Starting /dee2/code/volunteer_pipeline.sh SRR7170450 current disk space = 3050949492736 free memory = 1509189600 SRR7170450 SRAfilesize 2705eb3aeaa035d4af2718470095cd2a SRR7170450.sra SRR7170450.sra file validated SRR7170450 is paired end SRR7170450 is conventional basespace SRR7170450 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.19275 30.0 18.0 33.0 18.0 33.0 2 29.545 31.0 29.0 33.0 25.0 33.0 3 31.7535 33.0 31.0 33.0 28.0 33.0 4 32.396 33.0 33.0 33.0 31.0 34.0 5 32.94675 33.0 33.0 34.0 32.0 34.0 6 36.93925 38.0 37.0 38.0 35.0 38.0 7 37.418 38.0 38.0 38.0 37.0 38.0 8 37.56025 38.0 38.0 38.0 37.0 38.0 9 37.61825 38.0 38.0 38.0 38.0 38.0 10-14 37.634 38.0 38.0 38.0 38.0 38.0 15-19 37.626099999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.541250000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.590199999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.57195 38.0 38.0 38.0 38.0 38.0 35-39 37.513999999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.4851 38.0 38.0 38.0 37.4 38.0 45-49 37.41035 38.0 38.0 38.0 37.0 38.0 50-54 37.39405000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.30965 38.0 38.0 38.0 36.8 38.0 60-64 37.23405 38.0 38.0 38.0 36.4 38.0 65-69 37.1785 38.0 38.0 38.0 36.2 38.0 70-74 37.11805 38.0 38.0 38.0 36.0 38.0 75-79 36.998000000000005 38.0 38.0 38.0 35.8 38.0 80-84 37.0024 38.0 38.0 38.0 35.8 38.0 85-89 36.7303 38.0 38.0 38.0 35.0 38.0 90-94 36.63674999999999 38.0 38.0 38.0 34.6 38.0 95-99 36.5457 38.0 37.8 38.0 34.2 38.0 100-104 36.5952 38.0 38.0 38.0 34.0 38.0 105-109 36.3818 38.0 37.4 38.0 34.0 38.0 110-114 36.20219999999999 38.0 37.2 38.0 33.4 38.0 115-119 35.72185 38.0 36.8 38.0 31.0 38.0 120-124 35.8814 38.0 37.0 38.0 32.0 38.0 125-129 35.5021 38.0 36.0 38.0 30.2 38.0 130-134 32.0473 35.0 28.2 38.0 22.0 38.0 135-139 34.29745 38.0 33.4 38.0 25.4 38.0 140-144 30.46415 34.2 26.4 38.0 16.0 38.0 145-149 32.559799999999996 37.4 32.6 38.0 15.2 38.0 150-151 28.477125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 9.0 20 1.0 21 6.0 22 4.0 23 5.0 24 10.0 25 10.0 26 12.0 27 20.0 28 25.0 29 28.0 30 38.0 31 61.0 32 89.0 33 133.0 34 221.0 35 384.0 36 1287.0 37 1655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.296952331336286 11.252930450638186 8.85647303985413 39.5936441781714 2 21.56617463097323 13.785339004253188 36.92769577182887 27.72079059294471 3 19.525000000000002 19.7 25.900000000000002 34.875 4 22.275 27.775 23.9 26.05 5 22.35 31.874999999999996 25.124999999999996 20.65 6 18.175 33.575 27.450000000000003 20.8 7 12.975 26.5 43.325 17.2 8 18.7 24.95 30.349999999999998 26.0 9 17.724999999999998 23.275000000000002 34.5 24.5 10-14 19.275000000000002 30.04 27.465 23.22 15-19 19.86 28.62 28.084999999999997 23.435 20-24 19.62 28.860000000000003 27.77 23.75 25-29 19.564999999999998 28.87 27.605 23.96 30-34 19.52 29.385 27.54 23.555 35-39 19.650000000000002 28.815 27.98 23.555 40-44 19.93 29.01 28.055000000000003 23.005 45-49 19.939999999999998 28.53 27.705000000000002 23.825 50-54 19.825 28.115000000000002 28.439999999999998 23.62 55-59 19.475 29.049999999999997 27.445000000000004 24.03 60-64 20.4 28.305000000000003 27.82 23.474999999999998 65-69 20.21 28.225 27.915 23.65 70-74 19.71 28.904999999999998 27.255000000000003 24.13 75-79 19.830000000000002 28.51 28.1 23.56 80-84 19.97 28.185 27.805000000000003 24.04 85-89 20.47 28.194999999999997 28.189999999999998 23.145 90-94 20.59 28.315 27.735 23.36 95-99 20.135 28.235 28.16 23.47 100-104 20.755000000000003 28.84 27.029999999999998 23.375 105-109 20.32 28.349999999999998 27.625 23.705000000000002 110-114 19.81 28.315 27.334999999999997 24.54 115-119 20.82 28.205000000000002 27.6 23.375 120-124 