Starting /dee2/code/volunteer_pipeline.sh SRR7170446 current disk space = 3050931027968 free memory = 1578573244 SRR7170446 SRAfilesize 0de0eb263926a85220d7a22c73668e2f SRR7170446.sra SRR7170446.sra file validated SRR7170446 is paired end SRR7170446 is conventional basespace SRR7170446 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.04625 18.0 18.0 25.0 18.0 32.0 2 28.4995 29.0 27.0 31.0 25.0 33.0 3 30.337 31.0 29.0 33.0 27.0 33.0 4 31.613 33.0 31.0 33.0 29.0 33.0 5 32.7785 33.0 33.0 33.0 32.0 34.0 6 36.83675 38.0 37.0 38.0 35.0 38.0 7 37.25875 38.0 38.0 38.0 36.0 38.0 8 37.4125 38.0 38.0 38.0 37.0 38.0 9 37.52925 38.0 38.0 38.0 37.0 38.0 10-14 37.55735 38.0 38.0 38.0 37.4 38.0 15-19 37.524899999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.59740000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.5358 38.0 38.0 38.0 38.0 38.0 30-34 37.5521 38.0 38.0 38.0 37.8 38.0 35-39 37.5441 38.0 38.0 38.0 37.8 38.0 40-44 37.492149999999995 38.0 38.0 38.0 37.4 38.0 45-49 37.48905 38.0 38.0 38.0 37.2 38.0 50-54 37.355599999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.23485 38.0 38.0 38.0 36.2 38.0 60-64 37.1877 38.0 38.0 38.0 36.0 38.0 65-69 37.1415 38.0 38.0 38.0 36.0 38.0 70-74 36.9948 38.0 38.0 38.0 35.8 38.0 75-79 36.9597 38.0 38.0 38.0 35.8 38.0 80-84 36.7905 38.0 38.0 38.0 34.8 38.0 85-89 36.7513 38.0 38.0 38.0 34.8 38.0 90-94 36.69795 38.0 38.0 38.0 34.4 38.0 95-99 36.54875 38.0 38.0 38.0 34.0 38.0 100-104 36.2311 38.0 37.2 38.0 33.4 38.0 105-109 36.148649999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.90705 38.0 37.0 38.0 32.2 38.0 115-119 35.6725 38.0 36.2 38.0 31.0 38.0 120-124 35.4197 38.0 36.0 38.0 29.6 38.0 125-129 35.10775 38.0 35.2 38.0 28.4 38.0 130-134 34.79344999999999 38.0 34.8 38.0 28.0 38.0 135-139 34.3317 38.0 33.4 38.0 25.6 38.0 140-144 33.43755 38.0 33.0 38.0 21.6 38.0 145-149 32.1425 38.0 32.6 38.0 12.8 38.0 150-151 26.172625 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 0.0 19 2.0 20 6.0 21 0.0 22 6.0 23 3.0 24 12.0 25 10.0 26 18.0 27 10.0 28 19.0 29 35.0 30 40.0 31 54.0 32 76.0 33 116.0 34 237.0 35 430.0 36 1238.0 37 1680.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.94119191388816 11.81412444211079 13.336833814649514 38.907849829351534 2 21.425 14.499999999999998 33.425 30.65 3 18.5 20.825 26.200000000000003 34.475 4 22.275 27.6 24.224999999999998 25.900000000000002 5 22.15 32.15 24.2 21.5 6 18.65 36.175000000000004 24.95 20.225 7 13.8 26.700000000000003 41.725 17.775 8 17.025000000000002 26.650000000000002 32.6 23.724999999999998 9 16.475 24.725 35.125 23.674999999999997 10-14 18.755 30.915 27.735 22.595000000000002 15-19 19.445 29.28 27.529999999999998 23.745 20-24 18.92 28.87 28.189999999999998 24.02 25-29 19.395 29.53 27.605 23.47 30-34 19.125 29.87 27.525 23.48 35-39 19.3 29.56 27.250000000000004 23.89 40-44 19.16 29.455 27.77 23.615 45-49 19.355 29.25 27.55 23.845 50-54 19.985 28.84 27.42 23.755000000000003 55-59 19.11 28.965000000000003 28.02 23.905 60-64 18.98 29.485 27.765 23.77 65-69 18.96 29.304999999999996 27.839999999999996 23.895 70-74 19.78 29.4 27.63 23.189999999999998 75-79 19.46 28.475 28.27 23.794999999999998 80-84 19.975 28.815 27.37 23.84 85-89 19.685 29.53 27.105 23.68 90-94 19.695 28.549999999999997 27.61 