Starting /dee2/code/volunteer_pipeline.sh SRR7170447 current disk space = 3050932789248 free memory = 990902276 SRR7170447 SRAfilesize 2ae8fe2cd47cc8c045a4b83f875f6444 SRR7170447.sra SRR7170447.sra file validated SRR7170447 is paired end SRR7170447 is conventional basespace SRR7170447 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.7915 30.0 18.0 33.0 18.0 33.0 2 25.112 25.0 18.0 31.0 18.0 33.0 3 29.33975 30.0 27.0 33.0 25.0 33.0 4 31.42875 33.0 31.0 33.0 29.0 33.0 5 31.97275 33.0 31.0 33.0 29.0 33.0 6 36.48075 38.0 36.0 38.0 34.0 38.0 7 37.192 38.0 38.0 38.0 36.0 38.0 8 37.53425 38.0 38.0 38.0 37.0 38.0 9 37.52625 38.0 38.0 38.0 37.0 38.0 10-14 37.589999999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.6345 38.0 38.0 38.0 38.0 38.0 20-24 37.59575 38.0 38.0 38.0 38.0 38.0 25-29 37.5243 38.0 38.0 38.0 37.6 38.0 30-34 37.56805 38.0 38.0 38.0 38.0 38.0 35-39 37.584700000000005 38.0 38.0 38.0 38.0 38.0 40-44 36.8269 38.0 37.2 38.0 33.6 38.0 45-49 36.257200000000005 38.0 37.0 38.0 30.0 38.0 50-54 37.216150000000006 38.0 38.0 38.0 36.4 38.0 55-59 37.30875 38.0 38.0 38.0 37.0 38.0 60-64 37.27575 38.0 38.0 38.0 36.6 38.0 65-69 37.25375 38.0 38.0 38.0 36.8 38.0 70-74 37.09225 38.0 38.0 38.0 36.0 38.0 75-79 37.023450000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.94715 38.0 38.0 38.0 35.8 38.0 85-89 36.70595000000001 38.0 37.8 38.0 34.8 38.0 90-94 36.3916 38.0 37.8 38.0 33.8 38.0 95-99 36.4497 38.0 38.0 38.0 34.0 38.0 100-104 36.5298 38.0 38.0 38.0 34.2 38.0 105-109 36.465849999999996 38.0 37.8 38.0 34.2 38.0 110-114 36.150099999999995 38.0 37.0 38.0 33.2 38.0 115-119 35.716 38.0 36.6 38.0 30.8 38.0 120-124 35.81725 38.0 36.6 38.0 31.6 38.0 125-129 35.528949999999995 38.0 35.8 38.0 30.4 38.0 130-134 35.216049999999996 38.0 35.6 38.0 29.2 38.0 135-139 34.909349999999996 38.0 35.0 38.0 28.2 38.0 140-144 34.197 38.0 33.8 38.0 25.4 38.0 145-149 33.40675 38.0 33.0 38.0 22.0 38.0 150-151 28.698375 35.0 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 5.0 18 2.0 19 3.0 20 1.0 21 2.0 22 4.0 23 2.0 24 2.0 25 11.0 26 12.0 27 18.0 28 25.0 29 30.0 30 41.0 31 53.0 32 93.0 33 126.0 34 180.0 35 364.0 36 1096.0 37 1929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.18069179143004 11.74496644295302 6.608156943727414 31.46618482188952 2 23.46760070052539 13.184888666499875 34.701025769326996 28.646484863647736 3 18.4 21.425 25.374999999999996 34.8 4 22.425 28.725 23.775 25.074999999999996 5 22.35 33.175 23.575 20.9 6 18.7 36.95 24.45 19.900000000000002 7 14.45 26.150000000000002 41.25 18.15 8 17.0 25.775 30.725 26.5 9 17.474999999999998 23.925 35.075 23.525 10-14 19.835 29.805 27.525 22.835 15-19 19.615 28.485 28.465 23.435 20-24 19.685 28.499999999999996 28.275 23.54 25-29 19.45 29.24 28.249999999999996 23.06 30-34 19.345000000000002 28.825 28.08 23.75 35-39 20.385 28.345 28.01 23.26 40-44 19.765 29.459999999999997 27.939999999999998 22.835 45-49 20.14 28.7 27.765 23.395 50-54 20.47 28.64 26.974999999999998 23.915 55-59 19.735 28.794999999999998 28.08 23.39 60-64 19.335 28.735 28.025 23.905 65-69 19.78 28.610000000000003 27.950000000000003 23.66 70-74 19.759999999999998 29.095 27.71 23.435 75-79 19.835 28.305000000000003 28.22 23.64 80-84 19.965 28.455000000000002 27.925 23.655 85-89 20.630000000000003 27.950000000000003 28.015 23.405 90-94 19.86 29.065 27.450000000000003 23.625 95-99 19.545 28.93 27.67 23.855 100-104 20.015 29.255 27.534999999999997 23.195 105-109 20.51 28.95 27.6 22.939999999999998 110-114 20.68 28.595 27.800000000000004 22.925 115-119 20.73 28.360000000000003 27.565 23.345 120-124 20.46 28.74 27.43 23.369999999999997 125-129 20.19 28.58 27.435 