Starting /dee2/code/volunteer_pipeline.sh SRR7170449 current disk space = 3050911506432 free memory = 1578597904 SRR7170449 SRAfilesize efa22ecdc1ae65dc610949eafc5a563c SRR7170449.sra SRR7170449.sra file validated SRR7170449 is paired end SRR7170449 is conventional basespace SRR7170449 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.5705 28.0 18.0 33.0 18.0 33.0 2 29.485 31.0 29.0 33.0 25.0 33.0 3 31.90625 33.0 31.0 33.0 29.0 33.0 4 32.559 33.0 33.0 33.0 31.0 34.0 5 33.0695 33.0 33.0 34.0 33.0 34.0 6 37.136 38.0 37.0 38.0 36.0 38.0 7 37.441 38.0 38.0 38.0 37.0 38.0 8 37.4665 38.0 38.0 38.0 37.0 38.0 9 37.529 38.0 38.0 38.0 38.0 38.0 10-14 37.61365 38.0 38.0 38.0 38.0 38.0 15-19 37.6294 38.0 38.0 38.0 38.0 38.0 20-24 37.251549999999995 38.0 38.0 38.0 36.6 38.0 25-29 36.74255 38.0 37.8 38.0 34.6 38.0 30-34 37.4433 38.0 38.0 38.0 37.0 38.0 35-39 37.51885 38.0 38.0 38.0 37.6 38.0 40-44 36.94745 38.0 37.8 38.0 35.0 38.0 45-49 34.679899999999996 37.8 33.6 38.0 25.0 38.0 50-54 37.0955 38.0 37.8 38.0 35.8 38.0 55-59 37.23795 38.0 38.0 38.0 36.2 38.0 60-64 37.15585 38.0 38.0 38.0 36.0 38.0 65-69 37.0627 38.0 38.0 38.0 36.0 38.0 70-74 37.0536 38.0 38.0 38.0 36.0 38.0 75-79 36.9071 38.0 38.0 38.0 35.6 38.0 80-84 36.8105 38.0 38.0 38.0 34.8 38.0 85-89 36.63775 38.0 38.0 38.0 34.0 38.0 90-94 36.3928 38.0 37.6 38.0 34.0 38.0 95-99 36.494299999999996 38.0 37.8 38.0 34.0 38.0 100-104 36.41785 38.0 37.4 38.0 34.0 38.0 105-109 36.3804 38.0 37.2 38.0 33.8 38.0 110-114 35.96635 38.0 36.8 38.0 32.4 38.0 115-119 35.477999999999994 38.0 36.2 38.0 30.2 38.0 120-124 35.337300000000006 38.0 35.8 38.0 29.6 38.0 125-129 35.2625 38.0 36.0 38.0 29.8 38.0 130-134 34.9921 38.0 35.0 38.0 28.0 38.0 135-139 34.186249999999994 38.0 33.6 38.0 25.0 38.0 140-144 28.9809 33.6 23.4 37.0 15.4 38.0 145-149 26.089350000000003 31.8 15.6 37.6 2.0 38.0 150-151 16.41875 11.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 3.0 20 3.0 21 4.0 22 2.0 23 5.0 24 6.0 25 9.0 26 15.0 27 21.0 28 32.0 29 60.0 30 62.0 31 85.0 32 118.0 33 196.0 34 337.0 35 741.0 36 1487.0 37 804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.905852417302796 10.712468193384224 10.458015267175574 39.9236641221374 2 21.507260891337005 14.371557336004006 35.878818227341014 28.24236354531798 3 19.275000000000002 20.474999999999998 24.65 35.6 4 23.525 28.425 22.625 25.424999999999997 5 23.0 32.725 24.55 19.725 6 18.7 35.975 25.124999999999996 20.200000000000003 7 14.2 26.424999999999997 41.699999999999996 17.675 8 18.075 25.75 30.65 25.525 9 16.525000000000002 24.6 34.575 24.3 10-14 19.435 30.005 27.305 23.255 15-19 19.915 28.125 28.665000000000003 23.294999999999998 20-24 19.650000000000002 28.57 28.21 23.57 25-29 19.455 29.48 27.595 23.47 30-34 19.555 29.215000000000003 27.505000000000003 23.724999999999998 35-39 20.0 28.935 26.76 24.305 40-44 19.785 29.189999999999998 27.150000000000002 23.875 45-49 19.675 28.955 27.805000000000003 23.565 50-54 19.81 28.58 27.605 24.005000000000003 55-59 19.865 28.765 27.6 23.77 60-64 20.14 28.34 28.139999999999997 23.380000000000003 65-69 19.785 29.049999999999997 27.639999999999997 23.525 70-74 20.500125031257816 28.75218804701175 27.426856714178545 23.320830207551886 75-79 20.52 28.835 27.435 23.21 80-84 19.665 28.585 27.845 23.905 85-89 19.66 28.63 27.639999999999997 24.07 90-94 21.071321396418927 27.97339201760528 27.643292987896366 23.311993598079425 95-99 20.5330799619943 27.974196129419415 27.544131619742963 23.948592288843326 100-104 20.25 28.904999999999998 27.13 23.715 105-109 20.365 28.884999999999998 27.37 23.380000000000003 110-114 20.805 28.59 27.205000000000002 23.400000000000002 115-119 20.830000000000002 28.565 27.37 23.235 120-124 20.385 28.205000000000002 