21.08 28.645 27.279999999999998 22.994999999999997 125-129 19.939999999999998 28.57 27.93 23.56 130-134 20.4 27.865000000000002 28.044999999999998 23.69 135-139 21.01 27.725 27.365000000000002 23.9 140-144 20.630000000000003 28.37 27.544999999999998 23.455000000000002 145-149 20.59 28.03 27.68 23.7 150-151 20.3625 27.3875 27.35 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.0 24 0.5 25 0.5 26 3.5 27 7.0 28 8.5 29 13.0 30 19.5 31 24.0 32 34.0 33 49.0 34 57.5 35 72.0 36 94.0 37 124.0 38 160.5 39 175.5 40 201.0 41 235.5 42 234.5 43 242.5 44 258.5 45 253.0 46 253.0 47 246.5 48 228.0 49 208.0 50 177.0 51 143.0 52 113.5 53 94.5 54 69.5 55 49.0 56 40.5 57 31.5 58 22.0 59 14.5 60 14.0 61 10.0 62 5.0 63 1.5 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.025 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGAAC 20 0.0059376103 28.9975 130-134 >>END_MODULE SRR7170450 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170450_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.974 33.0 33.0 34.0 32.0 34.0 2 33.00625 34.0 33.0 34.0 32.0 34.0 3 33.03175 34.0 33.0 34.0 32.0 34.0 4 33.05525 34.0 33.0 34.0 32.0 34.0 5 33.0525 34.0 33.0 34.0 32.0 34.0 6 37.257 38.0 38.0 38.0 37.0 38.0 7 37.229 38.0 38.0 38.0 37.0 38.0 8 37.1475 38.0 38.0 38.0 37.0 38.0 9 37.15725 38.0 38.0 38.0 37.0 38.0 10-14 37.14960000000001 38.0 38.0 38.0 36.8 38.0 15-19 36.02910000000001 38.0 36.8 38.0 30.6 38.0 20-24 36.91975 38.0 38.0 38.0 36.0 38.0 25-29 36.820949999999996 38.0 38.0 38.0 35.6 38.0 30-34 37.00055 38.0 38.0 38.0 36.2 38.0 35-39 37.01535 38.0 38.0 38.0 36.0 38.0 40-44 36.98434999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.92255 38.0 38.0 38.0 35.8 38.0 50-54 36.92784999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.921800000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.73255 38.0 38.0 38.0 35.4 38.0 65-69 36.7171 38.0 38.0 38.0 35.4 38.0 70-74 36.65485 38.0 38.0 38.0 35.0 38.0 75-79 36.6322 38.0 38.0 38.0 34.8 38.0 80-84 36.543 38.0 38.0 38.0 34.4 38.0 85-89 36.07885 38.0 37.6 38.0 32.6 38.0 90-94 34.046749999999996 37.4 33.2 38.0 23.2 38.0 95-99 36.0478 38.0 37.0 38.0 33.4 38.0 100-104 36.00580000000001 38.0 37.2 38.0 33.0 38.0 105-109 35.80655 38.0 37.0 38.0 32.0 38.0 110-114 35.65285 38.0 37.0 38.0 31.0 38.0 115-119 35.54774999999999 38.0 36.6 38.0 31.0 38.0 120-124 34.853300000000004 38.0 36.0 38.0 27.0 38.0 125-129 34.5657 38.0 35.0 38.0 26.0 38.0 130-134 34.16565000000001 38.0 34.2 38.0 24.6 38.0 135-139 33.2619 38.0 33.0 38.0 20.0 38.0 140-144 32.50835 38.0 33.0 38.0 13.6 38.0 145-149 31.1313 37.8 30.6 38.0 8.2 38.0 150-151 25.183124999999997 32.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 3.0 11 0.0 12 0.0 13 2.0 14 2.0 15 4.0 16 6.0 17 3.0 18 6.0 19 10.0 20 9.0 21 12.0 22 8.0 23 11.0 24 21.0 25 16.0 26 26.0 27 44.0 28 41.0 29 38.0 30 65.0 31 85.0 32 71.0 33 133.0 34 225.0 35 392.0 36 838.0 37 1920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.125 20.5 14.674999999999999 30.7 2 25.85 26.474999999999998 31.35 16.325 3 19.975 27.85 31.225 20.95 4 22.400000000000002 34.9 23.75 18.95 5 24.425 35.3 22.875 17.4 6 19.975 38.824999999999996 23.549999999999997 17.65 7 19.475 21.8 39.800000000000004 18.925 8 21.475 26.1 27.775 24.65 9 22.1 24.7 29.725 23.474999999999998 10-14 23.235 28.665000000000003 27.065 21.035 15-19 22.61 28.005000000000003 28.494999999999997 20.89 20-24 22.795 28.585 27.88 20.74 25-29 22.564999999999998 28.735 28.065 20.635 30-34 22.81 28.310000000000002 28.43 20.45 35-39 23.315 28.4 27.644999999999996 20.64 40-44 22.745 28.365000000000002 28.09 20.8 45-49 23.125 27.715 28.060000000000002 21.099999999999998 50-54 22.57 28.255000000000003 