 7.5 62 5.0 63 5.0 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13705583756345 97.65 2 0.6345177664974619 1.25 3 0.12690355329949238 0.375 4 0.0 0.0 5 0.0 0.0 6 0.050761421319796954 0.3 7 0.025380710659898477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025380710659898477 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501612 spots for SRR7170445.sra Written 501612 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra Read 501605 spots for SRR7170445.sra Written 501605 spots for SRR7170445.sra SRR ids: ['SRR7170445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__mrcpmrf SRR7170445.sra spots: 10032107 blocks: [[1, 501605], [501606, 1003210], [1003211, 1504815], [1504816, 2006420], [2006421, 2508025], [2508026, 3009630], [3009631, 3511235], [3511236, 4012840], [4012841, 4514445], [4514446, 5016050], [5016051, 5517655], [5517656, 6019260], [6019261, 6520865], [6520866, 7022470], [7022471, 7524075], [7524076, 8025680], [8025681, 8527285], [8527286, 9028890], [9028891, 9530495], [9530496, 10032107]] SRR7170445 file size 3377851 SRR7170445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170445 SRR7170445_1.fastq SRR7170445_2.fastq Input file: SRR7170445_1.fastq Paired file: SRR7170445_2.fastq trimmed: SRR7170445-trimmed-pair1.fastq, SRR7170445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:36:23 2025 >> started Wed Feb 12 20:36:37 2025 >> done (13.947s) 10032107 read pairs processed; of these: 8634 ( 0.09%) short read pairs filtered out after trimming by size control 13862 ( 0.14%) empty read pairs filtered out after trimming by size control 10009611 (99.78%) read pairs available; of these: 5791382 (57.86%) trimmed read pairs available after processing 4218229 (42.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 4 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 4 0.00% 33 4 0.00% 34 5 0.00% 35 8 0.00% 36 5 0.00% 37 7 0.00% 38 9 0.00% 39 14 0.00% 40 13 0.00% 41 10 0.00% 42 19 0.00% 43 20 0.00% 44 16 0.00% 45 22 0.00% 46 31 0.00% 47 26 0.00% 48 41 0.00% 49 54 0.00% 50 47 0.00% 51 57 0.00% 52 61 0.00% 53 72 0.00% 54 70 0.00% 55 83 0.00% 56 85 0.00% 57 96 0.00% 58 132 0.00% 59 151 0.00% 60 177 0.00% 61 194 0.00% 62 233 0.00% 63 224 0.00% 64 264 0.00% 65 295 0.00% 66 345 0.00% 67 373 0.00% 68 415 0.00% 69 423 0.00% 70 529 0.01% 71 606 0.01% 72 736 0.01% 73 784 0.01% 74 862 0.01% 75 937 0.01% 76 1165 0.01% 77 1252 0.01% 78 1370 0.01% 79 1498 0.01% 80 1592 0.02% 81 1840 0.02% 82 2048 0.02% 83 2379 0.02% 84 3016 0.03% 85 3512 0.04% 86 3736 0.04% 87 3865 0.04% 88 4113 0.04% 89 4390 0.04% 90 4648 0.05% 91 4914 0.05% 92 5124 0.05% 93 5696 0.06% 94 6142 0.06% 95 6704 0.07% 96 6888 0.07% 97 7228 0.07% 98 7586 0.08% 99 7849 0.08% 100 8246 0.08% 101 8481 0.08% 102 9008 0.09% 103 9613 0.10% 104 10305 0.10% 105 10699 0.11% 106 11048 0.11% 107 11528 0.12% 108 11808 0.12% 109 12255 0.12% 110 12794 0.13% 111 12903 0.13% 112 13512 0.13% 113 14073 0.14% 114 14757 0.15% 115 15328 0.15% 116 15968 0.16% 117 16192 0.16% 118 16794 0.17% 119 17183 0.17% 120 17702 0.18% 121 18215 0.18% 122 18500 0.18% 123 19662 0.20% 124 20467 0.20% 125 21271 0.21% 126 22363 0.22% 127 23237 0.23% 128 24244 0.24% 129 25272 0.25% 130 26503 0.26% 131 27908 0.28% 132 29363 0.29% 133 31294 0.31% 134 33623 0.34% 135 36534 0.36% 136 39387 0.39% 137 43264 0.43% 138 47703 0.48% 139 52167 0.52% 140 58481 0.58% 141 65986 0.66% 142 74685 0.75% 143 87204 0.87% 144 105170 1.05% 145 130979 1.31% 146 167701 1.68% 147 237539 2.37% 148 369638 3.69% 149 735770 7.35% 150 2819913 28.17% 151 4218229 42.14% 10009611 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=26.57 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=27.99 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=1.3 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7170445 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:37:33 Started mapping on | Feb 12 20:37:33 Finished on | Feb 12 20:39:23 Mapping speed, Million of reads per hour | 327.59 Number of input reads | 10009611 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9184537 Uniquely mapped reads % | 91.76% Average mapped length | 293.65 Number of splices: Total | 9545000 Number of splices: Annotated (sjdb) | 9366553 Number of splices: GT/AG | 9376382 Number of splices: GC/AG | 141090 Number of splices: AT/AC | 5610 Number of splices: Non-canonical | 21918 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215221 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 11442 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.94% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 617833 617833 617833 N_multimapping 215221 215221 215221 N_noFeature 204998 8976767 247755 N_ambiguous 230569 576 65328 UnstrandedReadsAssigned:8748970 PositiveStrandReadsAssigned:207194 NegativeStrandReadsAssigned:8871454 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170445-trimmed-pair1.fastq SRR7170445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,009,611 reads, 8,781,991 reads pseudoaligned [quant] estimated average fragment length: 265.388 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7170445.ke.tsv 34699 SRR7170445.se.tsv 87100 total ==> SRR7170445.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.61 491 21.9955 Potri.005G024800.1.v4.1 1035 770.612 178 18.1456 Potri.004G059700.1.v4.1 961 696.652 13 1.46593 Potri.007G009000.2.v4.1 1416 1151.61 0 0 Potri.003G141000.2.v4.1 2943 2678.61 437 12.8162 Potri.016G087400.1.v4.1 270 75.6391 554 575.374 Potri.015G069301.1.v4.1 564 303.997 0 0 Potri.010G195200.1.v4.1 1773 1508.61 18 0.937306 Potri.012G127500.1.v4.1 977 712.623 40 4.40947 ==> SRR7170445.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 243 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170445 completed mapping pipeline successfully