27.73 23.68 125-129 20.4 28.075 27.229999999999997 24.295 130-134 20.855 27.04 28.065 24.04 135-139 20.255000000000003 28.904999999999998 26.875 23.965 140-144 20.455000000000002 28.349999999999998 27.005000000000003 24.19 145-149 20.53 28.04 27.175 24.255 150-151 20.225 29.1125 26.8375 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 1.5 21 0.0 22 0.0 23 0.5 24 2.0 25 4.5 26 4.5 27 5.5 28 10.5 29 14.0 30 19.5 31 26.0 32 38.0 33 51.5 34 62.5 35 76.0 36 96.0 37 110.0 38 122.5 39 164.5 40 193.5 41 231.0 42 260.0 43 249.5 44 242.0 45 255.0 46 263.5 47 240.0 48 218.5 49 198.5 50 173.0 51 150.5 52 119.5 53 91.0 54 79.5 55 69.5 56 54.0 57 34.0 58 21.5 59 13.0 60 8.5 61 9.0 62 5.5 63 1.5 64 1.0 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6624999999999996 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.262499999999999 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCAT 10 0.0068343505 144.975 3 >>END_MODULE SRR7170449 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170449_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.966 33.0 33.0 34.0 32.0 34.0 2 33.04575 34.0 33.0 34.0 32.0 34.0 3 33.0875 34.0 33.0 34.0 32.0 34.0 4 33.04325 34.0 33.0 34.0 32.0 34.0 5 33.03875 34.0 33.0 34.0 32.0 34.0 6 37.184 38.0 38.0 38.0 37.0 38.0 7 37.3005 38.0 38.0 38.0 37.0 38.0 8 37.248 38.0 38.0 38.0 37.0 38.0 9 37.318 38.0 38.0 38.0 37.0 38.0 10-14 36.42525 38.0 36.6 38.0 32.8 38.0 15-19 36.7427 38.0 37.6 38.0 34.4 38.0 20-24 36.785000000000004 38.0 38.0 38.0 35.2 38.0 25-29 36.81535 38.0 38.0 38.0 35.4 38.0 30-34 37.02195 38.0 38.0 38.0 36.2 38.0 35-39 36.9952 38.0 38.0 38.0 36.4 38.0 40-44 37.04405 38.0 38.0 38.0 36.2 38.0 45-49 35.76520000000001 38.0 35.6 38.0 30.8 38.0 50-54 36.05015 38.0 36.8 38.0 31.4 38.0 55-59 36.972899999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.87815 38.0 38.0 38.0 35.6 38.0 65-69 36.80315 38.0 38.0 38.0 35.2 38.0 70-74 36.707649999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.71410000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.61944999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.61579999999999 38.0 38.0 38.0 34.8 38.0 90-94 36.5578 38.0 38.0 38.0 34.4 38.0 95-99 36.32475 38.0 38.0 38.0 34.0 38.0 100-104 36.107600000000005 38.0 37.2 38.0 33.4 38.0 105-109 35.965199999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.929 38.0 37.4 38.0 32.8 38.0 115-119 35.68385 38.0 36.8 38.0 31.4 38.0 120-124 35.30315 38.0 36.4 38.0 29.8 38.0 125-129 34.63475 38.0 35.2 38.0 26.8 38.0 130-134 34.515649999999994 38.0 34.8 38.0 26.8 38.0 135-139 33.72385 38.0 33.2 38.0 22.6 38.0 140-144 32.70025 38.0 33.0 38.0 16.6 38.0 145-149 31.801350000000003 38.0 32.8 38.0 8.6 38.0 150-151 26.0425 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 2.0 6 1.0 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 1.0 15 5.0 16 4.0 17 4.0 18 6.0 19 9.0 20 7.0 21 9.0 22 4.0 23 16.0 24 14.0 25 21.0 26 30.0 27 25.0 28 44.0 29 41.0 30 50.0 31 57.0 32 86.0 33 122.0 34 205.0 35 360.0 36 842.0 37 2025.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.875 19.525000000000002 16.725 28.875 2 26.224999999999998 26.174999999999997 31.525 16.075 3 20.95 27.775 31.75 19.525000000000002 4 23.400000000000002 34.4 22.975 19.225 5 24.825 35.3 22.35 17.525 6 19.825 36.7 25.650000000000002 17.825 7 19.400000000000002 21.425 40.425 18.75 8 22.15 25.124999999999996 27.625 25.1 9 21.175 25.45 29.599999999999998 23.775 10-14 22.735 29.310000000000002 26.865 21.09 15-19 22.765 28.189999999999998 28.105000000000004 20.94 20-24 23.155 27.915 28.194999999999997 20.735 25-29 23.28 27.875 28.299999999999997 20.544999999999998 30-34 22.68 28.000000000000004 27.855 21.465 35-39 22.505 28.315 28.244999999999997 20.935000000000002 40-44 