24.145 95-99 19.365 29.330000000000002 27.305 24.0 100-104 20.185 28.494999999999997 27.400000000000002 23.919999999999998 105-109 19.935 29.07 27.944999999999997 23.05 110-114 20.265 28.155 27.800000000000004 23.78 115-119 20.1 29.220000000000002 27.265 23.415 120-124 20.405 28.03 27.52 24.044999999999998 125-129 20.445 28.244999999999997 27.455000000000002 23.855 130-134 20.115 28.565 27.46 23.86 135-139 19.715 28.115000000000002 28.315 23.855 140-144 20.36 27.73 27.985 23.925 145-149 20.185 28.505000000000003 27.43 23.880000000000003 150-151 20.6625 27.3 27.6375 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.5 18 2.0 19 0.5 20 0.0 21 0.0 22 0.5 23 4.0 24 4.0 25 2.0 26 4.5 27 8.5 28 10.5 29 13.0 30 20.0 31 28.5 32 37.5 33 58.5 34 82.0 35 102.5 36 110.5 37 124.5 38 151.5 39 190.5 40 214.0 41 224.0 42 240.5 43 235.0 44 247.5 45 259.5 46 245.0 47 236.5 48 222.5 49 201.5 50 167.5 51 124.5 52 107.0 53 85.5 54 54.5 55 43.0 56 37.0 57 26.0 58 21.5 59 17.5 60 10.5 61 6.0 62 4.0 63 3.0 64 2.5 65 1.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 2.9749999999999996 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.762499999999999 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 10 0.0068378756 144.95 145 TATGCTT 10 0.0068378756 144.95 9 ACCCTTT 25 8.7252335E-4 86.97 3 >>END_MODULE SRR7170446 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02675 33.0 33.0 34.0 32.0 34.0 2 33.174 34.0 33.0 34.0 33.0 34.0 3 33.23025 34.0 33.0 34.0 33.0 34.0 4 33.1995 34.0 33.0 34.0 33.0 34.0 5 33.21325 34.0 33.0 34.0 33.0 34.0 6 37.46975 38.0 38.0 38.0 38.0 38.0 7 37.45775 38.0 38.0 38.0 38.0 38.0 8 37.484 38.0 38.0 38.0 38.0 38.0 9 37.46475 38.0 38.0 38.0 38.0 38.0 10-14 37.471799999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.465199999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.43835 38.0 38.0 38.0 38.0 38.0 25-29 37.428549999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.329750000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.335 38.0 38.0 38.0 37.2 38.0 40-44 37.3438 38.0 38.0 38.0 37.4 38.0 45-49 37.3301 38.0 38.0 38.0 37.6 38.0 50-54 37.31505 38.0 38.0 38.0 37.4 38.0 55-59 37.257799999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.242200000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.188599999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.1392 38.0 38.0 38.0 37.0 38.0 75-79 37.03975 38.0 38.0 38.0 36.4 38.0 80-84 36.98115 38.0 38.0 38.0 36.0 38.0 85-89 36.9417 38.0 38.0 38.0 36.0 38.0 90-94 36.8092 38.0 38.0 38.0 35.8 38.0 95-99 36.711999999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.6299 38.0 38.0 38.0 35.0 38.0 105-109 36.58575 38.0 38.0 38.0 34.8 38.0 110-114 36.293350000000004 38.0 37.8 38.0 34.0 38.0 115-119 36.22410000000001 38.0 37.8 38.0 34.0 38.0 120-124 35.8717 38.0 37.2 38.0 32.4 38.0 125-129 35.46115 38.0 36.0 38.0 31.0 38.0 130-134 35.00095 38.0 36.0 38.0 30.2 38.0 135-139 34.352999999999994 38.0 34.0 38.0 26.4 38.0 140-144 33.87255 38.0 33.4 38.0 23.8 38.0 145-149 32.84885 38.0 33.0 38.0 17.4 38.0 150-151 26.954124999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 1.0 6 2.