Starting /dee2/code/volunteer_pipeline.sh SRR7170448 current disk space = 3050954702848 free memory = 1508511044 SRR7170448 SRAfilesize b597bb3054774bb8c511dcb51bcfc4d5 SRR7170448.sra SRR7170448.sra file validated SRR7170448 is paired end SRR7170448 is conventional basespace SRR7170448 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.613 18.0 18.0 18.0 18.0 32.0 2 27.06475 27.0 27.0 30.0 18.0 31.0 3 28.58225 29.0 27.0 31.0 25.0 33.0 4 31.499 33.0 31.0 33.0 29.0 33.0 5 32.15475 33.0 33.0 33.0 31.0 33.0 6 36.59125 38.0 37.0 38.0 34.0 38.0 7 37.10875 38.0 38.0 38.0 35.0 38.0 8 37.35775 38.0 38.0 38.0 36.0 38.0 9 37.52425 38.0 38.0 38.0 37.0 38.0 10-14 37.46075 38.0 38.0 38.0 37.0 38.0 15-19 37.545500000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.537400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.44885000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.474450000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.4546 38.0 38.0 38.0 37.0 38.0 40-44 36.695949999999996 38.0 37.2 38.0 32.8 38.0 45-49 36.09595 38.0 36.8 38.0 29.2 38.0 50-54 37.04685 38.0 37.8 38.0 35.8 38.0 55-59 37.15005000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.060700000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.007 38.0 38.0 38.0 36.0 38.0 70-74 36.882250000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.77785 38.0 38.0 38.0 34.8 38.0 80-84 36.779849999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.44025 38.0 37.6 38.0 33.8 38.0 90-94 36.141450000000006 38.0 37.0 38.0 32.8 38.0 95-99 36.21815 38.0 37.0 38.0 33.2 38.0 100-104 36.181799999999996 38.0 37.0 38.0 33.2 38.0 105-109 36.14975 38.0 37.0 38.0 33.2 38.0 110-114 35.78145 38.0 36.6 38.0 31.6 38.0 115-119 35.35195 38.0 35.8 38.0 29.6 38.0 120-124 35.29305 38.0 35.8 38.0 29.2 38.0 125-129 34.998650000000005 38.0 35.2 38.0 27.6 38.0 130-134 34.648649999999996 38.0 34.8 38.0 27.4 38.0 135-139 34.2731 38.0 34.2 38.0 25.4 38.0 140-144 33.40745 38.0 33.4 38.0 21.8 38.0 145-149 32.5292 38.0 32.6 38.0 15.0 38.0 150-151 27.244125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 3.0 22 6.0 23 6.0 24 9.0 25 6.0 26 18.0 27 17.0 28 19.0 29 38.0 30 56.0 31 73.0 32 115.0 33 138.0 34 275.0 35 527.0 36 1274.0 37 1412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.277330563490004 25.837444819527395 8.828875616722929 33.05634900025967 2 22.125 15.125 33.625 29.125 3 19.075 22.025 26.875 32.025 4 22.8 30.425 22.525000000000002 24.25 5 22.225 35.05 23.35 19.375 6 19.225 35.0 25.7 20.075000000000003 7 14.75 26.125 42.025 17.1 8 17.075000000000003 25.85 31.35 25.724999999999998 9 18.45 23.25 33.175 25.124999999999996 10-14 19.685 30.345 27.01 22.96 15-19 19.825 29.115000000000002 28.16 22.900000000000002 20-24 19.81 29.049999999999997 27.810000000000002 23.330000000000002 25-29 20.044999999999998 28.88 28.095 22.98 30-34 19.900000000000002 29.310000000000002 27.32 23.47 35-39 19.655 29.580000000000002 27.339999999999996 23.425 40-44 19.805990299514974 29.236461823091155 27.92139606980349 23.03615180759038 45-49 20.125 28.98 27.169999999999998 