28.060000000000002 21.115000000000002 55-59 22.830000000000002 28.16 28.144999999999996 20.865000000000002 60-64 23.11 27.54 28.4 20.95 65-69 23.18 27.639999999999997 28.249999999999996 20.93 70-74 22.925 27.994999999999997 28.005000000000003 21.075 75-79 23.599999999999998 27.755000000000003 27.805000000000003 20.84 80-84 23.465 27.534999999999997 27.644999999999996 21.355 85-89 22.91 28.255000000000003 27.66 21.175 90-94 22.869999999999997 28.655 27.18 21.295 95-99 23.11 27.935 27.839999999999996 21.115000000000002 100-104 23.880000000000003 27.395000000000003 27.775 20.95 105-109 23.455000000000002 27.99 28.015 20.54 110-114 23.61 28.275 27.73 20.385 115-119 23.74 28.03 27.57 20.66 120-124 23.89 28.095 27.74 20.275000000000002 125-129 23.885 28.18 27.655 20.28 130-134 24.245 27.845 27.52 20.39 135-139 24.19 27.55 28.33 19.93 140-144 24.625 28.01 27.22 20.145 145-149 23.815 28.345 27.935 19.905 150-151 24.9125 28.15 27.212500000000002 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 2.5 25 0.5 26 2.0 27 6.0 28 9.5 29 13.5 30 18.5 31 21.0 32 25.5 33 41.5 34 53.5 35 66.5 36 86.5 37 118.5 38 142.5 39 165.5 40 210.5 41 241.0 42 245.5 43 271.0 44 284.0 45 263.0 46 267.5 47 256.0 48 215.0 49 182.5 50 156.0 51 127.5 52 113.5 53 101.0 54 74.5 55 55.0 56 41.5 57 31.0 58 26.5 59 21.0 60 14.0 61 8.5 62 5.0 63 1.5 64 2.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.604991177211999 1.2 3 0.025207965717166627 0.075 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 3.9875000000000003 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.75 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGGA 10 0.006830828 145.0 2 GTTGTTT 10 0.006830828 145.0 7 TTTTTTT 30 0.0014437955 24.166668 90-94 >>END_MODULE Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716484 spots for SRR7170450.sra Written 716484 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra Read 716481 spots for SRR7170450.sra Written 716481 spots for SRR7170450.sra SRR ids: ['SRR7170450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2xder7ny SRR7170450.sra spots: 14329623 blocks: [[1, 716481], [716482, 1432962], [1432963, 2149443], [2149444, 2865924], [2865925, 3582405], [3582406, 4298886], [4298887, 5015367], [5015368, 5731848], [5731849, 6448329], [6448330, 7164810], [7164811, 7881291], [7881292, 8597772], [8597773, 9314253], [9314254, 10030734], [10030735, 10747215], [10747216, 11463696], [11463697, 12180177], [12180178, 12896658], [12896659, 13613139], [13613140, 14329623]] SRR7170450 file size 4834138 SRR7170450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170450 SRR7170450_1.fastq SRR7170450_2.fastq Input file: SRR7170450_1.fastq Paired file: SRR7170450_2.fastq trimmed: SRR7170450-trimmed-pair1.fastq, SRR7170450-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:36:32 2025 >> started Wed Feb 12 20:36:47 2025 >> done (15.012s) 14329623 read pairs processed; of these: 7615 ( 0.05%) short read pairs filtered out after trimming by size control 11027 ( 0.08%) empty read pairs filtered out after trimming by size control 14310981 (99.87%) read pairs available; of these: 8365534 (58.46%) trimmed read pairs available after processing 5945447 (41.