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 2.0 13 1.0 14 4.0 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 1.0 21 2.0 22 3.0 23 5.0 24 14.0 25 6.0 26 11.0 27 14.0 28 18.0 29 20.0 30 28.0 31 46.0 32 46.0 33 93.0 34 149.0 35 260.0 36 714.0 37 2532.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.842921460730366 18.8344172086043 17.208604302151077 28.114057028514257 2 27.088544272136065 24.88744372186093 30.890445222611305 17.133566783391696 3 20.955238809702426 28.132033008252062 32.53313328332083 18.37959489872468 4 25.431357839459867 32.70817704426106 23.080770192548137 18.779694923730933 5 24.337168584292147 36.26813406703352 22.336168084042022 17.058529264632316 6 20.3 38.525 23.45 17.724999999999998 7 21.3 20.825 38.75 19.125 8 22.1 25.95 27.650000000000002 24.3 9 22.1 24.4 30.525000000000002 22.975 10-14 24.19 29.304999999999996 26.05 20.455000000000002 15-19 23.352335233523352 28.06780678067807 27.73777377737774 20.842084208420843 20-24 24.016004001000248 28.66216554138535 26.626656664166042 20.69517379344836 25-29 23.885971492873217 28.602150537634408 27.506876719179797 20.005001250312578 30-34 24.105847631434145 27.802511130008504 27.527387324295933 20.564253914261418 35-39 23.42937174869948 28.226290516206483 27.62605042016807 20.71828731492597 40-44 23.301990597179152 27.71331399419826 28.123437031109333 20.861258377513252 45-49 23.460865216304075 27.901975493873472 28.31707926981745 20.320080020005 50-54 23.281984595378614 28.26347904371311 27.838351505451637 20.616184855456638 55-59 23.775943985996502 27.866966741685424 27.76194048512128 20.5951487871968 60-64 23.320830207551886 27.94698674668667 28.097024256064017 20.635158789697424 65-69 23.415536991646242 28.05762593166925 27.957580911410133 20.569256165274375 70-74 23.611528069648756 28.319823876713702 27.45922145501851 20.60942659861903 75-79 23.417563172379285 28.29622216662497 28.011008256192145 20.275206404803605 80-84 23.39754816112084 27.760820615461597 28.35126344758569 20.490367775831874 85-89 23.757818363772827 28.111083312484364 27.540655491618715 20.590442832124094 90-94 24.0706459198479 28.35342972932406 27.37779556711863 20.19812878370941 95-99 24.593526439541748 27.955375456501073 27.895342438341086 19.55575566561609 100-104 24.085838627382323 28.362763243459554 27.437346806062727 20.114051323095392 105-109 24.190885898654393 28.317742984342953 27.682457105697566 19.808914011305088 110-114 24.572286143071537 27.603801900950476 28.244122061030513 19.579789894947474 115-119 23.879327596557935 28.392035221132677 28.046828096858118 19.68180908545127 120-124 24.36449159327462 28.087469975980785 27.812249799839872 19.735788630904725 125-129 24.151736562906617 27.89510559503553 27.82003803423081 20.133119807827043 130-134 24.41819728742305 28.006606275962163 27.55117361493419 20.024022821680596 135-139 24.37193474126714 28.235411870683613 28.045240716644983 19.347412671404264 140-144 24.49827335969171 28.266853510835293 27.781392322706573 19.45348080676643 145-149 24.75356517388041 28.77157868401301 27.68076057042782 18.79409557167876 150-151 24.615384615384617 29.368355222013758 27.229518449030643 18.786741713570983 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 0.5 25 0.5 26 1.0 27 2.5 28 4.5 29 8.0 30 8.5 31 18.0 32 26.0 33 33.0 34 51.0 35 69.0 36 82.0 37 108.0 38 139.0 39 173.5 40 209.0 41 233.5 42 257.0 43 267.0 44 262.0 45 268.0 46 273.5 47 230.0 48 213.0 49 231.5 50 195.0 51 151.0 52 119.0 53 81.0 54 66.0 55 58.0 56 42.5 57 28.0 58 21.0 59 21.5 60 16.0 61 8.5 62 5.5 63 3.5 64 3.