23.080000000000002 27.755000000000003 28.505000000000003 20.66 45-49 23.185 28.57 27.27 20.974999999999998 50-54 22.564999999999998 28.449999999999996 27.715 21.27 55-59 23.025000000000002 27.58 28.23 21.165 60-64 22.765 27.79 28.349999999999998 21.095 65-69 23.419999999999998 27.900000000000002 27.97 20.71 70-74 23.380000000000003 27.6 28.02 21.0 75-79 23.015 28.24 27.834999999999997 20.91 80-84 23.369999999999997 27.785 28.050000000000004 20.794999999999998 85-89 23.425 27.49 28.335 20.75 90-94 23.635 27.810000000000002 28.055000000000003 20.5 95-99 23.855 27.74 28.055000000000003 20.349999999999998 100-104 23.61 27.92 27.625 20.845 105-109 23.71 27.744999999999997 27.689999999999998 20.855 110-114 24.18 28.265 27.495000000000005 20.06 115-119 23.645 28.975 27.05 20.330000000000002 120-124 23.98 28.175 27.61 20.235 125-129 24.099999999999998 27.97 27.07 20.86 130-134 24.325 27.6 28.01 20.064999999999998 135-139 24.47 28.050000000000004 27.095000000000002 20.385 140-144 25.009999999999998 27.0 27.965 20.025000000000002 145-149 24.86 27.639999999999997 27.045 20.455000000000002 150-151 24.349999999999998 27.3125 27.800000000000004 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 2.0 23 4.5 24 5.0 25 2.5 26 2.0 27 4.5 28 6.5 29 10.0 30 14.5 31 24.0 32 28.5 33 34.5 34 52.0 35 61.5 36 88.0 37 120.5 38 140.5 39 182.0 40 219.5 41 223.5 42 242.0 43 273.0 44 268.5 45 260.0 46 267.0 47 246.0 48 207.5 49 184.0 50 169.0 51 150.0 52 116.0 53 86.5 54 77.0 55 65.5 56 49.0 57 33.5 58 20.0 59 17.5 60 14.5 61 8.0 62 6.5 63 4.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.4278882456581928 0.8500000000000001 3 0.0 0.0 4 0.05033979360684621 0.2 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6624999999999996 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.237500000000001 0.0 0.0 0.0 0.0 128-129 4.762499999999999 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATCA 10 0.006830828 145.0 3 TTTTTTT 30 0.0014437955 24.166668 105-109 >>END_MODULE Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra Read 667291 spots for SRR7170449.sra Written 667291 spots for SRR7170449.sra SRR ids: ['SRR7170449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ebnuniai SRR7170449.sra spots: 13345820 blocks: [[1, 667291], [667292, 1334582], [1334583, 2001873], [2001874, 2669164], [2669165, 3336455], [3336456, 4003746], [4003747, 4671037], [4671038, 5338328], [5338329, 6005619], [6005620, 6672910], [6672911, 7340201], [7340202, 8007492], [8007493, 8674783], [8674784, 9342074], [9342075, 10009365], [10009366, 10676656], [10676657, 11343947], [11343948, 12011238], [12011239, 12678529], [12678530, 13345820]] SRR7170449 file size 4500760 SRR7170449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170449 SRR7170449_1.fastq SRR7170449_2.fastq Input file: SRR7170449_1.fastq Paired file: SRR7170449_2.fastq trimmed: SRR7170449-trimmed-pair1.fastq, SRR7170449-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:43 2025 >> started Wed Feb 12 20:38:00 2025 >> done (16.346s) 13345820 read pairs processed; of these: 7978 ( 0.06%) short read pairs filtered out after trimming by size control 9818 ( 0.07%) empty read pairs filtered out after trimming by size control 13328024 (99.87%) read pairs available; of these: 7531746 (56.51%) trimmed read pairs available after processing 5796278 (43.