23.794999999999998 130-134 20.855 27.92 27.834999999999997 23.39 135-139 20.87 27.939999999999998 27.345000000000002 23.845 140-144 20.505000000000003 28.16 27.675 23.66 145-149 20.830000000000002 28.754999999999995 26.905 23.51 150-151 20.150000000000002 28.762500000000003 27.0125 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.5 24 5.0 25 8.0 26 10.5 27 9.0 28 11.0 29 18.0 30 25.5 31 34.5 32 45.0 33 50.5 34 55.0 35 77.5 36 101.5 37 118.5 38 137.0 39 167.0 40 184.5 41 203.0 42 254.5 43 259.0 44 252.0 45 261.0 46 252.0 47 234.5 48 218.0 49 199.0 50 174.5 51 147.0 52 112.5 53 86.0 54 66.5 55 57.0 56 39.0 57 29.0 58 25.5 59 18.0 60 12.5 61 9.0 62 8.5 63 4.5 64 2.5 65 1.0 66 2.0 67 3.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 4.987500000000001 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAATC 10 0.006832588 144.9875 2 GCAACTC 10 0.006832588 144.9875 5 >>END_MODULE SRR7170447 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41325 33.0 32.0 34.0 31.0 34.0 2 32.759 33.0 33.0 34.0 32.0 34.0 3 30.436 33.0 30.0 34.0 18.0 34.0 4 32.04225 33.0 32.0 34.0 27.0 34.0 5 32.67775 33.0 33.0 34.0 32.0 34.0 6 37.15425 38.0 38.0 38.0 36.0 38.0 7 36.836 38.0 38.0 38.0 35.0 38.0 8 37.092 38.0 38.0 38.0 36.0 38.0 9 37.1365 38.0 38.0 38.0 37.0 38.0 10-14 37.0843 38.0 38.0 38.0 36.4 38.0 15-19 37.12985 38.0 38.0 38.0 36.8 38.0 20-24 36.94495 38.0 38.0 38.0 36.0 38.0 25-29 36.72735 38.0 38.0 38.0 35.4 38.0 30-34 36.9858 38.0 38.0 38.0 36.0 38.0 35-39 37.0445 38.0 38.0 38.0 36.2 38.0 40-44 36.13895 38.0 37.2 38.0 30.4 38.0 45-49 37.01395 38.0 38.0 38.0 36.0 38.0 50-54 36.99055 38.0 38.0 38.0 36.0 38.0 55-59 35.763000000000005 38.0 36.0 38.0 29.6 38.0 60-64 36.44045 38.0 37.8 38.0 33.6 38.0 65-69 36.2344 38.0 37.6 38.0 32.8 38.0 70-74 35.8579 38.0 37.0 38.0 30.8 38.0 75-79 36.513400000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.688750000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.498000000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.47995 38.0 38.0 38.0 34.0 38.0 95-99 36.319599999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.105650000000004 38.0 37.2 38.0 33.2 38.0 105-109 35.86125 38.0 37.0 38.0 32.0 38.0 110-114 35.846199999999996 38.0 37.0 38.0 32.0 38.0 115-119 35.40965 38.0 36.4 38.0 29.6 38.0 120-124 35.1511 38.0 35.8 38.0 29.0 38.0 125-129 34.538650000000004 38.0 34.6 38.0 25.6 38.0 130-134 34.3939 38.0 34.2 38.0 25.6 38.0 135-139 33.74795 38.0 33.0 38.0 22.8 38.0 140-144 32.69845 38.0 33.0 38.0 16.2 38.0 145-149 31.795599999999997 38.0 32.2 38.0 8.6 38.0 150-151 25.501624999999997 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 2.0 12 1.0 13 3.0 14 0.0 15 1.0 16 6.0 17 5.0 18 5.0 19 10.0 20 7.0 21 5.0 22 9.0 23 17.0 24 22.0 25 23.0 26 18.0 27 36.0 28 27.0 29 45.0 30 66.0 31 71.0 32 96.0 33 132.0 34 231.0 35 371.0 36 920.0 37 1864.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.300000000000004 22.225 11.425 26.05 2 26.375 28.15 30.925000000000004 14.549999999999999 3 21.125 27.875 32.65 18.35 4 22.425 35.199999999999996 22.45 19.925 5 24.224999999999998 37.55 21.925 16.3 6 20.0 39.75 22.400000000000002 17.849999999999998 7 20.599999999999998 20.825 39.275 19.3 8 21.05 25.4 28.525 25.025 9 21.8 25.374999999999996 29.599999999999998 23.225 10-14 23.195 29.099999999999998 26.400000000000002 21.305 15-19 22.915 28.9 28.065 20.119999999999997 20-24 22.105 28.299999999999997 28.63 20.965 25-29 22.805 28.725 28.09 20.380000000000003 30-34 22.625 28.53 28.01 20.835 35-39 22.125 28.115000000000002 28.575 21.185000000000002 40-44 22.325 28.275 28.560000000000002 20.84 45-49 22.564999999999998 28.720000000000002 28.115000000000002 