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.025 25-29 0.025 30-34 0.045 35-39 0.04 40-44 0.03 45-49 0.025 50-54 0.03 55-59 0.025 60-64 0.025 65-69 0.045 70-74 0.06999999999999999 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.065 95-99 0.055 100-104 0.045 105-109 0.045 110-114 0.05 115-119 0.06 120-124 0.08 125-129 0.09 130-134 0.095 135-139 0.09 140-144 0.095 145-149 0.075 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.2764513696908771 0.5499999999999999 3 0.050263885398341285 0.15 4 0.050263885398341285 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.2125 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.574999999999999 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATT 10 0.006830828 145.0 1 ACTCCGT 10 0.006830828 145.0 5 >>END_MODULE Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645456 spots for SRR7170446.sra Written 645456 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra Read 645447 spots for SRR7170446.sra Written 645447 spots for SRR7170446.sra SRR ids: ['SRR7170446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1nsni477 SRR7170446.sra spots: 12908949 blocks: [[1, 645447], [645448, 1290894], [1290895, 1936341], [1936342, 2581788], [2581789, 3227235], [3227236, 3872682], [3872683, 4518129], [4518130, 5163576], [5163577, 5809023], [5809024, 6454470], [6454471, 7099917], [7099918, 7745364], [7745365, 8390811], [8390812, 9036258], [9036259, 9681705], [9681706, 10327152], [10327153, 10972599], [10972600, 11618046], [11618047, 12263493], [12263494, 12908949]] SRR7170446 file size 4352718 SRR7170446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170446 SRR7170446_1.fastq SRR7170446_2.fastq Input file: SRR7170446_1.fastq Paired file: SRR7170446_2.fastq trimmed: SRR7170446-trimmed-pair1.fastq, SRR7170446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:30:41 2025 >> started Wed Feb 12 20:32:59 2025 >> done (137.962s) 12908949 read pairs processed; of these: 15309 ( 0.12%) short read pairs filtered out after trimming by size control 22949 ( 0.18%) empty read pairs filtered out after trimming by size control 12870691 (99.70%) read pairs available; of these: 8191629 (63.65%) trimmed read pairs available after processing 4679062 (36.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 5 0.00% 28 3 0.00% 29 3 0.00% 30 8 0.00% 31 5 0.00% 32 8 0.00% 33 2 0.00% 34 6 0.00% 35 14 0.00% 36 7 0.00% 37 12 0.00% 38 15 0.00% 39 25 0.00% 40 24 0.00% 41 23 0.00% 42 30 0.00% 43 29 0.00% 44 28 0.00% 45 39 0.00% 46 40 0.00% 47 61 0.00% 48 81 0.00% 49 95 0.00% 50 94 0.00% 51 128 0.00% 52 138 0.00% 53 122 0.00% 54 154 0.00% 55 185 0.00% 56 186 0.00% 57 227 0.00% 58 284 0.00% 59 300 0.00% 60 344 0.00% 61 395 0.00% 62 414 0.00% 63 476 0.00% 64 567 0.00% 65 540 0.00% 66 658 0.01% 67 724 0.01% 68 830 0.01% 69 935 0.01% 70 1014 0.01% 71 1292 0.01% 72 1450 0.01% 73 1623 0.01% 74 1726 0.01% 75 2037 0.02% 76 2160 0.02% 77 2348 0.02% 78 2467 0.02% 79 2902 0.02% 80 3124 0.02% 81 3666 0.03% 82 4256 0.03% 83 4713 0.04% 84 5687 0.04% 85 6130 0.05% 86 6296 0.05% 87 6557 0.05% 88 6836 0.05% 89 