23.724999999999998 50-54 20.185 29.509999999999998 27.389999999999997 22.915 55-59 20.07 28.615000000000002 27.975 23.34 60-64 19.785 29.349999999999998 27.99 22.875 65-69 20.794999999999998 28.48 27.6 23.125 70-74 20.31 29.45 27.450000000000003 22.79 75-79 19.965 28.765 27.845 23.425 80-84 20.455000000000002 28.775000000000002 27.439999999999998 23.330000000000002 85-89 20.369999999999997 28.98 26.915 23.735 90-94 20.49602480124006 29.251462573128656 26.691334566728337 23.561178058902946 95-99 20.23 29.345 27.37 23.055 100-104 20.599999999999998 28.799999999999997 27.705000000000002 22.895 105-109 20.48 29.145 27.005000000000003 23.369999999999997 110-114 20.76 29.215000000000003 26.515 23.51 115-119 20.395 29.385 26.705000000000002 23.515 120-124 20.925 28.465 26.790000000000003 23.82 125-129 20.427042704270427 28.26282628262826 27.662766276627664 23.647364736473648 130-134 20.76 28.525 27.16 23.555 135-139 20.526026301315063 27.9813990699535 27.431371568578427 24.06120306015301 140-144 21.154999999999998 28.15 27.52 23.175 145-149 20.575 28.244999999999997 27.150000000000002 24.03 150-151 20.150000000000002 29.349999999999998 26.85 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 1.5 25 4.5 26 7.5 27 8.5 28 8.5 29 11.5 30 20.5 31 33.0 32 40.0 33 54.5 34 78.0 35 87.0 36 100.5 37 121.0 38 136.0 39 164.5 40 218.0 41 241.5 42 239.5 43 256.5 44 267.5 45 264.0 46 248.5 47 230.5 48 215.0 49 190.0 50 171.5 51 141.5 52 105.5 53 83.5 54 64.0 55 52.5 56 36.5 57 27.5 58 19.5 59 12.0 60 11.0 61 6.0 62 3.5 63 3.0 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.6625 0.0 0.0 0.0 0.0 124-125 4.012499999999999 0.0 0.0 0.0 0.0 126-127 4.362500000000001 0.025 0.0 0.0 0.0 128-129 4.525 0.025 0.0 0.0 0.0 130-131 4.8125 0.025 0.0 0.0 0.0 132-133 5.137499999999999 0.025 0.0 0.0 0.0 134-135 5.3625 0.025 0.0 0.0 0.0 136-137 5.7 0.025 0.0 0.0 0.0 138-139 5.95 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACAT 10 0.0068378756 144.95 6 CTTTAAG 10 0.0068378756 144.95 6 TCACATG 10 0.0068378756 144.95 7 >>END_MODULE SRR7170448 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.30925 33.0 32.0 34.0 30.0 34.0 2 32.68575 33.0 33.0 34.0 32.0 34.0 3 30.17575 33.0 28.0 34.0 18.0 34.0 4 31.982 33.0 32.0 34.0 27.0 34.0 5 32.56975 33.0 33.0 34.0 32.0 34.0 6 37.1025 38.0 38.0 38.0 36.0 38.0 7 36.749 38.0 38.0 38.0 35.0 38.0 8 37.047 38.0 38.0 38.0 36.0 38.0 9 37.1545 38.0 38.0 38.0 37.0 38.0 10-14 37.10340000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.080349999999996 38.0 38.0 38.0 36.8 38.0 20-24 36.8836 38.0 38.0 38.0 35.8 38.0 25-29 36.6957 38.0 38.0 38.0 35.4 38.0 30-34 36.91029999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.948949999999996 38.0 38.0 38.0 36.0 38.0 40-44 35.9913 38.0 37.0 38.0 30.6 38.0 45-49 36.921549999999996 38.0 38.0 38.0 35.8 38.0 50-54 36.91145 38.0 38.0 38.0 36.0 38.0 55-59 35.5997 38.0 35.6 38.0 29.8 38.0 60-64 36.344699999999996 38.0 37.8 38.0 34.0 38.0 65-69 36.1774 38.0 37.6 38.0 32.8 38.0 70-74 35.773849999999996 38.0 36.8 38.0 30.8 38.0 75-79 36.517100000000006 38.0 38.0 38.0 34.6 