20.599999999999998 50-54 22.855 28.599999999999998 28.07 20.474999999999998 55-59 22.685 28.37 28.285 20.66 60-64 23.1 27.950000000000003 28.375 20.575 65-69 23.200000000000003 27.96 28.15 20.69 70-74 22.55 28.449999999999996 28.21 20.79 75-79 23.34 27.834999999999997 28.084999999999997 20.74 80-84 23.515 28.194999999999997 27.88 20.41 85-89 23.244999999999997 27.925 28.08 20.75 90-94 23.64 27.825 28.345 20.19 95-99 23.29 28.125 27.865000000000002 20.72 100-104 23.555 27.935 27.855 20.655 105-109 23.685000000000002 27.839999999999996 27.735 20.74 110-114 24.295 27.439999999999998 28.285 19.98 115-119 23.825 28.415000000000003 27.445000000000004 20.315 120-124 23.905 27.325 28.24 20.53 125-129 24.425 27.68 27.575 20.32 130-134 24.349999999999998 27.96 27.975 19.715 135-139 24.765 27.35 27.74 20.145 140-144 23.599999999999998 28.33 27.99 20.080000000000002 145-149 24.560000000000002 27.994999999999997 27.99 19.455 150-151 24.4125 27.325 27.6875 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 3.0 24 2.0 25 4.0 26 5.5 27 4.0 28 7.5 29 15.5 30 23.5 31 27.0 32 32.5 33 50.5 34 67.0 35 71.5 36 90.5 37 121.0 38 136.5 39 161.5 40 196.5 41 232.0 42 263.0 43 289.5 44 297.5 45 275.0 46 249.0 47 233.5 48 226.0 49 202.5 50 168.0 51 125.5 52 88.5 53 77.5 54 73.0 55 52.5 56 34.0 57 22.0 58 18.0 59 19.5 60 11.0 61 4.5 62 2.5 63 3.0 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36948297604036 98.5 2 0.5548549810844893 1.0999999999999999 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025220680958385876 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.9124999999999996 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGTCA 10 0.006830828 145.0 6 >>END_MODULE Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755516 spots for SRR7170447.sra Written 755516 spots for SRR7170447.sra Read 755517 spots for SRR7170447.sra Written 755517 spots for SRR7170447.sra SRR ids: ['SRR7170447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1vvzdk_l SRR7170447.sra spots: 15110321 blocks: [[1, 755516], [755517, 1511032], [1511033, 2266548], [2266549, 3022064], [3022065, 3777580], [3777581, 4533096], [4533097, 5288612], [5288613, 6044128], [6044129, 6799644], [6799645, 7555160], [7555161, 8310676], [8310677, 9066192], [9066193, 9821708], [9821709, 10577224], [10577225, 11332740], [11332741, 12088256], [12088257, 12843772], [12843773, 13599288], [13599289, 14354804], [14354805, 15110321]] SRR7170447 file size 5098691 SRR7170447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170447 SRR7170447_1.fastq SRR7170447_2.fastq Input file: SRR7170447_1.fastq Paired file: SRR7170447_2.fastq trimmed: SRR7170447-trimmed-pair1.fastq, SRR7170447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:38:23 2025 >> started Wed Feb 12 19:38:43 2025 >> done (19.684s) 15110321 read pairs processed; of these: 12207 ( 0.08%) short read pairs filtered out after trimming by size control 11777 ( 0.08%) empty read pairs filtered out after trimming by size control 15086337 (99.84%) read pairs available; of these: 8075042 (53.53%) trimmed read pairs available after processing 7011295 (46.