7039 0.05% 90 7654 0.06% 91 8169 0.06% 92 8629 0.07% 93 9322 0.07% 94 9951 0.08% 95 10539 0.08% 96 11354 0.09% 97 11602 0.09% 98 11979 0.09% 99 12077 0.09% 100 12716 0.10% 101 13425 0.10% 102 14038 0.11% 103 14850 0.12% 104 15548 0.12% 105 16242 0.13% 106 17279 0.13% 107 17472 0.14% 108 17378 0.14% 109 18237 0.14% 110 18468 0.14% 111 18745 0.15% 112 19094 0.15% 113 20041 0.16% 114 20830 0.16% 115 21658 0.17% 116 22275 0.17% 117 22744 0.18% 118 23593 0.18% 119 23803 0.18% 120 24378 0.19% 121 24963 0.19% 122 25328 0.20% 123 26906 0.21% 124 28122 0.22% 125 28729 0.22% 126 30434 0.24% 127 31586 0.25% 128 32407 0.25% 129 34103 0.26% 130 35484 0.28% 131 37319 0.29% 132 40203 0.31% 133 42580 0.33% 134 45211 0.35% 135 48970 0.38% 136 52759 0.41% 137 57702 0.45% 138 64217 0.50% 139 71379 0.55% 140 80369 0.62% 141 93579 0.73% 142 107959 0.84% 143 126972 0.99% 144 157367 1.22% 145 198488 1.54% 146 266642 2.07% 147 382797 2.97% 148 597738 4.64% 149 1139095 8.85% 150 3706526 28.80% 151 4679062 36.35% 12870691 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=25.91 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.9 sequence=CTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.2 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=29.45 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170446 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:34:52 Started mapping on | Feb 12 20:34:52 Finished on | Feb 12 20:36:50 Mapping speed, Million of reads per hour | 392.67 Number of input reads | 12870691 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11771913 Uniquely mapped reads % | 91.46% Average mapped length | 292.07 Number of splices: Total | 10691585 Number of splices: Annotated (sjdb) | 10414707 Number of splices: GT/AG | 10488007 Number of splices: GC/AG | 158522 Number of splices: AT/AC | 8186 Number of splices: Non-canonical | 36870 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363062 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 15795 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 744977 744977 744977 N_multimapping 363062 363062 363062 N_noFeature 386901 11576505 441384 N_ambiguous 233881 855 92656 UnstrandedReadsAssigned:11151131 PositiveStrandReadsAssigned:194553 NegativeStrandReadsAssigned:11237873 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170446-trimmed-pair1.fastq SRR7170446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,870,691 reads, 11,183,199 reads pseudoaligned [quant] estimated average fragment length: 253.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR7170446.ke.tsv 34699 SRR7170446.se.tsv 87100 total ==> SRR7170446.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.61 752 34.5305 Potri.005G024800.1.v4.1 1035 782.615 455 47.1351 Potri.004G059700.1.v4.1 961 708.626 5 0.57205 Potri.007G009000.2.v4.1 1416 1163.61 0 0 Potri.003G141000.2.v4.1 2943 2690.61 499.304 15.0451 Potri.016G087400.1.v4.1 270 78.7438 1110 1142.84 Potri.015G069301.1.v4.1 564 314.781 0 0 Potri.010G195200.1.v4.1 1773 1520.61 435 23.1927 Potri.012G127500.1.v4.1 977 724.621 53 5.92988 ==> SRR7170446.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 988 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170446 completed mapping pipeline successfully