38.0 80-84 36.517700000000005 38.0 38.0 38.0 34.6 38.0 85-89 36.387699999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.45555 38.0 38.0 38.0 34.2 38.0 95-99 36.295550000000006 38.0 37.8 38.0 34.0 38.0 100-104 36.010000000000005 38.0 37.0 38.0 33.2 38.0 105-109 35.7341 38.0 37.0 38.0 31.4 38.0 110-114 35.65605 38.0 37.0 38.0 31.4 38.0 115-119 35.27095 38.0 36.0 38.0 29.4 38.0 120-124 35.005050000000004 38.0 35.8 38.0 28.0 38.0 125-129 34.3284 38.0 34.2 38.0 24.4 38.0 130-134 34.1995 38.0 33.4 38.0 25.0 38.0 135-139 33.65215 38.0 33.0 38.0 22.2 38.0 140-144 32.729 38.0 32.6 38.0 17.0 38.0 145-149 31.69325 37.6 32.2 38.0 10.4 38.0 150-151 25.6695 32.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 3.0 5 2.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 4.0 14 3.0 15 1.0 16 6.0 17 5.0 18 5.0 19 7.0 20 7.0 21 5.0 22 14.0 23 3.0 24 6.0 25 15.0 26 27.0 27 33.0 28 36.0 29 41.0 30 45.0 31 69.0 32 96.0 33 160.0 34 227.0 35 429.0 36 1014.0 37 1720.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.75 21.15 14.124999999999998 24.975 2 25.15 26.125 31.025000000000002 17.7 3 20.599999999999998 27.025 34.275 18.099999999999998 4 23.9 34.1 22.575 19.425 5 24.0 36.275 22.225 17.5 6 18.825 38.375 24.65 18.15 7 19.950000000000003 20.724999999999998 39.25 20.075000000000003 8 21.45 25.55 27.900000000000002 25.1 9 20.974999999999998 25.55 31.4 22.075 10-14 22.67 28.694999999999997 27.33 21.305 15-19 22.18 28.895 28.449999999999996 20.474999999999998 20-24 22.765 28.18 28.335 20.72 25-29 22.3 28.665000000000003 28.244999999999997 20.79 30-34 22.275 28.444999999999997 28.189999999999998 21.09 35-39 22.055 28.535 28.465 20.945 40-44 22.634999999999998 28.515 28.28 20.57 45-49 22.61 27.815 28.615000000000002 20.96 50-54 22.96 28.494999999999997 27.93 20.615 55-59 23.53 27.279999999999998 28.24 20.95 60-64 23.18 27.74 28.199999999999996 20.880000000000003 65-69 23.3 27.97 27.88 20.849999999999998 70-74 22.835 27.944999999999997 27.889999999999997 21.33 75-79 22.66 28.310000000000002 27.87 21.16 80-84 22.745 28.000000000000004 27.87 21.385 85-89 23.015 27.705000000000002 28.33 20.95 90-94 23.080000000000002 27.965 28.315 20.64 95-99 22.915 27.665 28.555000000000003 20.865000000000002 100-104 23.68 27.935 27.865000000000002 20.52 105-109 23.369999999999997 28.09 27.99 20.549999999999997 110-114 23.64 28.449999999999996 27.900000000000002 20.01 115-119 23.995 28.01 27.810000000000002 20.185 120-124 24.195 28.144999999999996 27.08 20.580000000000002 125-129 23.82 28.07 27.85 20.26 130-134 23.87 27.35 28.044999999999998 20.735 135-139 24.240000000000002 27.800000000000004 28.255000000000003 19.705000000000002 140-144 23.785 27.474999999999998 28.27 20.47 145-149 24.295 27.41 27.72 20.575 150-151 23.05 28.0625 28.725 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.5 23 1.0 24 1.0 25 1.5 26 4.0 27 6.0 28 5.5 29 12.0 30 19.5 31 27.0 32 35.0 33 40.5 34 48.5 35 73.5 36 102.0 37 127.0 38 152.5 39 185.5 40 211.0 41 210.5 42 241.0 43 288.5 44 294.5 45 280.5 46 245.5 47 222.5 48 225.5 49 197.5 50 158.5 51 130.5 52 101.5 53 80.0 54 71.0 55 56.0 56 37.5 57 27.0 58 23.5 59 17.5 60 8.0 61 5.0 62 6.0 63 4.5 64 2.5 65 1.5 66 0.