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 2 0.00% 28 7 0.00% 29 8 0.00% 30 7 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 11 0.00% 35 9 0.00% 36 16 0.00% 37 24 0.00% 38 21 0.00% 39 29 0.00% 40 24 0.00% 41 35 0.00% 42 36 0.00% 43 38 0.00% 44 30 0.00% 45 56 0.00% 46 59 0.00% 47 85 0.00% 48 72 0.00% 49 104 0.00% 50 121 0.00% 51 132 0.00% 52 167 0.00% 53 156 0.00% 54 171 0.00% 55 210 0.00% 56 183 0.00% 57 233 0.00% 58 286 0.00% 59 336 0.00% 60 393 0.00% 61 407 0.00% 62 486 0.00% 63 585 0.00% 64 594 0.00% 65 622 0.00% 66 690 0.01% 67 754 0.01% 68 861 0.01% 69 1024 0.01% 70 1114 0.01% 71 1243 0.01% 72 1518 0.01% 73 1715 0.01% 74 1794 0.01% 75 2001 0.02% 76 2259 0.02% 77 2444 0.02% 78 2538 0.02% 79 2807 0.02% 80 2963 0.02% 81 3370 0.03% 82 3909 0.03% 83 4267 0.03% 84 4876 0.04% 85 5584 0.04% 86 5784 0.04% 87 6021 0.05% 88 6606 0.05% 89 6821 0.05% 90 7118 0.05% 91 7731 0.06% 92 8254 0.06% 93 9108 0.07% 94 9594 0.07% 95 10183 0.08% 96 10581 0.08% 97 10826 0.08% 98 11353 0.09% 99 11499 0.09% 100 12253 0.09% 101 12633 0.09% 102 13359 0.10% 103 13910 0.10% 104 14598 0.11% 105 15273 0.11% 106 15410 0.12% 107 16098 0.12% 108 16214 0.12% 109 16905 0.13% 110 16785 0.13% 111 17699 0.13% 112 18179 0.14% 113 18926 0.14% 114 19512 0.15% 115 20206 0.15% 116 20943 0.16% 117 21274 0.16% 118 21771 0.16% 119 22152 0.17% 120 22905 0.17% 121 23518 0.18% 122 24203 0.18% 123 24846 0.19% 124 26231 0.20% 125 27221 0.20% 126 28383 0.21% 127 29531 0.22% 128 30835 0.23% 129 32193 0.24% 130 33183 0.25% 131 34950 0.26% 132 37420 0.28% 133 39008 0.29% 134 42359 0.32% 135 45338 0.34% 136 49272 0.37% 137 53316 0.40% 138 58388 0.44% 139 64415 0.48% 140 71819 0.54% 141 80925 0.61% 142 94163 0.71% 143 110354 0.83% 144 133394 1.00% 145 166515 1.25% 146 215678 1.62% 147 301743 2.26% 148 474570 3.56% 149 945779 7.10% 150 3690177 27.69% 151 5796278 43.49% 13328024 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=323.92 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=35.40 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170449 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:57 Started mapping on | Feb 12 20:38:57 Finished on | Feb 12 20:40:41 Mapping speed, Million of reads per hour | 461.35 Number of input reads | 13328024 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12538021 Uniquely mapped reads % | 94.07% Average mapped length | 293.43 Number of splices: Total | 11972644 Number of splices: Annotated (sjdb) | 11707141 Number of splices: GT/AG | 11750499 Number of splices: GC/AG | 180720 Number of splices: AT/AC | 7301 Number of splices: Non-canonical | 34124 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348980 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 33519 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448738 448738 448738 N_multimapping 348980 348980 348980 N_noFeature 456069 12317535 530564 N_ambiguous 231974 924 85439 UnstrandedReadsAssigned:11849978 PositiveStrandReadsAssigned:219562 NegativeStrandReadsAssigned:11922018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170449 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170449-trimmed-pair1.fastq SRR7170449-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,328,024 reads, 11,846,455 reads pseudoaligned [quant] estimated average fragment length: 276.232 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7170449.ke.tsv 34699 SRR7170449.se.tsv 87100 total ==> SRR7170449.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.77 387.515 16.9915 Potri.005G024800.1.v4.1 1035 759.768 116 11.667 Potri.004G059700.1.v4.1 961 685.8 7 0.77998 Potri.007G009000.2.v4.1 1416 1140.77 0 0 Potri.003G141000.2.v4.1 2943 2667.77 573 16.4131 Potri.016G087400.1.v4.1 270 78.1149 643.701 629.699 Potri.015G069301.1.v4.1 564 295.209 0 0 Potri.010G195200.1.v4.1 1773 1497.77 25 1.27549 Potri.012G127500.1.v4.1 977 701.773 125 13.6112 ==> SRR7170449.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 920 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 38 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170449 completed mapping pipeline successfully