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 3 0.00% 30 11 0.00% 31 11 0.00% 32 7 0.00% 33 7 0.00% 34 12 0.00% 35 7 0.00% 36 10 0.00% 37 19 0.00% 38 17 0.00% 39 16 0.00% 40 20 0.00% 41 16 0.00% 42 37 0.00% 43 39 0.00% 44 37 0.00% 45 34 0.00% 46 50 0.00% 47 56 0.00% 48 66 0.00% 49 79 0.00% 50 74 0.00% 51 93 0.00% 52 114 0.00% 53 114 0.00% 54 130 0.00% 55 124 0.00% 56 160 0.00% 57 146 0.00% 58 217 0.00% 59 243 0.00% 60 258 0.00% 61 332 0.00% 62 371 0.00% 63 410 0.00% 64 454 0.00% 65 474 0.00% 66 544 0.00% 67 615 0.00% 68 591 0.00% 69 764 0.01% 70 961 0.01% 71 996 0.01% 72 1097 0.01% 73 1338 0.01% 74 1414 0.01% 75 1616 0.01% 76 1861 0.01% 77 2076 0.01% 78 2180 0.01% 79 2330 0.02% 80 2523 0.02% 81 2943 0.02% 82 3317 0.02% 83 3899 0.03% 84 4540 0.03% 85 5220 0.03% 86 5463 0.04% 87 5675 0.04% 88 5972 0.04% 89 6366 0.04% 90 6805 0.05% 91 7295 0.05% 92 8068 0.05% 93 8858 0.06% 94 9372 0.06% 95 10053 0.07% 96 10297 0.07% 97 10632 0.07% 98 10995 0.07% 99 11395 0.08% 100 12094 0.08% 101 12645 0.08% 102 13597 0.09% 103 14224 0.09% 104 15036 0.10% 105 15740 0.10% 106 16315 0.11% 107 16851 0.11% 108 16989 0.11% 109 17522 0.12% 110 18040 0.12% 111 18730 0.12% 112 19454 0.13% 113 20285 0.13% 114 21243 0.14% 115 22002 0.15% 116 22902 0.15% 117 23883 0.16% 118 23896 0.16% 119 24351 0.16% 120 25199 0.17% 121 25994 0.17% 122 27240 0.18% 123 28582 0.19% 124 30053 0.20% 125 30800 0.20% 126 32498 0.22% 127 33778 0.22% 128 35088 0.23% 129 36533 0.24% 130 38126 0.25% 131 40128 0.27% 132 42196 0.28% 133 44722 0.30% 134 47794 0.32% 135 51551 0.34% 136 55634 0.37% 137 60707 0.40% 138 65777 0.44% 139 71706 0.48% 140 79388 0.53% 141 89838 0.60% 142 102591 0.68% 143 120412 0.80% 144 145456 0.96% 145 179807 1.19% 146 230556 1.53% 147 317105 2.10% 148 488734 3.24% 149 959595 6.36% 150 4009253 26.58% 151 7011295 46.47% 15086337 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=29 prefix-density=0.34 prefix-fanout=1.9 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=15.81 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.0 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=28.47 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.0 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR7170447 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:39:33 Started mapping on | Feb 12 19:39:34 Finished on | Feb 12 19:41:46 Mapping speed, Million of reads per hour | 411.45 Number of input reads | 15086337 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14049611 Uniquely mapped reads % | 93.13% Average mapped length | 293.72 Number of splices: Total | 13563213 Number of splices: Annotated (sjdb) | 13238478 Number of splices: GT/AG | 13311448 Number of splices: GC/AG | 199017 Number of splices: AT/AC | 8602 Number of splices: Non-canonical | 44146 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423615 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 114100 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624193 624193 624193 N_multimapping 423615 423615 423615 N_noFeature 589976 13805196 692261 N_ambiguous 263678 1175 120793 UnstrandedReadsAssigned:13195957 PositiveStrandReadsAssigned:243240 NegativeStrandReadsAssigned:13236557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170447-trimmed-pair1.fastq SRR7170447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,086,337 reads, 13,228,453 reads pseudoaligned [quant] estimated average fragment length: 271.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7170447.ke.tsv 34699 SRR7170447.se.tsv 87100 total ==> SRR7170447.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.62 1119 44.8057 Potri.005G024800.1.v4.1 1035 764.625 511 46.7653 Potri.004G059700.1.v4.1 961 690.647 13 1.31716 Potri.007G009000.2.v4.1 1416 1145.62 0 0 Potri.003G141000.2.v4.1 2943 2672.62 666.163 17.4419 Potri.016G087400.1.v4.1 270 75.2394 1089.24 1013.04 Potri.015G069301.1.v4.1 564 299.805 0 0 Potri.010G195200.1.v4.1 1773 1502.62 1198.99 55.8363 Potri.012G127500.1.v4.1 977 706.641 113 11.19 ==> SRR7170447.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 738 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170447 completed mapping pipeline successfully