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5033979360684621 1.0 3 0.05033979360684621 0.15 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.4625000000000004 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.475 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.7 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAATG 10 0.006830828 145.0 1 >>END_MODULE Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777103 spots for SRR7170448.sra Written 777103 spots for SRR7170448.sra Read 777111 spots for SRR7170448.sra Written 777111 spots for SRR7170448.sra SRR ids: ['SRR7170448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_edmsmayp SRR7170448.sra spots: 15542068 blocks: [[1, 777103], [777104, 1554206], [1554207, 2331309], [2331310, 3108412], [3108413, 3885515], [3885516, 4662618], [4662619, 5439721], [5439722, 6216824], [6216825, 6993927], [6993928, 7771030], [7771031, 8548133], [8548134, 9325236], [9325237, 10102339], [10102340, 10879442], [10879443, 11656545], [11656546, 12433648], [12433649, 13210751], [13210752, 13987854], [13987855, 14764957], [14764958, 15542068]] SRR7170448 file size 5244996 SRR7170448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170448 SRR7170448_1.fastq SRR7170448_2.fastq Input file: SRR7170448_1.fastq Paired file: SRR7170448_2.fastq trimmed: SRR7170448-trimmed-pair1.fastq, SRR7170448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:39:42 2025 >> started Wed Feb 12 19:40:01 2025 >> done (19.369s) 15542068 read pairs processed; of these: 16370 ( 0.11%) short read pairs filtered out after trimming by size control 16483 ( 0.11%) empty read pairs filtered out after trimming by size control 15509215 (99.79%) read pairs available; of these: 8635874 (55.68%) trimmed read pairs available after processing 6873341 (44.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 12 0.00% 24 4 0.00% 25 7 0.00% 26 9 0.00% 27 10 0.00% 28 8 0.00% 29 10 0.00% 30 10 0.00% 31 12 0.00% 32 11 0.00% 33 8 0.00% 34 6 0.00% 35 20 0.00% 36 18 0.00% 37 22 0.00% 38 18 0.00% 39 36 0.00% 40 39 0.00% 41 48 0.00% 42 56 0.00% 43 50 0.00% 44 60 0.00% 45 69 0.00% 46 73 0.00% 47 75 0.00% 48 120 0.00% 49 132 0.00% 50 157 0.00% 51 188 0.00% 52 159 0.00% 53 198 0.00% 54 224 0.00% 55 245 0.00% 56 272 0.00% 57 319 0.00% 58 383 0.00% 59 421 0.00% 60 465 0.00% 61 584 0.00% 62 634 0.00% 63 685 0.00% 64 745 0.00% 65 826 0.01% 66 918 0.01% 67 971 0.01% 68 1118 0.01% 69 1264 0.01% 70 1476 0.01% 71 1606 0.01% 72 1842 0.01% 73 2217 0.01% 74 2310 0.01% 75 2600 0.02% 76 2876 0.02% 77 3101 0.02% 78 3021 0.02% 79 3336 0.02% 80 3848 0.02% 81 4165 0.03% 82 4767 0.03% 83 5242 0.03% 84 6429 0.04% 85 7283 0.05% 86 7293 0.05% 87 7698 0.05% 88 8003 0.05% 89 8394 0.05% 90 8677 0.06% 91 9450 0.06% 92 10152 0.07% 93 11058 0.07% 94 11418 0.07% 95 12284 0.08% 96 12359 0.08% 97 12608 0.08% 98 13007 0.08% 99 13447 0.09% 100 13808 0.09% 101 14575 0.09% 102 15328 0.10% 103 16462 0.11% 104 16831 0.11% 105 17526 0.11% 106 17695 0.11% 