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 9 0.00% 30 6 0.00% 31 4 0.00% 32 8 0.00% 33 13 0.00% 34 13 0.00% 35 7 0.00% 36 8 0.00% 37 24 0.00% 38 23 0.00% 39 23 0.00% 40 31 0.00% 41 40 0.00% 42 44 0.00% 43 37 0.00% 44 39 0.00% 45 55 0.00% 46 62 0.00% 47 76 0.00% 48 85 0.00% 49 110 0.00% 50 134 0.00% 51 159 0.00% 52 159 0.00% 53 160 0.00% 54 187 0.00% 55 215 0.00% 56 216 0.00% 57 256 0.00% 58 274 0.00% 59 325 0.00% 60 434 0.00% 61 453 0.00% 62 470 0.00% 63 595 0.00% 64 626 0.00% 65 700 0.00% 66 758 0.01% 67 877 0.01% 68 878 0.01% 69 1057 0.01% 70 1157 0.01% 71 1379 0.01% 72 1596 0.01% 73 1746 0.01% 74 2015 0.01% 75 2093 0.01% 76 2499 0.02% 77 2615 0.02% 78 2765 0.02% 79 3053 0.02% 80 3260 0.02% 81 3832 0.03% 82 4245 0.03% 83 4685 0.03% 84 5492 0.04% 85 6295 0.04% 86 6372 0.04% 87 6851 0.05% 88 7184 0.05% 89 7427 0.05% 90 8059 0.06% 91 8683 0.06% 92 9022 0.06% 93 10042 0.07% 94 10571 0.07% 95 11343 0.08% 96 11694 0.08% 97 12101 0.08% 98 12410 0.09% 99 12697 0.09% 100 13562 0.09% 101 13816 0.10% 102 14760 0.10% 103 15621 0.11% 104 16132 0.11% 105 16793 0.12% 106 17303 0.12% 107 18043 0.13% 108 18101 0.13% 109 18607 0.13% 110 18857 0.13% 111 19549 0.14% 112 20290 0.14% 113 20947 0.15% 114 21954 0.15% 115 22711 0.16% 116 23417 0.16% 117 24485 0.17% 118 24597 0.17% 119 24867 0.17% 120 25841 0.18% 121 26811 0.19% 122 27368 0.19% 123 28489 0.20% 124 30025 0.21% 125 31545 0.22% 126 33212 0.23% 127 34733 0.24% 128 36417 0.25% 129 38290 0.27% 130 40063 0.28% 131 42255 0.30% 132 44823 0.31% 133 48271 0.34% 134 51722 0.36% 135 56231 0.39% 136 61763 0.43% 137 67456 0.47% 138 74408 0.52% 139 82470 0.58% 140 91682 0.64% 141 103071 0.72% 142 116541 0.81% 143 134517 0.94% 144 160643 1.12% 145 197206 1.38% 146 250137 1.75% 147 345624 2.42% 148 529167 3.70% 149 1033741 7.22% 150 3943729 27.56% 151 5945447 41.54% 14310981 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=12 prefix-density=0.49 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=278.90 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=1.09 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=50.45 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR7170450 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:37:45 Started mapping on | Feb 12 20:37:45 Finished on | Feb 12 20:39:08 Mapping speed, Million of reads per hour | 620.72 Number of input reads | 14310981 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13626615 Uniquely mapped reads % | 95.22% Average mapped length | 292.82 Number of splices: Total | 13410703 Number of splices: Annotated (sjdb) | 13115787 Number of splices: GT/AG | 13159208 Number of splices: GC/AG | 204384 Number of splices: AT/AC | 7702 Number of splices: Non-canonical | 39409 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357089 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 23585 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336473 336473 336473 N_multimapping 357089 357089 357089 N_noFeature 501064 13374781 587548 N_ambiguous 260524 856 94682 UnstrandedReadsAssigned:12865027 PositiveStrandReadsAssigned:250978 NegativeStrandReadsAssigned:12944385 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170450 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170450-trimmed-pair1.fastq SRR7170450-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,310,981 reads, 12,831,670 reads pseudoaligned [quant] estimated average fragment length: 274.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170450.ke.tsv 34699 SRR7170450.se.tsv 87100 total ==> SRR7170450.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.07 578 22.9905 Potri.005G024800.1.v4.1 1035 761.065 124 11.3027 Potri.004G059700.1.v4.1 961 687.091 13 1.31254 Potri.007G009000.2.v4.1 1416 1142.07 0 0 Potri.003G141000.2.v4.1 2943 2669.07 845.437 21.9738 Potri.016G087400.1.v4.1 270 78.4542 851 752.481 Potri.015G069301.1.v4.1 564 297.088 0 0 Potri.010G195200.1.v4.1 1773 1499.07 37 1.71224 Potri.012G127500.1.v4.1 977 703.081 161 15.8856 ==> SRR7170450.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 647 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7170450 completed mapping pipeline successfully