107 18124 0.12% 108 18415 0.12% 109 18795 0.12% 110 19356 0.12% 111 19734 0.13% 112 20500 0.13% 113 21267 0.14% 114 22142 0.14% 115 23079 0.15% 116 23678 0.15% 117 24041 0.16% 118 24403 0.16% 119 24742 0.16% 120 25341 0.16% 121 25803 0.17% 122 26681 0.17% 123 28322 0.18% 124 29694 0.19% 125 30325 0.20% 126 32099 0.21% 127 32915 0.21% 128 34791 0.22% 129 35752 0.23% 130 37632 0.24% 131 39441 0.25% 132 41740 0.27% 133 44669 0.29% 134 47571 0.31% 135 51537 0.33% 136 55790 0.36% 137 60448 0.39% 138 65828 0.42% 139 73250 0.47% 140 81313 0.52% 141 92267 0.59% 142 107277 0.69% 143 127215 0.82% 144 154909 1.00% 145 194092 1.25% 146 252827 1.63% 147 355775 2.29% 148 554418 3.57% 149 1093032 7.05% 150 4198914 27.07% 151 6873341 44.32% 15509215 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=15 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=45.03 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=16 prefix-density=0.89 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.25 sequence-density-rank=15 fanout-score=10.15 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=5.7 sequence=AAGAAAGCTTACCCTAAC SRR7170448 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:40:48 Started mapping on | Feb 12 19:40:48 Finished on | Feb 12 19:42:42 Mapping speed, Million of reads per hour | 489.76 Number of input reads | 15509215 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14327359 Uniquely mapped reads % | 92.38% Average mapped length | 293.07 Number of splices: Total | 13865811 Number of splices: Annotated (sjdb) | 13521875 Number of splices: GT/AG | 13605967 Number of splices: GC/AG | 206811 Number of splices: AT/AC | 8064 Number of splices: Non-canonical | 44969 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405440 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 37834 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 790262 790262 790262 N_multimapping 405440 405440 405440 N_noFeature 549002 14068156 621109 N_ambiguous 308282 837 120958 UnstrandedReadsAssigned:13470075 PositiveStrandReadsAssigned:258366 NegativeStrandReadsAssigned:13585292 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170448-trimmed-pair1.fastq SRR7170448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,509,215 reads, 13,482,525 reads pseudoaligned [quant] estimated average fragment length: 272.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7170448.ke.tsv 34699 SRR7170448.se.tsv 87100 total ==> SRR7170448.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.08 919 33.316 Potri.005G024800.1.v4.1 1035 763.075 302 25.0519 Potri.004G059700.1.v4.1 961 689.101 7 0.643007 Potri.007G009000.2.v4.1 1416 1144.08 0 0 Potri.003G141000.2.v4.1 2943 2671.08 597 14.1478 Potri.016G087400.1.v4.1 270 76.378 802.792 665.328 Potri.015G069301.1.v4.1 564 298.047 0 0 Potri.010G195200.1.v4.1 1773 1501.08 99 4.17478 Potri.012G127500.1.v4.1 977 705.091 113 10.1446 ==> SRR7170448.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 323 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170448 completed mapping pipeline successfully